Лечение сальмонеллеза бактериофагом кому помогло: Бактериофаг сальмонеллезный групп A,B,C,D,E, инструкция по применению, цена, противопоказания и состав

Содержание

Бактериофаг сальмонеллезный групп A,B,C,D,E, инструкция по применению, цена, противопоказания и состав

Array
(
    [ILLNESS] => Array
        (
            [ID] => 89
            [TIMESTAMP_X] => 2013-12-01 02:37:47
            [IBLOCK_ID] => 14
            [NAME] => Профилактика и лечение болезней
            [ACTIVE] => Y
            [SORT] => 55
            [CODE] => ILLNESS
            [DEFAULT_VALUE] => 
            [PROPERTY_TYPE] => E
            [ROW_COUNT] => 1
            [COL_COUNT] => 30
            [LIST_TYPE] => L
            [MULTIPLE] => Y
            [XML_ID] => 
            [FILE_TYPE] => 
            [MULTIPLE_CNT] => 5
            [TMP_ID] => 
            [LINK_IBLOCK_ID] => 23
            [WITH_DESCRIPTION] => N
            [SEARCHABLE] => N
            [FILTRABLE] => N
            [IS_REQUIRED] => N
            [VERSION] => 2
            [USER_TYPE] => 
            [USER_TYPE_SETTINGS] => 
            [HINT] => 
            [VALUE] => Array
                (
                    [0] => 381
                    [1] => 370
                )

            [DESCRIPTION] => Array
                (
                    [0] => 
                    [1] => 
                )

            [~VALUE] => Array
                (
                    [0] => 381
                    [1] => 370
                )

            [~DESCRIPTION] => Array
                (
                    [0] => 
                    [1] => 
                )

            [DISPLAY_VALUE] => Array
                (
                    [0] => Инфекционные болезни
                    [1] => Детские инфекции
                )

            [LINK_ELEMENT_VALUE] => Array
                (
                    [381] => Array
                        (
                            [ID] => 381
                            [~ID] => 381
                            [IBLOCK_ID] => 23
                            [~IBLOCK_ID] => 23
                            [NAME] => Инфекционные болезни
                            [~NAME] => Инфекционные болезни
                            [DETAIL_PAGE_URL] => /
                            [~DETAIL_PAGE_URL] => /
                            [PREVIEW_PICTURE] => 
                            [~PREVIEW_PICTURE] => 
                            [DETAIL_PICTURE] => 
                            [~DETAIL_PICTURE] => 
                            [LANG_DIR] => /
                            [~LANG_DIR] => /
                            [CODE] => infektsionnye-bolezni
                            [~CODE] => infektsionnye-bolezni
                            [EXTERNAL_ID] => 381
                            [~EXTERNAL_ID] => 381
                            [IBLOCK_SECTION_ID] => 
                            [~IBLOCK_SECTION_ID] => 
                            [IBLOCK_TYPE_ID] => services
                            [~IBLOCK_TYPE_ID] => services
                            [IBLOCK_CODE] => illness
                            [~IBLOCK_CODE] => illness
                            [IBLOCK_EXTERNAL_ID] => 
                            [~IBLOCK_EXTERNAL_ID] => 
                            [LID] => s1
                            [~LID] => s1
                        )

                    [370] => Array
                        (
                            [ID] => 370
                            [~ID] => 370
                            [IBLOCK_ID] => 23
                            [~IBLOCK_ID] => 23
                            [NAME] => Детские инфекции
                            [~NAME] => Детские инфекции
                            [DETAIL_PAGE_URL] => /
                            [~DETAIL_PAGE_URL] => /
                            [PREVIEW_PICTURE] => 
                            [~PREVIEW_PICTURE] => 
                            [DETAIL_PICTURE] => 
                            [~DETAIL_PICTURE] => 
                            [LANG_DIR] => /
                            [~LANG_DIR] => /
                            [CODE] => detskie-infektsii
                            [~CODE] => detskie-infektsii
                            [EXTERNAL_ID] => 370
                            [~EXTERNAL_ID] => 370
                            [IBLOCK_SECTION_ID] => 
                            [~IBLOCK_SECTION_ID] => 
                            [IBLOCK_TYPE_ID] => services
                            [~IBLOCK_TYPE_ID] => services
                            [IBLOCK_CODE] => illness
                            [~IBLOCK_CODE] => illness
                            [IBLOCK_EXTERNAL_ID] => 
                            [~IBLOCK_EXTERNAL_ID] => 
                            [LID] => s1
                            [~LID] => s1
                        )

                )

        )

    [PACK] => Array
        (
            [ID] => 70
            [TIMESTAMP_X] => 2013-11-27 14:08:12
            [IBLOCK_ID] => 14
            [NAME] => Тип упаковки
            [ACTIVE] => Y
            [SORT] => 60
            [CODE] => PACK
            [DEFAULT_VALUE] => 
            [PROPERTY_TYPE] => S
            [ROW_COUNT] => 1
            [COL_COUNT] => 30
            [LIST_TYPE] => L
            [MULTIPLE] => N
            [XML_ID] => 
            [FILE_TYPE] => 
            [MULTIPLE_CNT] => 5
            [TMP_ID] => 
            [LINK_IBLOCK_ID] => 0
            [WITH_DESCRIPTION] => N
            [SEARCHABLE] => N
            [FILTRABLE] => N
            [IS_REQUIRED] => N
            [VERSION] => 2
            [USER_TYPE] => 
            [USER_TYPE_SETTINGS] => 
            [HINT] => 
            [VALUE] => Раствор для приема внутрь и ректального введения, фл.
100 мл №1 [DESCRIPTION] => [~VALUE] => Раствор для приема внутрь и ректального введения, фл.100 мл №1 [~DESCRIPTION] => [DISPLAY_VALUE] => Раствор для приема внутрь и ректального введения, фл.100 мл №1 ) [MANUFACTURER] => Array ( [ID] => 72 [TIMESTAMP_X] => 2021-09-21 17:48:56 [IBLOCK_ID] => 14 [NAME] => Производитель [ACTIVE] => Y [SORT] => 70 [CODE] => MANUFACTURER [DEFAULT_VALUE] => [PROPERTY_TYPE] => S [ROW_COUNT] => 1 [COL_COUNT] => 30 [LIST_TYPE] => L [MULTIPLE] => N [XML_ID] => [FILE_TYPE] => [MULTIPLE_CNT] => 5 [TMP_ID] => [LINK_IBLOCK_ID] => 0 [WITH_DESCRIPTION] => N [SEARCHABLE] => N [FILTRABLE] => N [IS_REQUIRED] => N [VERSION] => 2 [USER_TYPE] => HTML [USER_TYPE_SETTINGS] => Array ( [height] => 200 ) [HINT] => [VALUE] => Array ( [TEXT] => Филиал АО "НПО "Микроген" в г. Пермь "Пермское НПО "Биомед"; Филиал АО НПО "Микроген" в г. Н.Новгород НППБП "ИмБио" [TYPE] => TEXT ) [DESCRIPTION] => [~VALUE] => Array ( [TEXT] => Филиал АО "НПО "Микроген" в г. Пермь "Пермское НПО "Биомед"; Филиал АО НПО "Микроген" в г. Н.Новгород НППБП "ИмБио" [TYPE] => TEXT ) [~DESCRIPTION] => [DISPLAY_VALUE] => Филиал АО "НПО "Микроген" в г. Пермь "Пермское НПО "Биомед"; Филиал АО НПО "Микроген" в г. Н.Новгород НППБП "ИмБио" ) [COMPOSITION] => Array ( [ID] => 90 [TIMESTAMP_X] => 2019-05-07 15:22:56 [IBLOCK_ID] => 14 [NAME] => Состав [ACTIVE] => Y [SORT] => 76 [CODE] => COMPOSITION [DEFAULT_VALUE] => [PROPERTY_TYPE] => S [ROW_COUNT] => 1 [COL_COUNT] => 30 [LIST_TYPE] => L [MULTIPLE] => N [XML_ID] => [FILE_TYPE] => [MULTIPLE_CNT] => 5 [TMP_ID] => [LINK_IBLOCK_ID] => 0 [WITH_DESCRIPTION] => N [SEARCHABLE] => N [FILTRABLE] => N [IS_REQUIRED] => N [VERSION] => 2 [USER_TYPE] => HTML [USER_TYPE_SETTINGS] => Array ( [height] => 200 ) [HINT] => [VALUE] => Array ( [TEXT] => <p> Стерильный очищенный фильтрат фаголизатов наиболее распространенных сальмонелл (активность по Аппельману) гр. А - <i>Salmonella paratyphi А</i>; гр. В - <i>S. paratyphi В. S. heiclelherg</i>; гр. С - <i>S. newport, S. choleraesuis, S. oranienburg</i>, <i>S. infantis</i>, rp. D - <i>S. dublin, S. enlerilidis</i>; гр. E - <i>S. anatum, S. newlands</i> - не менее 10<sup>-4</sup>; сальмонелл гр. В - <i>S. typhimurium</i> - не менее 10<sup>-5</sup> - до 1 мл. </p> [TYPE] => HTML ) [DESCRIPTION] => [~VALUE] => Array ( [TEXT] =>

Стерильный очищенный фильтрат фаголизатов наиболее распространенных сальмонелл (активность по Аппельману) гр. А - Salmonella paratyphi А; гр. В -
S. paratyphi В. S. heiclelherg
; гр. С - S. newport, S. choleraesuis, S. oranienburg, S. infantis, rp. D - S. dublin, S. enlerilidis; гр. E - S. anatum, S. newlands - не менее 10-4; сальмонелл гр. В - S. typhimurium - не менее 10-5 - до 1 мл.

[TYPE] => HTML ) [~DESCRIPTION] => [DISPLAY_VALUE] =>

Стерильный очищенный фильтрат фаголизатов наиболее распространенных сальмонелл (активность по Аппельману) гр. А - Salmonella paratyphi А; гр. В - S. paratyphi В. S. heiclelherg; гр. С - S. newport, S. choleraesuis, S. oranienburg, S. infantis, rp. D - S. dublin, S. enlerilidis; гр. E - S. anatum, S. newlands - не менее 10-4; сальмонелл гр. В - S. typhimurium - не менее 10-5 - до 1 мл.

) [F1] => Array ( [ID] => 74 [TIMESTAMP_X] => 2019-04-25 23:54:03 [IBLOCK_ID] => 14 [NAME] => Название [ACTIVE] => Y [SORT] => 80 [CODE] => F1 [DEFAULT_VALUE] => Показания [PROPERTY_TYPE] => S [ROW_COUNT] => 1 [COL_COUNT] => 30 [LIST_TYPE] => L [MULTIPLE] => N [XML_ID] => [FILE_TYPE] => [MULTIPLE_CNT] => 5 [TMP_ID] => [LINK_IBLOCK_ID] => 0 [WITH_DESCRIPTION] => N [SEARCHABLE] => N [FILTRABLE] => N [IS_REQUIRED] => N [VERSION] => 2 [USER_TYPE] => [USER_TYPE_SETTINGS] => [HINT] => [VALUE] => Описание [DESCRIPTION] => [~VALUE] => Описание [~DESCRIPTION] => [DISPLAY_VALUE] => Описание ) [F1_TEXT] => Array ( [ID] => 75 [TIMESTAMP_X] => 2019-02-27 11:26:09 [IBLOCK_ID] => 14 [NAME] => Текст [ACTIVE] => Y [SORT] => 85 [CODE] => F1_TEXT [DEFAULT_VALUE] => [PROPERTY_TYPE] => S [ROW_COUNT] => 1 [COL_COUNT] => 30 [LIST_TYPE] => L [MULTIPLE] => N [XML_ID] => [FILE_TYPE] => [MULTIPLE_CNT] => 5 [TMP_ID] => [LINK_IBLOCK_ID] => 0 [WITH_DESCRIPTION] => N [SEARCHABLE] => N [FILTRABLE] => N [IS_REQUIRED] => N [VERSION] => 2 [USER_TYPE] => HTML [USER_TYPE_SETTINGS] => Array ( [height] => 200 ) [HINT] => [VALUE] => Array ( [TEXT] => <p> Прозрачная жидкость желтого цвета различной интенсивности, возмо­жен зеленоватый оттенок. </p> [TYPE] => HTML ) [DESCRIPTION] => [~VALUE] => Array ( [TEXT] =>

Прозрачная жидкость желтого цвета различной интенсивности, возмо­жен зеленоватый оттенок.

[TYPE] => HTML ) [~DESCRIPTION] => [DISPLAY_VALUE] =>

Прозрачная жидкость желтого цвета различной интенсивности, возмо­жен зеленоватый оттенок.

) [F2] => Array ( [ID] => 76 [TIMESTAMP_X] => 2019-04-25 23:54:03 [IBLOCK_ID] => 14 [NAME] => Название [ACTIVE] => Y [SORT] => 90 [CODE] => F2 [DEFAULT_VALUE] => Применение [PROPERTY_TYPE] => S [ROW_COUNT] => 1 [COL_COUNT] => 30 [LIST_TYPE] => L [MULTIPLE] => N [XML_ID] => [FILE_TYPE] => [MULTIPLE_CNT] => 5 [TMP_ID] => [LINK_IBLOCK_ID] => 0 [WITH_DESCRIPTION] => N [SEARCHABLE] => N [FILTRABLE] => N [IS_REQUIRED] => N [VERSION] => 2 [USER_TYPE] => [USER_TYPE_SETTINGS] => [HINT] => [VALUE] => Фармакологические свойства [DESCRIPTION] => [~VALUE] => Фармакологические свойства [~DESCRIPTION] => [DISPLAY_VALUE] => Фармакологические свойства ) [F2_TEXT] => Array ( [ID] => 77 [TIMESTAMP_X] => 2019-02-27 11:26:09 [IBLOCK_ID] => 14 [NAME] => Текст [ACTIVE] => Y [SORT] => 95 [CODE] => F2_TEXT [DEFAULT_VALUE] => [PROPERTY_TYPE] => S [ROW_COUNT] => 1 [COL_COUNT] => 30 [LIST_TYPE] => L [MULTIPLE] => N [XML_ID] => [FILE_TYPE] => [MULTIPLE_CNT] => 5 [TMP_ID] => [LINK_IBLOCK_ID] => 0 [WITH_DESCRIPTION] => N [SEARCHABLE] => N [FILTRABLE] => N [IS_REQUIRED] => N [VERSION] => 2 [USER_TYPE] => HTML [USER_TYPE_SETTINGS] => Array ( [height] => 200 ) [HINT] => [VALUE] => Array ( [TEXT] => <p> Препарат вызывает специфический лизис сальмо­нелл серотипов: гр. А - <i>S. paratyphi А</i>; гр. В - <i>S. paratyphi В, S. typhimurium, S. heidelberg</i>; гр. С - <i>S. newport, S. choleraesuis, S. oranienburg, S. infantis</i>; rp. D - <i>S. dublin, S. enleritidis</i>: гр. E - <i>S. anatum, S. newlands</i>.<br> </p> [TYPE] => HTML ) [DESCRIPTION] => [~VALUE] => Array ( [TEXT] =>

Препарат вызывает специфический лизис сальмо­нелл серотипов: гр. А - S. paratyphi А; гр. В - S. paratyphi В, S. typhimurium, S. heidelberg; гр. С - S. newport, S. choleraesuis, S. oranienburg, S. infantis; rp. D - S. dublin, S. enleritidis: гр. E - S. anatum, S. newlands.

[TYPE] => HTML ) [~DESCRIPTION] => [DISPLAY_VALUE] =>

Препарат вызывает специфический лизис сальмо­нелл серотипов: гр. А - S. paratyphi А; гр. В - S. paratyphi В, S. typhimurium, S. heidelberg; гр. С - S. newport, S. choleraesuis, S. oranienburg, S. infantis; rp. D - S. dublin, S. enleritidis: гр. E - S. anatum, S. newlands.

) [F3] => Array ( [ID] => 78 [TIMESTAMP_X] => 2019-04-25 23:54:03 [IBLOCK_ID] => 14 [NAME] => Название [ACTIVE] => Y [SORT] => 100 [CODE] => F3 [DEFAULT_VALUE] => Побочные эффекты [PROPERTY_TYPE] => S [ROW_COUNT] => 1 [COL_COUNT] => 30 [LIST_TYPE] => L [MULTIPLE] => N [XML_ID] => [FILE_TYPE] => [MULTIPLE_CNT] => 5 [TMP_ID] => [LINK_IBLOCK_ID] => 0 [WITH_DESCRIPTION] => N [SEARCHABLE] => N [FILTRABLE] => N [IS_REQUIRED] => N [VERSION] => 2 [USER_TYPE] => [USER_TYPE_SETTINGS] => [HINT] => [VALUE] => Показания к применению [DESCRIPTION] => [~VALUE] => Показания к применению [~DESCRIPTION] => [DISPLAY_VALUE] => Показания к применению ) [F3_TEXT] => Array ( [ID] => 79 [TIMESTAMP_X] => 2019-02-27 11:26:09 [IBLOCK_ID] => 14 [NAME] => Текст [ACTIVE] => Y [SORT] => 105 [CODE] => F3_TEXT [DEFAULT_VALUE] => [PROPERTY_TYPE] => S [ROW_COUNT] => 1 [COL_COUNT] => 30 [LIST_TYPE] => L [MULTIPLE] => N [XML_ID] => [FILE_TYPE] => [MULTIPLE_CNT] => 5 [TMP_ID] => [LINK_IBLOCK_ID] => 0 [WITH_DESCRIPTION] => N [SEARCHABLE] => N [FILTRABLE] => N [IS_REQUIRED] => N [VERSION] => 2 [USER_TYPE] => HTML [USER_TYPE_SETTINGS] => Array ( [height] => 200 ) [HINT] => [VALUE] => Array ( [TEXT] => <p> Лечение и профилактика заболеваний и бактерионо­сительства, вызванных сальмонеллами: гр. А - S. paratyphi А; гр. В - S. paratyphi В, S. typhimurium, S. heidelberg; гр. С - S. newport, S. choleraesuis, S. oranienburg, S. infantis; rp. D - S. dublin, S. enleritidis: гр. E - S. anatum, S. newlands. </p> [TYPE] => HTML ) [DESCRIPTION] => [~VALUE] => Array ( [TEXT] =>

Лечение и профилактика заболеваний и бактерионо­сительства, вызванных сальмонеллами: гр. А - S. paratyphi А; гр. В - S. paratyphi В, S. typhimurium, S. heidelberg; гр. С - S. newport, S. choleraesuis, S. oranienburg, S. infantis; rp. D - S. dublin, S. enleritidis: гр. E - S. anatum, S. newlands.

[TYPE] => HTML ) [~DESCRIPTION] => [DISPLAY_VALUE] =>

Лечение и профилактика заболеваний и бактерионо­сительства, вызванных сальмонеллами: гр. А - S. paratyphi А; гр. В - S. paratyphi В, S. typhimurium, S. heidelberg; гр. С - S. newport, S. choleraesuis, S. oranienburg, S. infantis; rp. D - S. dublin, S. enleritidis: гр. E - S. anatum, S. newlands.

) [F4] => Array ( [ID] => 80 [TIMESTAMP_X] => 2019-04-25 23:54:03 [IBLOCK_ID] => 14 [NAME] => Название [ACTIVE] => Y [SORT] => 110 [CODE] => F4 [DEFAULT_VALUE] => Особые указания [PROPERTY_TYPE] => S [ROW_COUNT] => 1 [COL_COUNT] => 30 [LIST_TYPE] => L [MULTIPLE] => N [XML_ID] => [FILE_TYPE] => [MULTIPLE_CNT] => 5 [TMP_ID] => [LINK_IBLOCK_ID] => 0 [WITH_DESCRIPTION] => N [SEARCHABLE] => N [FILTRABLE] => N [IS_REQUIRED] => N [VERSION] => 2 [USER_TYPE] => [USER_TYPE_SETTINGS] => [HINT] => [VALUE] => Противопоказания [DESCRIPTION] => [~VALUE] => Противопоказания [~DESCRIPTION] => [DISPLAY_VALUE] => Противопоказания ) [F4_TEXT] => Array ( [ID] => 81 [TIMESTAMP_X] => 2019-02-27 11:26:09 [IBLOCK_ID] => 14 [NAME] => Текст [ACTIVE] => Y [SORT] => 115 [CODE] => F4_TEXT [DEFAULT_VALUE] => [PROPERTY_TYPE] => S [ROW_COUNT] => 1 [COL_COUNT] => 30 [LIST_TYPE] => L [MULTIPLE] => N [XML_ID] => [FILE_TYPE] => [MULTIPLE_CNT] => 5 [TMP_ID] => [LINK_IBLOCK_ID] => 0 [WITH_DESCRIPTION] => N [SEARCHABLE] => N [FILTRABLE] => N [IS_REQUIRED] => N [VERSION] => 2 [USER_TYPE] => HTML [USER_TYPE_SETTINGS] => Array ( [height] => 200 ) [HINT] => [VALUE] => Array ( [TEXT] => <p> Индивидуальная непереносимость, гиперчувствительпость к компонентам препарата. </p> [TYPE] => HTML ) [DESCRIPTION] => [~VALUE] => Array ( [TEXT] =>

Индивидуальная непереносимость, гиперчувствительпость к компонентам препарата.

[TYPE] => HTML ) [~DESCRIPTION] => [DISPLAY_VALUE] =>

Индивидуальная непереносимость, гиперчувствительпость к компонентам препарата.

) [F5] => Array ( [ID] => 82 [TIMESTAMP_X] => 2013-11-27 14:08:12 [IBLOCK_ID] => 14 [NAME] => Название [ACTIVE] => Y [SORT] => 120 [CODE] => F5 [DEFAULT_VALUE] => Взаимодействие [PROPERTY_TYPE] => S [ROW_COUNT] => 1 [COL_COUNT] => 30 [LIST_TYPE] => L [MULTIPLE] => N [XML_ID] => [FILE_TYPE] => [MULTIPLE_CNT] => 5 [TMP_ID] => [LINK_IBLOCK_ID] => 0 [WITH_DESCRIPTION] => N [SEARCHABLE] => N [FILTRABLE] => N [IS_REQUIRED] => N [VERSION] => 2 [USER_TYPE] => [USER_TYPE_SETTINGS] => [HINT] => [VALUE] => Применение при беременности и в период грудного вскармливания [DESCRIPTION] => [~VALUE] => Применение при беременности и в период грудного вскармливания [~DESCRIPTION] => [DISPLAY_VALUE] => Применение при беременности и в период грудного вскармливания ) [F5_TEXT] => Array ( [ID] => 83 [TIMESTAMP_X] => 2019-02-27 11:26:09 [IBLOCK_ID] => 14 [NAME] => Текст [ACTIVE] => Y [SORT] => 125 [CODE] => F5_TEXT [DEFAULT_VALUE] => [PROPERTY_TYPE] => S [ROW_COUNT] => 1 [COL_COUNT] => 30 [LIST_TYPE] => L [MULTIPLE] => N [XML_ID] => [FILE_TYPE] => [MULTIPLE_CNT] => 5 [TMP_ID] => [LINK_IBLOCK_ID] => 0 [WITH_DESCRIPTION] => N [SEARCHABLE] => N [FILTRABLE] => N [IS_REQUIRED] => N [VERSION] => 2 [USER_TYPE] => HTML [USER_TYPE_SETTINGS] => Array ( [height] => 200 ) [HINT] => [VALUE] => Array ( [TEXT] => <p> Целесооб­разно применение препарата при наличии инфекций, вызванных фагочувствительными штаммами сальмонелл (по рекомендации врача). </p> [TYPE] => HTML ) [DESCRIPTION] => [~VALUE] => Array ( [TEXT] =>

Целесооб­разно применение препарата при наличии инфекций, вызванных фагочувствительными штаммами сальмонелл (по рекомендации врача).

[TYPE] => HTML ) [~DESCRIPTION] => [DISPLAY_VALUE] =>

Целесооб­разно применение препарата при наличии инфекций, вызванных фагочувствительными штаммами сальмонелл (по рекомендации врача).

) [F6] => Array ( [ID] => 84 [TIMESTAMP_X] => 2013-11-27 14:08:12 [IBLOCK_ID] => 14 [NAME] => Название [ACTIVE] => Y [SORT] => 130 [CODE] => F6 [DEFAULT_VALUE] => Передозировка [PROPERTY_TYPE] => S [ROW_COUNT] => 1 [COL_COUNT] => 30 [LIST_TYPE] => L [MULTIPLE] => N [XML_ID] => [FILE_TYPE] => [MULTIPLE_CNT] => 5 [TMP_ID] => [LINK_IBLOCK_ID] => 0 [WITH_DESCRIPTION] => N [SEARCHABLE] => N [FILTRABLE] => N [IS_REQUIRED] => N [VERSION] => 2 [USER_TYPE] => [USER_TYPE_SETTINGS] => [HINT] => [VALUE] => Режим дозирования и способ введения [DESCRIPTION] => [~VALUE] => Режим дозирования и способ введения [~DESCRIPTION] => [DISPLAY_VALUE] => Режим дозирования и способ введения ) [F6_TEXT] => Array ( [ID] => 85 [TIMESTAMP_X] => 2019-02-27 11:26:09 [IBLOCK_ID] => 14 [NAME] => Текст [ACTIVE] => Y [SORT] => 135 [CODE] => F6_TEXT [DEFAULT_VALUE] => [PROPERTY_TYPE] => S [ROW_COUNT] => 1 [COL_COUNT] => 30 [LIST_TYPE] => L [MULTIPLE] => N [XML_ID] => [FILE_TYPE] => [MULTIPLE_CNT] => 5 [TMP_ID] => [LINK_IBLOCK_ID] => 0 [WITH_DESCRIPTION] => N [SEARCHABLE] => N [FILTRABLE] => N [IS_REQUIRED] => N [VERSION] => 2 [USER_TYPE] => HTML [USER_TYPE_SETTINGS] => Array ( [height] => 200 ) [HINT] => [VALUE] => Array ( [TEXT] => <p> Для лечения бактериофаг принимают 3 раза в день через рот за 1 час до приема пищи с первого дня заболевания в течение 7-10 суток. При заболевании, характеризую­щемся слабовыраженным колитическим синдромом, и в период реконвалесценции одно­временно с пероральным применением рекомендуется вводить препарат ректально, в виде клизм, вместо 1 приема через рот. </p> <p> <br> </p> <table> <tbody> <tr> <th rowspan="2"> <p> ВОЗРАСТ ПАЦИЕНТА </p> </th> <th colspan="2"> <p> ДОЗА НА 1 ПРИЕМ (мл) </p> </th> </tr> <tr> <th> <p> ПЕРОРАЛЬНО </p> </th> <th> <p> РЕКТАЛЬНО </p> </th> </tr> <tr> <td> <p> 0 – 6 мес. </p> </td> <td> <p> 5 </p> </td> <td> <p> 10 </p> </td> </tr> <tr> <td> <p> 6 – 12 мес. </p> </td> <td> <p> 10-15 </p> </td> <td> <p> 20 </p> </td> </tr> <tr> <td> <p> от 1 года до 3 лет </p> </td> <td> <p> 15-20 </p> </td> <td> <p> 20-30 </p> </td> </tr> <tr> <td> <p> от 3 до 8 лет </p> </td> <td> <p> 20-30 </p> </td> <td> <p> 30-40 </p> </td> </tr> <tr> <td> <p> от 8 лет и старше </p> </td> <td> <p> 30-40 </p> </td> <td> <p> 50-60 </p> </td> </tr> </tbody> </table> <p> <br> </p> <p> В профилактических целях препарат рекомендуется применять для предупреждения бактерионосительства, внутрибольничной инфекции, во время групповых заболеваний в организованных коллективах и семьях. Оптимальные схемы использования - ежедневный прием разовой дозы в зависимости от возраста. Продолжительность приема препарата определяется условиями эпидситуации. </p> [TYPE] => HTML ) [DESCRIPTION] => [~VALUE] => Array ( [TEXT] =>

Для лечения бактериофаг принимают 3 раза в день через рот за 1 час до приема пищи с первого дня заболевания в течение 7-10 суток. При заболевании, характеризую­щемся слабовыраженным колитическим синдромом, и в период реконвалесценции одно­временно с пероральным применением рекомендуется вводить препарат ректально, в виде клизм, вместо 1 приема через рот.

ВОЗРАСТ ПАЦИЕНТА

ДОЗА НА 1 ПРИЕМ (мл)

ПЕРОРАЛЬНО

РЕКТАЛЬНО

0 – 6 мес.

5

10

6 – 12 мес.

10-15

20

от 1 года до 3 лет

15-20

20-30

от 3 до 8 лет

20-30

30-40

от 8 лет и старше

30-40

50-60

В профилактических целях препарат рекомендуется применять для предупреждения бактерионосительства, внутрибольничной инфекции, во время групповых заболеваний в организованных коллективах и семьях. Оптимальные схемы использования — ежедневный прием разовой дозы в зависимости от возраста. Продолжительность приема препарата определяется условиями эпидситуации.

[TYPE] => HTML ) [~DESCRIPTION] => [DISPLAY_VALUE] =>

Для лечения бактериофаг принимают 3 раза в день через рот за 1 час до приема пищи с первого дня заболевания в течение 7-10 суток. При заболевании, характеризую­щемся слабовыраженным колитическим синдромом, и в период реконвалесценции одно­временно с пероральным применением рекомендуется вводить препарат ректально, в виде клизм, вместо 1 приема через рот.

ВОЗРАСТ ПАЦИЕНТА

ДОЗА НА 1 ПРИЕМ (мл)

ПЕРОРАЛЬНО

РЕКТАЛЬНО

0 – 6 мес.

5

10

6 – 12 мес.

10-15

20

от 1 года до 3 лет

15-20

20-30

от 3 до 8 лет

20-30

30-40

от 8 лет и старше

30-40

50-60

В профилактических целях препарат рекомендуется применять для предупреждения бактерионосительства, внутрибольничной инфекции, во время групповых заболеваний в организованных коллективах и семьях. Оптимальные схемы использования — ежедневный прием разовой дозы в зависимости от возраста. Продолжительность приема препарата определяется условиями эпидситуации.

) [F7] => Array ( [ID] => 86 [TIMESTAMP_X] => 2013-11-27 14:08:12 [IBLOCK_ID] => 14 [NAME] => Название [ACTIVE] => Y [SORT] => 140 [CODE] => F7 [DEFAULT_VALUE] => Условия хранения [PROPERTY_TYPE] => S [ROW_COUNT] => 1 [COL_COUNT] => 30 [LIST_TYPE] => L [MULTIPLE] => N [XML_ID] => [FILE_TYPE] => [MULTIPLE_CNT] => 5 [TMP_ID] => [LINK_IBLOCK_ID] => 0 [WITH_DESCRIPTION] => N [SEARCHABLE] => N [FILTRABLE] => N [IS_REQUIRED] => N [VERSION] => 2 [USER_TYPE] => [USER_TYPE_SETTINGS] => [HINT] => [VALUE] => Побочное действие [DESCRIPTION] => [~VALUE] => Побочное действие [~DESCRIPTION] => [DISPLAY_VALUE] => Побочное действие ) [F7_TEXT] => Array ( [ID] => 87 [TIMESTAMP_X] => 2019-02-27 11:26:09 [IBLOCK_ID] => 14 [NAME] => Текст [ACTIVE] => Y [SORT] => 145 [CODE] => F7_TEXT [DEFAULT_VALUE] => [PROPERTY_TYPE] => S [ROW_COUNT] => 1 [COL_COUNT] => 30 [LIST_TYPE] => L [MULTIPLE] => N [XML_ID] => [FILE_TYPE] => [MULTIPLE_CNT] => 5 [TMP_ID] => [LINK_IBLOCK_ID] => 0 [WITH_DESCRIPTION] => N [SEARCHABLE] => N [FILTRABLE] => N [IS_REQUIRED] => N [VERSION] => 2 [USER_TYPE] => HTML [USER_TYPE_SETTINGS] => Array ( [height] => 200 ) [HINT] => [VALUE] => Array ( [TEXT] => Отсутствует. [TYPE] => HTML ) [DESCRIPTION] => [~VALUE] => Array ( [TEXT] =>

Отсутствует.

[TYPE] => HTML ) [~DESCRIPTION] => [DISPLAY_VALUE] =>

Отсутствует.

) [F8] => Array ( [ID] => 142 [TIMESTAMP_X] => 2019-04-25 23:38:34 [IBLOCK_ID] => 14 [NAME] => Название [ACTIVE] => Y [SORT] => 146 [CODE] => F8 [DEFAULT_VALUE] => [PROPERTY_TYPE] => S [ROW_COUNT] => 1 [COL_COUNT] => 30 [LIST_TYPE] => L [MULTIPLE] => N [XML_ID] => [FILE_TYPE] => [MULTIPLE_CNT] => 5 [TMP_ID] => [LINK_IBLOCK_ID] => 0 [WITH_DESCRIPTION] => N [SEARCHABLE] => N [FILTRABLE] => N [IS_REQUIRED] => N [VERSION] => 2 [USER_TYPE] => [USER_TYPE_SETTINGS] => [HINT] => [VALUE] => Взаимодействие с другими лекарственными препаратами [DESCRIPTION] => [~VALUE] => Взаимодействие с другими лекарственными препаратами [~DESCRIPTION] => [DISPLAY_VALUE] => Взаимодействие с другими лекарственными препаратами ) [F8_TEXT] => Array ( [ID] => 143 [TIMESTAMP_X] => 2019-04-25 23:38:34 [IBLOCK_ID] => 14 [NAME] => Текст [ACTIVE] => Y [SORT] => 147 [CODE] => F8_TEXT [DEFAULT_VALUE] => [PROPERTY_TYPE] => S [ROW_COUNT] => 1 [COL_COUNT] => 30 [LIST_TYPE] => L [MULTIPLE] => N [XML_ID] => [FILE_TYPE] => [MULTIPLE_CNT] => 5 [TMP_ID] => [LINK_IBLOCK_ID] => 0 [WITH_DESCRIPTION] => N [SEARCHABLE] => N [FILTRABLE] => N [IS_REQUIRED] => N [VERSION] => 2 [USER_TYPE] => HTML [USER_TYPE_SETTINGS] => Array ( [height] => 200 ) [HINT] => [VALUE] => Array ( [TEXT] => Применение возможно в сочетании с другими лекарственными средствами, в том числе с антибиотиками. [TYPE] => HTML ) [DESCRIPTION] => [~VALUE] => Array ( [TEXT] =>

Применение возможно в сочетании с другими лекарственными средствами, в том числе с антибиотиками.

[TYPE] => HTML ) [~DESCRIPTION] => [DISPLAY_VALUE] =>

Применение возможно в сочетании с другими лекарственными средствами, в том числе с антибиотиками.

) [F9] => Array ( [ID] => 144 [TIMESTAMP_X] => 2019-04-25 23:54:03 [IBLOCK_ID] => 14 [NAME] => Название [ACTIVE] => Y [SORT] => 148 [CODE] => F9 [DEFAULT_VALUE] => [PROPERTY_TYPE] => S [ROW_COUNT] => 1 [COL_COUNT] => 30 [LIST_TYPE] => L [MULTIPLE] => N [XML_ID] => [FILE_TYPE] => [MULTIPLE_CNT] => 5 [TMP_ID] => [LINK_IBLOCK_ID] => 0 [WITH_DESCRIPTION] => N [SEARCHABLE] => N [FILTRABLE] => N [IS_REQUIRED] => N [VERSION] => 2 [USER_TYPE] => [USER_TYPE_SETTINGS] => [HINT] => [VALUE] => Указания по применению [DESCRIPTION] => [~VALUE] => Указания по применению [~DESCRIPTION] => [DISPLAY_VALUE] => Указания по применению ) [F9_TEXT] => Array ( [ID] => 145 [TIMESTAMP_X] => 2019-04-25 23:54:03 [IBLOCK_ID] => 14 [NAME] => Текст [ACTIVE] => Y [SORT] => 149 [CODE] => F9_TEXT [DEFAULT_VALUE] => [PROPERTY_TYPE] => S [ROW_COUNT] => 1 [COL_COUNT] => 30 [LIST_TYPE] => L [MULTIPLE] => N [XML_ID] => [FILE_TYPE] => [MULTIPLE_CNT] => 5 [TMP_ID] => [LINK_IBLOCK_ID] => 0 [WITH_DESCRIPTION] => N [SEARCHABLE] => N [FILTRABLE] => N [IS_REQUIRED] => N [VERSION] => 2 [USER_TYPE] => HTML [USER_TYPE_SETTINGS] => Array ( [height] => 200 ) [HINT] => [VALUE] => Array ( [TEXT] => Важным условием эффективной фаготерапии является предвари­тельное определение чувствительности возбудителя к бактериофагу и раннее применение препарата. Не пригоден к применению препарат во флаконах с нарушенной целостностью или маркировкой, при истекшем сроке годности, при помутнении. Вследствие содержания в препарате питательной среды, в которой могут развиваться бактерии из окружающей среды, вызывая помутнение препарата, необходимо при вскры­тии флакона соблюдать следующие правила:  тщательно мыть руки; обработать колпачок спиртсодержащим раствором; сиять колпачок не открывая пробки; не класть пробку внутренней поверхностью на стол или другие предметы; не оставлять флакон открытым; вскрытый флакон хранить только в холодильнике. Перед использованием флакон с бактериофагом необходимо встряхнуть и просмот­реть. Препарат должен быть прозрачным и не содержать осадка. Вскрытие флакона и извлечение необходимого объема препарата может проводиться стерильным шприцем путем прокола пробки. Препарат из вскрытого флакона при соблю­дении условий хранения, вышеперечисленных правил и отсутствии помутнения, может быть использован в течение всего срока годности. [TYPE] => HTML ) [DESCRIPTION] => [~VALUE] => Array ( [TEXT] =>

Важным условием эффективной фаготерапии является предвари­тельное определение чувствительности возбудителя к бактериофагу и раннее применение препарата.

Не пригоден к применению препарат во флаконах с нарушенной целостностью или маркировкой, при истекшем сроке годности, при помутнении.

Вследствие содержания в препарате питательной среды, в которой могут развиваться бактерии из окружающей среды, вызывая помутнение препарата, необходимо при вскры­тии флакона соблюдать следующие правила: 

  • тщательно мыть руки;
  • обработать колпачок спиртсодержащим раствором; сиять колпачок не открывая пробки;

  • не класть пробку внутренней поверхностью на стол или другие предметы;

  • не оставлять флакон открытым;

  • вскрытый флакон хранить только в холодильнике.

Перед использованием флакон с бактериофагом необходимо встряхнуть и просмот­реть. Препарат должен быть прозрачным и не содержать осадка.

Вскрытие флакона и извлечение необходимого объема препарата может проводиться стерильным шприцем путем прокола пробки. Препарат из вскрытого флакона при соблю­дении условий хранения, вышеперечисленных правил и отсутствии помутнения, может быть использован в течение всего срока годности.

[TYPE] => HTML ) [~DESCRIPTION] => [DISPLAY_VALUE] =>

Важным условием эффективной фаготерапии является предвари­тельное определение чувствительности возбудителя к бактериофагу и раннее применение препарата.

Не пригоден к применению препарат во флаконах с нарушенной целостностью или маркировкой, при истекшем сроке годности, при помутнении.

Вследствие содержания в препарате питательной среды, в которой могут развиваться бактерии из окружающей среды, вызывая помутнение препарата, необходимо при вскры­тии флакона соблюдать следующие правила: 

  • тщательно мыть руки;
  • обработать колпачок спиртсодержащим раствором; сиять колпачок не открывая пробки;

  • не класть пробку внутренней поверхностью на стол или другие предметы;

  • не оставлять флакон открытым;

  • вскрытый флакон хранить только в холодильнике.

Перед использованием флакон с бактериофагом необходимо встряхнуть и просмот­реть. Препарат должен быть прозрачным и не содержать осадка.

Вскрытие флакона и извлечение необходимого объема препарата может проводиться стерильным шприцем путем прокола пробки. Препарат из вскрытого флакона при соблю­дении условий хранения, вышеперечисленных правил и отсутствии помутнения, может быть использован в течение всего срока годности.

) [F10] => Array ( [ID] => 146 [TIMESTAMP_X] => 2019-04-25 23:54:03 [IBLOCK_ID] => 14 [NAME] => Название [ACTIVE] => Y [SORT] => 150 [CODE] => F10 [DEFAULT_VALUE] => [PROPERTY_TYPE] => S [ROW_COUNT] => 1 [COL_COUNT] => 30 [LIST_TYPE] => L [MULTIPLE] => N [XML_ID] => [FILE_TYPE] => [MULTIPLE_CNT] => 5 [TMP_ID] => [LINK_IBLOCK_ID] => 0 [WITH_DESCRIPTION] => N [SEARCHABLE] => N [FILTRABLE] => N [IS_REQUIRED] => N [VERSION] => 2 [USER_TYPE] => [USER_TYPE_SETTINGS] => [HINT] => [VALUE] => Условия хранения [DESCRIPTION] => [~VALUE] => Условия хранения [~DESCRIPTION] => [DISPLAY_VALUE] => Условия хранения ) [F10_TEXT] => Array ( [ID] => 147 [TIMESTAMP_X] => 2019-04-25 23:55:40 [IBLOCK_ID] => 14 [NAME] => Текст [ACTIVE] => Y [SORT] => 151 [CODE] => F10_TEXT [DEFAULT_VALUE] => [PROPERTY_TYPE] => S [ROW_COUNT] => 1 [COL_COUNT] => 30 [LIST_TYPE] => L [MULTIPLE] => N [XML_ID] => [FILE_TYPE] => [MULTIPLE_CNT] => 5 [TMP_ID] => [LINK_IBLOCK_ID] => 0 [WITH_DESCRIPTION] => N [SEARCHABLE] => N [FILTRABLE] => N [IS_REQUIRED] => N [VERSION] => 2 [USER_TYPE] => HTML [USER_TYPE_SETTINGS] => Array ( [height] => 200 ) [HINT] => [VALUE] => Array ( [TEXT] => При температуре от 2 до 8°С в защищенном от света и недоступном для детей месте. [TYPE] => HTML ) [DESCRIPTION] => [~VALUE] => Array ( [TEXT] =>

При температуре от 2 до 8°С в защищенном от света и недоступном для детей месте.

[TYPE] => HTML ) [~DESCRIPTION] => [DISPLAY_VALUE] =>

При температуре от 2 до 8°С в защищенном от света и недоступном для детей месте.

) [F11] => Array ( [ID] => 148 [TIMESTAMP_X] => 2019-04-25 23:54:03 [IBLOCK_ID] => 14 [NAME] => Название [ACTIVE] => Y [SORT] => 152 [CODE] => F11 [DEFAULT_VALUE] => [PROPERTY_TYPE] => S [ROW_COUNT] => 1 [COL_COUNT] => 30 [LIST_TYPE] => L [MULTIPLE] => N [XML_ID] => [FILE_TYPE] => [MULTIPLE_CNT] => 5 [TMP_ID] => [LINK_IBLOCK_ID] => 0 [WITH_DESCRIPTION] => N [SEARCHABLE] => N [FILTRABLE] => N [IS_REQUIRED] => N [VERSION] => 2 [USER_TYPE] => [USER_TYPE_SETTINGS] => [HINT] => [VALUE] => Условия транспортирования [DESCRIPTION] => [~VALUE] => Условия транспортирования [~DESCRIPTION] => [DISPLAY_VALUE] => Условия транспортирования ) [F11_TEXT] => Array ( [ID] => 149 [TIMESTAMP_X] => 2019-04-25 23:55:40 [IBLOCK_ID] => 14 [NAME] => Текст [ACTIVE] => Y [SORT] => 153 [CODE] => F11_TEXT [DEFAULT_VALUE] => [PROPERTY_TYPE] => S [ROW_COUNT] => 1 [COL_COUNT] => 30 [LIST_TYPE] => L [MULTIPLE] => N [XML_ID] => [FILE_TYPE] => [MULTIPLE_CNT] => 5 [TMP_ID] => [LINK_IBLOCK_ID] => 0 [WITH_DESCRIPTION] => N [SEARCHABLE] => N [FILTRABLE] => N [IS_REQUIRED] => N [VERSION] => 2 [USER_TYPE] => HTML [USER_TYPE_SETTINGS] => Array ( [height] => 200 ) [HINT] => [VALUE] => Array ( [TEXT] => При температуре от 2 до 8°С, допускается транспортирование при температуре от 9 до 25°С не более 1 мес. [TYPE] => HTML ) [DESCRIPTION] => [~VALUE] => Array ( [TEXT] =>

При температуре от 2 до 8°С, допускается транспортирование при температуре от 9 до 25°С не более 1 мес.

[TYPE] => HTML ) [~DESCRIPTION] => [DISPLAY_VALUE] =>

При температуре от 2 до 8°С, допускается транспортирование при температуре от 9 до 25°С не более 1 мес.

) [F12] => Array ( [ID] => 150 [TIMESTAMP_X] => 2019-04-25 23:54:03 [IBLOCK_ID] => 14 [NAME] => Название [ACTIVE] => Y [SORT] => 154 [CODE] => F12 [DEFAULT_VALUE] => [PROPERTY_TYPE] => S [ROW_COUNT] => 1 [COL_COUNT] => 30 [LIST_TYPE] => L [MULTIPLE] => N [XML_ID] => [FILE_TYPE] => [MULTIPLE_CNT] => 5 [TMP_ID] => [LINK_IBLOCK_ID] => 0 [WITH_DESCRIPTION] => N [SEARCHABLE] => N [FILTRABLE] => N [IS_REQUIRED] => N [VERSION] => 2 [USER_TYPE] => [USER_TYPE_SETTINGS] => [HINT] => [VALUE] => Срок годности [DESCRIPTION] => [~VALUE] => Срок годности [~DESCRIPTION] => [DISPLAY_VALUE] => Срок годности ) [F12_TEXT] => Array ( [ID] => 151 [TIMESTAMP_X] => 2019-04-25 23:55:40 [IBLOCK_ID] => 14 [NAME] => Текст [ACTIVE] => Y [SORT] => 155 [CODE] => F12_TEXT [DEFAULT_VALUE] => [PROPERTY_TYPE] => S [ROW_COUNT] => 1 [COL_COUNT] => 30 [LIST_TYPE] => L [MULTIPLE] => N [XML_ID] => [FILE_TYPE] => [MULTIPLE_CNT] => 5 [TMP_ID] => [LINK_IBLOCK_ID] => 0 [WITH_DESCRIPTION] => N [SEARCHABLE] => N [FILTRABLE] => N [IS_REQUIRED] => N [VERSION] => 2 [USER_TYPE] => HTML [USER_TYPE_SETTINGS] => Array ( [height] => 200 ) [HINT] => [VALUE] => Array ( [TEXT] => Срок годности 2 года. Не применять по истечении срока годности препарата. [TYPE] => HTML ) [DESCRIPTION] => [~VALUE] => Array ( [TEXT] =>

Срок годности 2 года. Не применять по истечении срока годности препарата.

[TYPE] => HTML ) [~DESCRIPTION] => [DISPLAY_VALUE] =>

Срок годности 2 года. Не применять по истечении срока годности препарата.

) [F13] => Array ( [ID] => 152 [TIMESTAMP_X] => 2019-04-25 23:54:03 [IBLOCK_ID] => 14 [NAME] => Название [ACTIVE] => Y [SORT] => 156 [CODE] => F13 [DEFAULT_VALUE] => [PROPERTY_TYPE] => S [ROW_COUNT] => 1 [COL_COUNT] => 30 [LIST_TYPE] => L [MULTIPLE] => N [XML_ID] => [FILE_TYPE] => [MULTIPLE_CNT] => 5 [TMP_ID] => [LINK_IBLOCK_ID] => 0 [WITH_DESCRIPTION] => N [SEARCHABLE] => N [FILTRABLE] => N [IS_REQUIRED] => N [VERSION] => 2 [USER_TYPE] => [USER_TYPE_SETTINGS] => [HINT] => [VALUE] => Условия отпуска [DESCRIPTION] => [~VALUE] => Условия отпуска [~DESCRIPTION] => [DISPLAY_VALUE] => Условия отпуска ) [F13_TEXT] => Array ( [ID] => 153 [TIMESTAMP_X] => 2019-04-25 23:55:40 [IBLOCK_ID] => 14 [NAME] => Текст [ACTIVE] => Y [SORT] => 157 [CODE] => F13_TEXT [DEFAULT_VALUE] => [PROPERTY_TYPE] => S [ROW_COUNT] => 1 [COL_COUNT] => 30 [LIST_TYPE] => L [MULTIPLE] => N [XML_ID] => [FILE_TYPE] => [MULTIPLE_CNT] => 5 [TMP_ID] => [LINK_IBLOCK_ID] => 0 [WITH_DESCRIPTION] => N [SEARCHABLE] => N [FILTRABLE] => N [IS_REQUIRED] => N [VERSION] => 2 [USER_TYPE] => HTML [USER_TYPE_SETTINGS] => Array ( [height] => 200 ) [HINT] => [VALUE] => Array ( [TEXT] => Отпускают без рецепта. [TYPE] => HTML ) [DESCRIPTION] => [~VALUE] => Array ( [TEXT] =>

Отпускают без рецепта.

[TYPE] => HTML ) [~DESCRIPTION] => [DISPLAY_VALUE] =>

Отпускают без рецепта.

) [F14] => Array ( [ID] => 154 [TIMESTAMP_X] => 2019-04-25 23:54:03 [IBLOCK_ID] => 14 [NAME] => Название [ACTIVE] => Y [SORT] => 158 [CODE] => F14 [DEFAULT_VALUE] => [PROPERTY_TYPE] => S [ROW_COUNT] => 1 [COL_COUNT] => 30 [LIST_TYPE] => L [MULTIPLE] => N [XML_ID] => [FILE_TYPE] => [MULTIPLE_CNT] => 5 [TMP_ID] => [LINK_IBLOCK_ID] => 0 [WITH_DESCRIPTION] => N [SEARCHABLE] => N [FILTRABLE] => N [IS_REQUIRED] => N [VERSION] => 2 [USER_TYPE] => [USER_TYPE_SETTINGS] => [HINT] => [VALUE] => Где купить [DESCRIPTION] => [~VALUE] => Где купить [~DESCRIPTION] => [DISPLAY_VALUE] => Где купить ) [F14_TEXT] => Array ( [ID] => 155 [TIMESTAMP_X] => 2019-04-25 23:55:40 [IBLOCK_ID] => 14 [NAME] => Текст [ACTIVE] => Y [SORT] => 159 [CODE] => F14_TEXT [DEFAULT_VALUE] => [PROPERTY_TYPE] => S [ROW_COUNT] => 1 [COL_COUNT] => 30 [LIST_TYPE] => L [MULTIPLE] => N [XML_ID] => [FILE_TYPE] => [MULTIPLE_CNT] => 5 [TMP_ID] => [LINK_IBLOCK_ID] => 0 [WITH_DESCRIPTION] => N [SEARCHABLE] => N [FILTRABLE] => N [IS_REQUIRED] => N [VERSION] => 2 [USER_TYPE] => HTML [USER_TYPE_SETTINGS] => Array ( [height] => 200 ) [HINT] => [VALUE] => Array ( [TEXT] => Узнать цены и купить Бактериофаг сальмонеллезный групп A,B,C,D,E в аптеках вашего города. Воспользуйтесь сайтом для поиска или сервисом заказа лекарств в аптеку. [TYPE] => HTML ) [DESCRIPTION] => [~VALUE] => Array ( [TEXT] =>

Узнать цены и купить Бактериофаг сальмонеллезный групп A,B,C,D,E в аптеках вашего города.

Воспользуйтесь сайтом для поиска или сервисом заказа лекарств в аптеку.

[TYPE] => HTML ) [~DESCRIPTION] => [DISPLAY_VALUE] =>

Узнать цены и купить Бактериофаг сальмонеллезный групп A,B,C,D,E в аптеках вашего города.

Воспользуйтесь сайтом для поиска или сервисом заказа лекарств в аптеку.

) [F15] => Array ( [ID] => 156 [TIMESTAMP_X] => 2019-05-13 01:00:59 [IBLOCK_ID] => 14 [NAME] => Название [ACTIVE] => Y [SORT] => 160 [CODE] => F15 [DEFAULT_VALUE] => [PROPERTY_TYPE] => S [ROW_COUNT] => 1 [COL_COUNT] => 30 [LIST_TYPE] => L [MULTIPLE] => N [XML_ID] => [FILE_TYPE] => [MULTIPLE_CNT] => 5 [TMP_ID] => [LINK_IBLOCK_ID] => 0 [WITH_DESCRIPTION] => N [SEARCHABLE] => N [FILTRABLE] => N [IS_REQUIRED] => N [VERSION] => 2 [USER_TYPE] => [USER_TYPE_SETTINGS] => [HINT] => [VALUE] => Инструкция по применению [DESCRIPTION] => [~VALUE] => Инструкция по применению [~DESCRIPTION] => [DISPLAY_VALUE] => Инструкция по применению ) [F15_TEXT] => Array ( [ID] => 157 [TIMESTAMP_X] => 2019-04-25 23:55:40 [IBLOCK_ID] => 14 [NAME] => Текст [ACTIVE] => Y [SORT] => 161 [CODE] => F15_TEXT [DEFAULT_VALUE] => [PROPERTY_TYPE] => S [ROW_COUNT] => 1 [COL_COUNT] => 30 [LIST_TYPE] => L [MULTIPLE] => N [XML_ID] => [FILE_TYPE] => [MULTIPLE_CNT] => 5 [TMP_ID] => [LINK_IBLOCK_ID] => 0 [WITH_DESCRIPTION] => N [SEARCHABLE] => N [FILTRABLE] => N [IS_REQUIRED] => N [VERSION] => 2 [USER_TYPE] => HTML [USER_TYPE_SETTINGS] => Array ( [height] => 200 ) [HINT] => [VALUE] => Array ( [TEXT] => a.pdf { text-decoration: none; } a.pdf:hover { color: #1FBDA5; text-decoration: none; } Скачать инструкциюпо применению [TYPE] => HTML ) [DESCRIPTION] => [~VALUE] => Array ( [TEXT] =>


Скачать инструкцию
по применению

[TYPE] => HTML ) [~DESCRIPTION] => [DISPLAY_VALUE] =>


Скачать инструкцию
по применению

) [GERM] => Array ( [ID] => 141 [TIMESTAMP_X] => 2019-03-26 16:46:33 [IBLOCK_ID] => 14 [NAME] => Виды бактерий [ACTIVE] => Y [SORT] => 500 [CODE] => GERM [DEFAULT_VALUE] => [PROPERTY_TYPE] => E [ROW_COUNT] => 1 [COL_COUNT] => 30 [LIST_TYPE] => L [MULTIPLE] => Y [XML_ID] => [FILE_TYPE] => [MULTIPLE_CNT] => 5 [TMP_ID] => [LINK_IBLOCK_ID] => 38 [WITH_DESCRIPTION] => N [SEARCHABLE] => N [FILTRABLE] => N [IS_REQUIRED] => N [VERSION] => 2 [USER_TYPE] => [USER_TYPE_SETTINGS] => [HINT] => [VALUE] => Array ( [0] => 656 [1] => 657 [2] => 658 [3] => 659 [4] => 660 ) [DESCRIPTION] => Array ( [0] => [1] => [2] => [3] => [4] => ) [~VALUE] => Array ( [0] => 656 [1] => 657 [2] => 658 [3] => 659 [4] => 660 ) [~DESCRIPTION] => Array ( [0] => [1] => [2] => [3] => [4] => ) [DISPLAY_VALUE] => Array ( [0] => Сальмонелла серогруппы А [1] => Сальмонелла серогруппы B [2] => Сальмонелла серогруппы С [3] => Сальмонелла серогруппы D [4] => Сальмонелла серогруппы E ) [LINK_ELEMENT_VALUE] => Array ( [656] => Array ( [ID] => 656 [~ID] => 656 [IBLOCK_ID] => 38 [~IBLOCK_ID] => 38 [NAME] => Сальмонелла серогруппы А [~NAME] => Сальмонелла серогруппы А [DETAIL_PAGE_URL] => [~DETAIL_PAGE_URL] => [PREVIEW_PICTURE] => [~PREVIEW_PICTURE] => [DETAIL_PICTURE] => [~DETAIL_PICTURE] => [LANG_DIR] => / [~LANG_DIR] => / [CODE] => salmonella-serogruppy-a [~CODE] => salmonella-serogruppy-a [EXTERNAL_ID] => 656 [~EXTERNAL_ID] => 656 [IBLOCK_SECTION_ID] => [~IBLOCK_SECTION_ID] => [IBLOCK_TYPE_ID] => catalog [~IBLOCK_TYPE_ID] => catalog [IBLOCK_CODE] => [~IBLOCK_CODE] => [IBLOCK_EXTERNAL_ID] => [~IBLOCK_EXTERNAL_ID] => [LID] => s1 [~LID] => s1 ) [657] => Array ( [ID] => 657 [~ID] => 657 [IBLOCK_ID] => 38 [~IBLOCK_ID] => 38 [NAME] => Сальмонелла серогруппы B [~NAME] => Сальмонелла серогруппы B [DETAIL_PAGE_URL] => [~DETAIL_PAGE_URL] => [PREVIEW_PICTURE] => [~PREVIEW_PICTURE] => [DETAIL_PICTURE] => [~DETAIL_PICTURE] => [LANG_DIR] => / [~LANG_DIR] => / [CODE] => salmonella-serogruppy-b [~CODE] => salmonella-serogruppy-b [EXTERNAL_ID] => 657 [~EXTERNAL_ID] => 657 [IBLOCK_SECTION_ID] => [~IBLOCK_SECTION_ID] => [IBLOCK_TYPE_ID] => catalog [~IBLOCK_TYPE_ID] => catalog [IBLOCK_CODE] => [~IBLOCK_CODE] => [IBLOCK_EXTERNAL_ID] => [~IBLOCK_EXTERNAL_ID] => [LID] => s1 [~LID] => s1 ) [658] => Array ( [ID] => 658 [~ID] => 658 [IBLOCK_ID] => 38 [~IBLOCK_ID] => 38 [NAME] => Сальмонелла серогруппы С [~NAME] => Сальмонелла серогруппы С [DETAIL_PAGE_URL] => [~DETAIL_PAGE_URL] => [PREVIEW_PICTURE] => [~PREVIEW_PICTURE] => [DETAIL_PICTURE] => [~DETAIL_PICTURE] => [LANG_DIR] => / [~LANG_DIR] => / [CODE] => salmonella-serogruppy-s [~CODE] => salmonella-serogruppy-s [EXTERNAL_ID] => 658 [~EXTERNAL_ID] => 658 [IBLOCK_SECTION_ID] => [~IBLOCK_SECTION_ID] => [IBLOCK_TYPE_ID] => catalog [~IBLOCK_TYPE_ID] => catalog [IBLOCK_CODE] => [~IBLOCK_CODE] => [IBLOCK_EXTERNAL_ID] => [~IBLOCK_EXTERNAL_ID] => [LID] => s1 [~LID] => s1 ) [659] => Array ( [ID] => 659 [~ID] => 659 [IBLOCK_ID] => 38 [~IBLOCK_ID] => 38 [NAME] => Сальмонелла серогруппы D [~NAME] => Сальмонелла серогруппы D [DETAIL_PAGE_URL] => [~DETAIL_PAGE_URL] => [PREVIEW_PICTURE] => [~PREVIEW_PICTURE] => [DETAIL_PICTURE] => [~DETAIL_PICTURE] => [LANG_DIR] => / [~LANG_DIR] => / [CODE] => salmonella-serogruppy-d [~CODE] => salmonella-serogruppy-d [EXTERNAL_ID] => 659 [~EXTERNAL_ID] => 659 [IBLOCK_SECTION_ID] => [~IBLOCK_SECTION_ID] => [IBLOCK_TYPE_ID] => catalog [~IBLOCK_TYPE_ID] => catalog [IBLOCK_CODE] => [~IBLOCK_CODE] => [IBLOCK_EXTERNAL_ID] => [~IBLOCK_EXTERNAL_ID] => [LID] => s1 [~LID] => s1 ) [660] => Array ( [ID] => 660 [~ID] => 660 [IBLOCK_ID] => 38 [~IBLOCK_ID] => 38 [NAME] => Сальмонелла серогруппы E [~NAME] => Сальмонелла серогруппы E [DETAIL_PAGE_URL] => [~DETAIL_PAGE_URL] => [PREVIEW_PICTURE] => [~PREVIEW_PICTURE] => [DETAIL_PICTURE] => [~DETAIL_PICTURE] => [LANG_DIR] => / [~LANG_DIR] => / [CODE] => salmonella-serogruppy-e [~CODE] => salmonella-serogruppy-e [EXTERNAL_ID] => 660 [~EXTERNAL_ID] => 660 [IBLOCK_SECTION_ID] => [~IBLOCK_SECTION_ID] => [IBLOCK_TYPE_ID] => catalog [~IBLOCK_TYPE_ID] => catalog [IBLOCK_CODE] => [~IBLOCK_CODE] => [IBLOCK_EXTERNAL_ID] => [~IBLOCK_EXTERNAL_ID] => [LID] => s1 [~LID] => s1 ) ) ) [CITY] => Array ( [ID] => 139 [TIMESTAMP_X] => 2019-03-14 09:16:21 [IBLOCK_ID] => 14 [NAME] => Город производства [ACTIVE] => Y [SORT] => 500 [CODE] => CITY [DEFAULT_VALUE] => [PROPERTY_TYPE] => E [ROW_COUNT] => 1 [COL_COUNT] => 30 [LIST_TYPE] => L [MULTIPLE] => Y [XML_ID] => [FILE_TYPE] => [MULTIPLE_CNT] => 5 [TMP_ID] => [LINK_IBLOCK_ID] => 37 [WITH_DESCRIPTION] => N [SEARCHABLE] => N [FILTRABLE] => N [IS_REQUIRED] => N [VERSION] => 2 [USER_TYPE] => [USER_TYPE_SETTINGS] => [HINT] => [VALUE] => Array ( [0] => 644 [1] => 643 ) [DESCRIPTION] => Array ( [0] => [1] => ) [~VALUE] => Array ( [0] => 644 [1] => 643 ) [~DESCRIPTION] => Array ( [0] => [1] => ) [DISPLAY_VALUE] => Array ( [0] => Нижний Новгород [1] => Пермь ) [LINK_ELEMENT_VALUE] => Array ( [644] => Array ( [ID] => 644 [~ID] => 644 [IBLOCK_ID] => 37 [~IBLOCK_ID] => 37 [NAME] => Нижний Новгород [~NAME] => Нижний Новгород [DETAIL_PAGE_URL] => [~DETAIL_PAGE_URL] => [PREVIEW_PICTURE] => [~PREVIEW_PICTURE] => [DETAIL_PICTURE] => [~DETAIL_PICTURE] => [LANG_DIR] => / [~LANG_DIR] => / [CODE] => nizhniy-novgorod [~CODE] => nizhniy-novgorod [EXTERNAL_ID] => 644 [~EXTERNAL_ID] => 644 [IBLOCK_SECTION_ID] => [~IBLOCK_SECTION_ID] => [IBLOCK_TYPE_ID] => catalog [~IBLOCK_TYPE_ID] => catalog [IBLOCK_CODE] => [~IBLOCK_CODE] => [IBLOCK_EXTERNAL_ID] => [~IBLOCK_EXTERNAL_ID] => [LID] => s1 [~LID] => s1 ) [643] => Array ( [ID] => 643 [~ID] => 643 [IBLOCK_ID] => 37 [~IBLOCK_ID] => 37 [NAME] => Пермь [~NAME] => Пермь [DETAIL_PAGE_URL] => [~DETAIL_PAGE_URL] => [PREVIEW_PICTURE] => [~PREVIEW_PICTURE] => [DETAIL_PICTURE] => [~DETAIL_PICTURE] => [LANG_DIR] => / [~LANG_DIR] => / [CODE] => perm [~CODE] => perm [EXTERNAL_ID] => 643 [~EXTERNAL_ID] => 643 [IBLOCK_SECTION_ID] => [~IBLOCK_SECTION_ID] => [IBLOCK_TYPE_ID] => catalog [~IBLOCK_TYPE_ID] => catalog [IBLOCK_CODE] => [~IBLOCK_CODE] => [IBLOCK_EXTERNAL_ID] => [~IBLOCK_EXTERNAL_ID] => [LID] => s1 [~LID] => s1 ) ) ) )

Описание

Прозрачная жидкость желтого цвета различной интенсивности, возмо­жен зеленоватый оттенок.

Фармакологические свойства

Препарат вызывает специфический лизис сальмо­нелл серотипов: гр. А — S. paratyphi А; гр. В — S. paratyphi В, S. typhimurium, S. heidelberg; гр. С — S. newport, S. choleraesuis, S. oranienburg, S. infantis; rp. D — S. dublin, S. enleritidis: гр. E — S. anatum, S. newlands.

Показания к применению

Лечение и профилактика заболеваний и бактерионо­сительства, вызванных сальмонеллами: гр. А — S. paratyphi А; гр. В — S. paratyphi В, S. typhimurium, S. heidelberg; гр. С — S. newport, S. choleraesuis, S. oranienburg, S. infantis; rp. D — S. dublin, S. enleritidis: гр. E — S. anatum, S. newlands.

Противопоказания

Индивидуальная непереносимость, гиперчувствительпость к компонентам препарата.

Применение при беременности и в период грудного вскармливания

Целесооб­разно применение препарата при наличии инфекций, вызванных фагочувствительными штаммами сальмонелл (по рекомендации врача).

Режим дозирования и способ введения

Для лечения бактериофаг принимают 3 раза в день через рот за 1 час до приема пищи с первого дня заболевания в течение 7-10 суток. При заболевании, характеризую­щемся слабовыраженным колитическим синдромом, и в период реконвалесценции одно­временно с пероральным применением рекомендуется вводить препарат ректально, в виде клизм, вместо 1 приема через рот.

ВОЗРАСТ ПАЦИЕНТА

ДОЗА НА 1 ПРИЕМ (мл)

ПЕРОРАЛЬНО

РЕКТАЛЬНО

0 – 6 мес.

5

10

6 – 12 мес.

10-15

20

от 1 года до 3 лет

15-20

20-30

от 3 до 8 лет

20-30

30-40

от 8 лет и старше

30-40

50-60

В профилактических целях препарат рекомендуется применять для предупреждения бактерионосительства, внутрибольничной инфекции, во время групповых заболеваний в организованных коллективах и семьях. Оптимальные схемы использования — ежедневный прием разовой дозы в зависимости от возраста. Продолжительность приема препарата определяется условиями эпидситуации.

Побочное действие

Взаимодействие с другими лекарственными препаратами

Применение возможно в сочетании с другими лекарственными средствами, в том числе с антибиотиками.

Указания по применению

Важным условием эффективной фаготерапии является предвари­тельное определение чувствительности возбудителя к бактериофагу и раннее применение препарата.

Не пригоден к применению препарат во флаконах с нарушенной целостностью или маркировкой, при истекшем сроке годности, при помутнении.

Вследствие содержания в препарате питательной среды, в которой могут развиваться бактерии из окружающей среды, вызывая помутнение препарата, необходимо при вскры­тии флакона соблюдать следующие правила: 

  • тщательно мыть руки;
  • обработать колпачок спиртсодержащим раствором; сиять колпачок не открывая пробки;

  • не класть пробку внутренней поверхностью на стол или другие предметы;

  • не оставлять флакон открытым;

  • вскрытый флакон хранить только в холодильнике.

Перед использованием флакон с бактериофагом необходимо встряхнуть и просмот­реть. Препарат должен быть прозрачным и не содержать осадка.

Вскрытие флакона и извлечение необходимого объема препарата может проводиться стерильным шприцем путем прокола пробки. Препарат из вскрытого флакона при соблю­дении условий хранения, вышеперечисленных правил и отсутствии помутнения, может быть использован в течение всего срока годности.

Условия хранения

При температуре от 2 до 8°С в защищенном от света и недоступном для детей месте.

Условия транспортирования

При температуре от 2 до 8°С, допускается транспортирование при температуре от 9 до 25°С не более 1 мес.

Срок годности

Срок годности 2 года. Не применять по истечении срока годности препарата.

Условия отпуска

Отпускают без рецепта.

Бактериофаги: медицина будущего

На днях начал работу первый в России Биологический ресурсный центр исследования бактериофагов – вирусов, поражающих бактерии. Новая структура создана на базе компании «Микроген», входящей в холдинг «Нацимбио» Госкорпорации Ростех.

Центр станет своеобразной коллекцией, в которой уже насчитывается около 10 тыс. микроорганизмов. Это уникальный материал, на основе которого удастся создать новые препараты бактериофагов и в перспективе 5-7 лет разработать основу для перехода к персонализированной фаготерапии. Разбираемся, в чем преимущества бактериофагов и смогут ли они стать эффективным средством борьбы с инфекциями, с которыми не могут справиться антибиотики.

Бактериофаги – «пожиратели» бактерий

На самом деле, бактериофаги – это вирусы. Но только не те вирусы, которые поражают человека или животных. Бактериофаги уничтожают исключительно бактерии, или точнее – пожирают их (от греческого phagos – «пожиратель»). Эти миниатюрные (размером в среднем от 20 до 200 нанометров) враги бактерий очень распространены на нашей планете, найти их можно практически везде: в воде, глубоко под землей, в почве и даже в макроорганизмах. Бактериофаги используют в научных исследованиях, но, конечно, их основное практическое применение – борьба с бактериями.

Каждый бактериофаг поражает только те бактерии, против которых направлен. Когда фаг замечает «свою» бактерию, он моментально прикрепляется к оболочке ее клетки, после чего вводит собственную нуклеиновую кислоту (геном) внутрь бактерии. Его цель – заставить бактериальную клетку «работать на себя», то есть начать в ней процесс своего размножения.


Бактериофаговая активность. Маленькие пятна – область лизиса бактерий, вызванного фагами

Вскоре внутри бактерии формируются новые бактериофаги, и начинается процесс лизиса – распада бактериальной клетки и выход зрелых фагов. Таким образом, на свет появляются сотни новых бактериофагов, готовых к нападению. «Литический цикл» вновь повторяется. При всей своей кажущейся агрессивности, этот процесс абсолютно безвреден и не причиняет никаких побочных эффектов остальной микрофлоре организма.

Бактериофаги – далеко не новый биологический вид, а древнейшая группа вирусов. Ученые приступили к их изучению задолго до появления всем известных антибиотиков. Первые научные сообщения о бактериофагах появились еще в 1920-х годах. Многие тогда считали фаготерапию ключом к уничтожению бактериальных инфекций. Кстати, одним из основоположников фаготерапии стал грузинский микробиолог Георгий Элиава. В 1923 году он основал бактериологический институт в Тбилиси – первый в мире научно-исследовательский центр бактериофагологии. Через некоторое время к нему присоединился и сам первооткрыватель бактериофагов – француз Феликс Д’Эрелль. Кстати, именно он и придумал само название «бактериофаг».

В 1940 году бактериофагами заинтересовались за океаном – американские фармацевтические компании пытаются коммерциализировать идею фаготерапии. Но «фаготерапевтическому буму» вскоре приходит конец. Событие, которое отложило исследование фаготерапии на долгие годы – начало промышленного производства пенициллина. Несмотря на то что Александр Флеминг открыл пенициллин еще в 1928 году, первое время его идея не получила широкого применения из-за отсутствия возможности химического производства антибиотика. И только в начале 1940-х годов в Англии, США и СССР организуется промышленный выпуск пенициллина.

Бактерии vs. Человечество: глобальное сопротивление

Случайное открытие Флеминга ознаменовало начало новой эры в медицине. Человечество смогло побороть множество смертельных бактериальных заболеваний, которые на протяжении тысячелетий оставались неизлечимыми.

Но наряду с возможностями антибиотиков, Флеминг обнаружил и другое – при недостаточном количестве пенициллина или если его действие было непродолжительным, бактерии приобретали устойчивость к антибиотику. Флеминг об этом рассказывал в своих выступлениях по всему миру и не раз предупреждал, что не стоит использовать пенициллин, пока заболевание не будет диагностировано, а при необходимости применения антибиотика, его нельзя использовать в течение короткого времени и в совсем малых количествах. К сожалению, это предостережение не помогло.

Уже к 1945 году пенициллин стал доступен повсеместно, активно создавались и другие антибиотики. На протяжении последующих десятилетий они применялись практически бесконтрольно. К примеру, одной из проблем стало самолечение антибиотиками среди населения. Причем при самостоятельном выборе антибиотика часто предпочтение отдавалось именно препаратам широкого спектра действия. Антибиотики стали также широко применяться в сельском хозяйстве – до 80% всех антибиотиков в мире используют для лечения скота. Все это ускорило темпы формирования «антибиотикорезистентности» (от английского resist – «сопротивляться») и привело к тому, что многие инфекционные заболевания снова стали неизлечимы.


Легионеллы – патогенные грамотрицательные бактерии

«Все хотят жить, в том числе и микробы, – рассказывает РИА «Новый день» доктор медицинских наук Тамара Перепанова. – Они развивают сопротивляемость. И эта борьба складывается в пользу микроорганизмов. Они вырабатывают новые штаммы быстрее, чем все фармакологии мира разрабатывают новые препараты. И вот уже антибиотик неэффективен». К слову, самый первый антибиотик – пенициллин – практически бесполезен сегодня: у бактерий к нему развилась почти полная устойчивость.

В 2017 году Всемирная организация здравоохранения (ВОЗ) впервые опубликовала список устойчивых к действию антибиотиков «приоритетных патогенов» – 12 видов бактерий, представляющих наибольшую угрозу для здоровья человека. В их числе – Acinetobacter baumannii, Pseudomonas aeruginosa, Enterobacteriaceae, Enterococcus faecium, Staphylococcus aureus, Helicobacter pylori, Campylobacter spp., Salmonellae, Neisseria gonorrhoeae, Streptococcus pneumoniae, Haemophilus influenzae, Shigella. За всеми этими названиями – очень серьезные заболевания: сепсис, менингит, пневмония, брюшной тиф, дизентерия и другие.

По данным ВОЗ практически все существующие патогенные для человека бактерии приобретут устойчивость к антибиотикам уже через 10-20 лет. По прогнозам, к 2050 году число жертв бактериальных инфекций возрастет до 10 млн в год. Кстати, с уверенностью можно констатировать, что для любого жителя нашей страны вероятность подцепить бактериальную инфекцию, устойчивую ко всем основным антибиотикам, сейчас гораздо выше, чем заразиться вирусом из Китая.

Антибиотики и бактериофаги – оружие против одного врага

Сегодня существующие антибиотики в большинстве случаев все еще работают. Но ученые уже назвали борьбу с бактериями «главным вызовом времени». Проблема антимикробной резистентности рассматривается на глобальном уровне, и мировое научное сообщество активно ищет пути ее решения. Конечно, первый выход из ситуации – это создание новых видов антибиотиков. Но на разработку одного препарата, его клинические испытания и внедрение в массовое производство уходит в среднем 10 лет. Второй явный минус – это стоимость: создание нового антибиотика обходится в миллиарды долларов.

Поэтому ученые все чаще стали вспоминать «старую» альтернативу антибиотикам – бактериофаги. Как отмечают эксперты отрасли, создание бактериофага обходится в десятки раз дешевле, чем антибиотика. Но главное преимущество фагов – не в стоимости, а в их способности изменяться вслед за бактерией. Кроме того, бактериофаги не имеют побочных эффектов и не нарушают естественную флору организма.


Структура типичного миовируса бактериофага

Тем не менее антибиотики никуда не исчезнут с полок аптек и из арсенала врачей. Как отмечают специалисты, антибиотики и бактериофаги – оружие против одного врага. Только действуют они по-разному. Антибиотики можно сравнить с тяжелой артиллерией. Они необходимы, когда действовать нужно быстро, и возможные побочные эффекты меркнут перед критическим состоянием пациента. Бактериофаги – это снайпер, который прицельно уничтожает только один вид бактерий.

Действительно, плюс антибиотиков – отсутствие узкой специализации. Один антибиотик способен лечить довольно широкий круг бактериальных инфекций. Но, как уже отмечалось выше, не обходится без побочных эффектов – от антибиотиков страдают не только инфекционные бактерии, но и полезные бактерии нашей микрофлоры. Поэтому длительное употребление антибиотиков нередко вызывает дисбактериоз.

Бактериофаги обладают узкой специализацией, поэтому для каждой бактерии нужно выделить свой терапевтический фаг. Положительная сторона такой специализации – более «прицельный» удар: ликвидируется только инфекционная бактерия, а полезные не страдают.

Фаготерапия по-русски

Эксперты отмечают, что производство бактериофагов – весьма перспективное направление в фармацевтической промышленности. Кстати, наша страна в производстве бактериофагов исторически занимает ведущие позиции. Уже в годы Великой Отечественной войны применялась фаготерапия. Особое внимание уделялось разработке бактериофагов против кишечных инфекций – холеры, брюшного тифа, дизентерии и сальмонеллеза. Всего в военное время для фронта было изготовлено более 200 тыс. литров бактериофагов.

Сегодня в нашей стране развитие производства лекарственных препаратов на основе бактериофагов входит в Стратегию предупреждения распространения антимикробной резистентности в Российской Федерации до 2030 года, принятую Правительством РФ. Единственный в стране производитель препаратов бактериофагов – компания «Микроген» холдинга «Нацимбио» Госкорпорации Ростех. В период с 2017 по 2019 год продажи бактериофагов «Микрогена» выросли более чем на 25% в денежном выражении. 


Компанией разработаны и выпускаются 19 наименований лекарств на основе бактериофагов против множества известных возбудителей инфекционных заболеваний: дизентерии, брюшного тифа, сальмонеллеза, гнойно-септических и других. Кроме того, разработаны комбинированные препараты, например «Секстафаг» (Пиобактериофаг поливалентный). Он обладает способностью справиться с бактериями стафилококков, стрептококков (в том числе энтерококков), протея, клебсиелл пневмонии, синегнойной и кишечной палочек. Данный препарат отличается высокой степенью очистки от бактериальных метаболитов, что позволяет успешно использовать его для лечения новорожденных и детей раннего возраста, а также применять для беременных.

В рамках Стратегии по борьбе с антимикробной резистентностью ученые НПО «Микроген» проводят множество исследований. В настоящий момент предприятие приступило к созданию первого в России Биологического ресурсного центра для углубленного изучения бактериофагов.

«Задача Биологического ресурсного центра – объединить микробные производственные коллекции, собранные на территории России. На данный момент это более 10 тыс. штаммов. В коллекцию также входят бактериофаги для терапевтических целей. Это уникальный материал, представляющий собой государственную ценность, на его основе удастся создать новые виды лекарств», – прокомментировал исполнительный директор Госкорпорации Ростех Олег Евтушенко.

Но, пожалуй, самой амбициозной целью нового центра является создание основы для перехода к персонализированной фаготерапии в ближайшие 5-7 лет. Персонально подобранный «коктейль» из бактериофагов может спасти жизнь пациентам, которым уже не помогают антибиотики.

Успехи российских и зарубежных ученых вселяют надежду на то, что проблема антимикробной резистентности в скором времени может быть преодолена. Тем временем каждый из нас в этой борьбе с «супербактериями» может внести свой маленький вклад – соблюдать правила, которые помогут уберечься от вирусов и бактерий, остановить появление новых опасных инфекций. Все просто: не забывать о гигиене, вести здоровый образ жизни, вовремя обращаться к врачам и ограничить использование антибиотиков.

Острая кишечная инфекция — сальмонеллез

Сальмонеллы – палочковидные бактерии, колонизирующие стенки тонкой кишки. Являются возбудителем сальмонеллёза.

Сальмонеллёз – это распространенная острая кишечная инфекция. Присуща как людям, так и животным. Характеризуется сильной интоксикацией, а также нарушением работы желудочно-кишечного тракта. Особенно опасен для детей и пожилых людей, ибо болезнь вызывает обезвоживание, что приводит к проблемам с сердцем.

Клиническая картина

Инкубационный период болезни длится 6-72 часа. Примерно на третий день заражения начинается активное развитие болезни и проявляются первые симптомы – боли в животе, сопровождающиеся водянистым жидким стулом, слабость, повышение температуры, иногда рвота. Тяжелые формы сальмонеллёза характерны обезвоживанием, а также увеличением селезёнки и печени. При рациональном лечении симптомы сальмонеллёза уходят спустя десять дней заболевания. Существует неразвёрнутый вид сальмонеллёза, когда человек является бактерионосителем – сам заражённый не страдает от болезни, но от него могут заразиться другие люди.

Лечение

Перед началом лечения необходимо обратиться к врачу для диагностирования болезни, ибо сальмонеллёз следует отличать от других кишечных заболеваний. Диагностика подразумевает анализ крови и кала, а также пищи, употреблённой накануне. Процесс лечения включает в себя:

  • Лекарственный режим. В основе лежит правильный подбор и принятие антибактериальных средств. Предполагается, что первоначальное лечение проводится в стационаре, поэтому первые антибиотики вводятся внутривенно. Среди них – фторхинолоны и полусинтетические пенициллины. В дальнейшем они принимаются в форме таблеток и капсул. При легком течении сальмонеллёза антибиотики назначаться не должны — в данном случае без их употребления выздоровление приходит на 7-10 день. Известны случаи, когда сальмонеллёз переходит в хроническую стадию и человек становится носителем сальмонелл. Помимо антибиотиков также назначаются витамины и пробиотики. Также при лечении применяются сальмонеллёзные бактериофаги.
  • Питьевой режим. Во избежание обезвоживания рекомендуется обильное питьё и большое потребление жидкостей. Наиболее эффективны солевые растворы с водой. Также рекомендуется компот, приготовленный из кураги или изюма. Желательно выпивать по 400 мл. жидкостей в час, делая глотки каждые 5-10 минут.
  • Диета. При сальмонеллёзе назначается ограниченный пищевой рацион. Из разрешённых продуктов рекомендуются кисломолочные продукты, каши на воде, без использования масла, яблоки и бананы, а также сорта рыбы и мяса невысокой жирности.

Профилактика

Предупредить сальмонеллёз помогает соблюдение правил приготовления пищи. Основные профилактические рекомендации, следующие:

  • Хранение продуктов в холодильнике. При комнатной температуре бактерия сальмонеллы быстро размножается.
  • Стоит обращать внимание на срок годности покупаемых продуктов и не покупать просроченные.
  • Тщательно промывать фрукты, овощи, а особенно мясную продукцию и мыть руки перед употреблением или перед началом приготовления пищи.
  • Не следует покупать готовую пищу в открытых уличных ларьках и питаться в непроверенных местах. Чаще всего источником сальмонеллёза является именно пища в таких заведениях.

Несмотря на то, что основной пик заболеваний сальмонеллёза приходится на лето, стоит сохранять бдительность во все времена года. Соблюдая приведённые профилактические меры, можно уберечь себя и своих близких от болезни.

Бактериофаг сальмонеллезный групп A,B,C,D,E жидкий инструкция по применению: показания, противопоказания, побочное действие – описание Bacteriophage Salmonellicum A,B,C,D,E liqiud р-р д/приема внутрь и местн. прим. 20 мл: фл. 4 или 10 шт (25578)

Бактериофаг сальмонеллезный групп A,B,C,D,E жидкий

📜 Инструкция по применению Бактериофаг сальмонеллезный групп A,B,C,D,E жидкий

💊 Состав препарата Бактериофаг сальмонеллезный групп A,B,C,D,E жидкий

✅ Применение препарата Бактериофаг сальмонеллезный групп A,B,C,D,E жидкий

📅 Условия хранения Бактериофаг сальмонеллезный групп A,B,C,D,E жидкий

⏳ Срок годности Бактериофаг сальмонеллезный групп A,B,C,D,E жидкий


Сохраните у себя

Поделиться с друзьями

Пожалуйста, заполните поля e-mail адресов и убедитесь в их правильности

Описание лекарственного препарата Бактериофаг сальмонеллезный групп A,B,C,D,E жидкий (Bacteriophage Salmonellicum A,B,C,D,E liqiud)

Основано на официально утвержденной инструкции по применению препарата и подготовлено для электронного издания справочника Видаль 2013 года, дата обновления: 2019.08.02

Владелец регистрационного удостоверения:

Код ATX: V03A (Прочие разные препараты)

Лекарственные формы


Бактериофаг сальмонеллезный групп A,B,C,D,E жидкий

Р-р д/приема внутрь и местн. прим. 20 мл: фл. 4 или 10 шт

рег. №: ЛС-000624 от 21.06.10 — Бессрочно Дата перерегистрации: 07.05.18

Р-р д/приема внутрь и местн. прим. 100 мл: фл. 1 шт.

рег. №: ЛС-000624 от 21.06.10 — Бессрочно Дата перерегистрации: 07.05.18

Форма выпуска, упаковка и состав препарата Бактериофаг сальмонеллезный групп A,B,C,D,E жидкий


Раствор для приема внутрь и местного применения1 фл.
бактериофаг сальмонеллезный групп A, B, C, D, E жидкий20 мл

20 мл — флаконы (4) — пачки картонные.
20 мл — флаконы (10) — пачки картонные.

Раствор для приема внутрь и местного применения1 фл.
бактериофаг сальмонеллезный групп A, B, C, D, E жидкий100 мл

100 мл — флаконы (1) — пачки картонные.

Фармакологическое действие

Препарат вызывает специфический лизис сальмонелл указанных выше серотипов.

Показания препарата Бактериофаг сальмонеллезный групп A,B,C,D,E жидкий

  • заболевания или бактерионосительство, вызванные сальмонеллами указанных выше серотипов.

Важным условием эффективной фаготерапии является предварительное определение фагочувствительности и раннее применение препарата.

Режим дозирования

Препарат предназначен для внутреннего применения. Для лечения бактериофаг принимают 3 раза в день через рот за 1час до приема пищи с первого дня заболевания в течение 7-10 суток. При заболевании, характеризующемся слабовыраженным колитическим синдромом, и в период реконвалесценции одновременно с пероральным применением рекомендуется вводить препарат ректально, в виде клизм, вместо 1 приема через рот.

Рекомендуемые дозировки препарата

ВозрастСпособ введения
Через рот (доза на один прием)Ректально
До 6 месяцев5 мл10 мл
От 6 месяцев до 1 года10- 15мл20 мл
От 1 года до 3-х лет15-20 мл20-30 мл
С 3-х лет до 8 лет20-30 мл30-40 мл
От 8 лет и старше30-40 мл50-60 мл

В профилактических целях препарат рекомендуется применять для предупреждения бактерионосительства, внутрибольничной инфекции, во время групповых заболеваний в организованных коллективах и семьях. Оптимальные схемы использования — ежедневный прием разовой дозы в зависимости от возраста. Продолжительность приема препарата определяется условиями эпидситуации.

Побочное действие

Не установлены.

Противопоказания к применению

Применение у детей

Возможно применение у детей по показаниям.

Особые указания

Перед употреблением флакон с жидким бактериофагом необходимо взбалтывать. При помутнении не употреблять!

Влияние на способность к управлению транспортными средствами и механизмами

Применение препарата не влияет на способность управлять транспортными средствами, механизмами.

Передозировка

Не установлены.

Лекарственное взаимодействие

Применение препарата возможно в сочетании с другими лекарственными средствами, в том числе с антибиотиками.

Условия хранения препарата Бактериофаг сальмонеллезный групп A,B,C,D,E жидкий

Хранение в соответствии с СП 3.3.2.1248-03 при температуре от 2 до 8°С в сухом, защищенном от света и недоступном для детей месте.

Срок годности препарата Бактериофаг сальмонеллезный групп A,B,C,D,E жидкий

Срок годности — 2 года.

Условия реализации

Без рецепта.


Сохраните у себя

Поделиться с друзьями

Пожалуйста, заполните поля e-mail адресов и убедитесь в их правильности

Лечение бактериофагами – аналитический портал ПОЛИТ.РУ

Мы публикуем текст лекции канд. биолог. наук, заведующего лабораторией вирусов микроорганизмов Института микробиологии им. С.Н. Виноградского РАН Андрея Летарова «Лечение бактериофагами с точки зрения микробной экологии«, прочитанной 7 апреля 2011 года в Политехническом музее в рамках проекта «Публичные лекции Полит.ру».

«Публичные лекции «Полит.ру»» проводятся при поддержке:

 

Текст лекции

Уважаемые коллеги, исходно я пытался назвать эту лекцию так «Экология бактериофагов, туманные контуры фаговой терапии», но редактор попросил сделать название более популярным, и отсюда родилась фраза «Лечение бактериофагами с точки зрения микробной экологии». В целом это более или менее эквивалентные выражения, хотя первое мне нравится больше. В качестве эпиграфа я взял цитату из недавней публикации по поводу фаговой терапии, я переведу: может, не все тут читают по-английски, она звучит так: «Многочисленные фаговые препараты продаются в наше время в российских аптеках, однако ни клинические испытания, проведенные с этими продуктами, ни фаги, которые в них содержатся, не были описаны в детальных научных публикациях». Эта удивительная ситуация требует своего объяснения и, конечно же, разрешения — а особенно, если мы учтем, что фаговая терапия бактериальных инфекций, то есть попытки лечить заболевания, вызванные бактериями, с помощью вирусов, которые эти бактерии поражают, исторически является первой технологией специфической антибактериальной терапии. Первый опыт по фаговой терапии был осуществлен за несколько лет до начала применения первых сульфаниламидных препаратов.

На слайде мы с вами видим два портрета людей, которые делят честь открытия бактериофагов. Надо сказать, что Фридрих Уильям Туорт опубликовал свое сообщение, которое называлось «Исследование ультрамикроскопического вируса» в журнале «Ланцет» на два года раньше, но в тот момент, хотя вирусы уже были открыты, на самом деле никто не понимал, что это такое, и Туорт в своих рассуждениях постеснялся назвать открытый им феномен вирусом, рассуждая, что, возможно, это – всего лишь фермент, имеющий способность размножаться. С нашей точки зрения, это одно и то же. С точки зрения тогдашней науки не было должной ясности – или, скажем так, не было называния вещей своими именами и поэтому работа Туорта не имела продолжения, отчасти этому помешала Первая мировая война.

Феликс д’Эрель описал фагов дизентерийных бактерий в 1917 году. Это был канадский микробиолог, однако в то время он работал в институте Пастера в Париже. Он в этот момент занимался исследованием причин вспышки дизентерии в кавалерийском эскадроне, расквартированном неподалеку от Парижа. Он выделял от больных культуры  и, поскольку он предполагал, что, возможно, дизентерия вызывается одновременной инфекцией каким-то вирусом и бактерией, он смешивал культуры с экстрактами фекалий, профильтрованными через очень тонкий фарфоровый фильтр, который задерживал бактерии. И в какой-то момент эти культуры растворились, лизировались, и д”Эрель сразу почему-то понял, что он имеет дело с вирусом, который поражает бактерии, и назвал его бактериофагом. Этим термином, кстати, не слишком удачным, мы пользуемся по сей день. В отличие от Фредерика Туорта, д’Эрель остаток своей жизни посвятил работе с фагами, сделал очень много, приложил руку к открытию ныне здравствующего института, занимающегося фаговой терапией в Тбилиси, тогда это был Советский Союз, даже собирался переехать жить в Тбилиси.  Но вскоре уехал оттуда, поскольку в процессе известных событий 30-х годов его сотрудник Элиава, в честь которого сейчас назван институт, был расстрелян, и д’Эрель счел за благо немедленно вернуться в Париж. В 1917 году выходит его первая публикация по бактериофагам, в 1921 году появляется довольно объемная книга, которая была переведена в 1926 году на русский язык. У меня есть это очень интересное издание, в котором мы видим уже очень большой объем знаний о биологии этих вирусов, накопленных одним человеком, может быть, с помощью лаборанта, с которым он работал.  И он же практически сразу пытается использовать бактериофаги для борьбы с инфекциями в 1919 году, то есть через два года после открытия самого феномена, под руководством  профессора Гутинеля в детском госпитале в Париже они проводят первый эксперимент по лечению дизентерии. Кстати, этому эксперименту предшествовали своеобразные тесты безопасности, несколько наивные по нашим меркам: фаг выпили сам д’Эрель и его сотрудники в дозах больших, чем они планировали использовать.  Тогда такая процедура считалась вполне надежной. Этот опыт был успешным, и Д’Эрель провел еще довольно много исследований в области фаговой терапии. Он лечил, таким образом, дизентерию, некоторые заболевания кур, холеру в Индии и даже несколько случаев чумы. Местами ему сопутствовал значительный успех, он был по-современному мыслящий ученый и ставил довольно аккуратные контроли. Технологии двойного слепого медицинского исследования тогда не существовало, но с точки зрения обычной (не медицинской) научной практики он выполнял довольно аккуратные исследования. И под влиянием его работ поднялась большая волна работ по фаговой терапии, которая активно развивалась до 30-х годов, и многие компании начали выпускать коммерческие препараты бактериофагов — так же, как мы это видим и в наши дни. Что интересно, первая компания, во всей видимости была «Общество безопасных красок для волос», которая дошла до наших дней под именем компании L’Oreal. К 30-м годам накопились проблемы, связанные с тем, что результаты фаговой терапии плохо воспроизводились, и с появлением антибиотиков на Западе от нее отказались, а в некоторых других странах, в частности, в Советском Союзе, а также несколько позже эти исследования были начаты в Польше и Чехословакии. Эта работа продолжалась, продолжается, и по сей день и сейчас есть две страны, где фаги можно купить в аптеке – это Грузия и Россия, и еще есть польский центр, где эти препараты производятся и применяются в лечении как экспериментальная терапия. Однако, в те времена помимо прикладных исследований феномен «бактериофагия» привлек довольно большое внимание исследователей, и отчасти этим обязаны демонстрации того, что бактериофаг представляет собой некий дискретный агент. Если мы возьмем сильно разведенную суспензию этого вируса так, чтобы в некой капле, которую мы можем реально накапать, было, скажем, порядка сотни частиц, и нанесем это на чашку Петри с питательной средой, на которую вместе с вирусом помещаем очень много бактерий так, чтобы они выросли сплошным слоем  (этот серый слой — это так называемый газон чувствительной культуры), то там, куда попадают вирусные частицы, мы видим образование дырок. Для сравнения я привел две чашки. Это один и тот же бактериофаг. Этот является мутантом этого варианта. Сама по себе морфология этих дырок, так называемых бляшек, может отличаться, но это дает возможность понять две вещи: что, во-первых, этот агент дискретный, то есть имеется какая-то одна частица, которая куда-то попадает, что-то делает с бактериями и размножается. Можно эту бляшку отсюда вырезать и убедиться, что там очень много фага. И второй момент: мы можем их посчитать и с учетом разведений прикинуть, сколько этих частиц было в исходном материале, и таким образом мы можем мерить их концентрацию. Используя эксперименты, основанные на таких техниках, д’Эрель, а потом и несколько исследователей, среди которых мне бы хотелось назвать Макса Дельбрюка, установили принципы жизненного цикла бактериофагов. Я сейчас о них расскажу, но, что очень важно к этому моменту, это уже 40-е годы, возникает некая потребность науки разобраться в природе наследственной информации. И Макс Дельбрюк, а также еще несколько ученых правильно решили, что бактериофаг — это некоторый пакет, как мы сейчас бы сказали, содержащий определенную генетическую программу. То есть это выделенная самой природой в отдельном виде какая-то упаковка с генетическим материалом, природу которого можно установить, и, кроме того, эта программа развивается очень мощно, то есть в течение 20 минут бактерия практически останавливает свой собственный обмен веществ и делает внутри себя огромное количество вирусов. Это не какое-то небольшое изменение свойств, например, есть у нее там жгутики или нет, это кардинальная перестройка всего обмена с очень большими эффектами, которые легко заметить. И люди поняли, что это модель, которая может привести к успеху, и поэтому исследования фагов легли в основу современной молекулярной биологии, и этот мейнстрим фактически отодвинул в сторону все исследования по экологии этих вирусов до довольно недавних лет, хотя очень неплохие зачатки этих исследований мы находим ещё в работе Дереля. Так развивалась научная мода! Экологию можно было исследовать с полным успехом еще тогда, для этого не было никаких технических препятствий, но научная мода, некие идеи, владеющие довольно небольшой горсткой биологов, работавших в те годы в этой области (их было сильно меньше, чем сейчас), определили развитие науки.

Теперь я позволю себе сделать небольшой краткий экскурс в то, как устроен жизненный цикл бактериофагов. Этот мультик сделан несколько грубо, но дает нам различить несколько стадий так называемого литического цикла. Первая стадия — это прикрепление бактериофага, который узнает определенные молекулы на поверхности клетки. Это так называемый рецептор, он прикрепился и ввел в клетку свой генетический материал. На этом рисунке это был этот самый червячок. Сейчас мультик повторится, и мы это увидим поаккуратнее. На самом деле молекула ДНК, конечно, значительно длиннее бактериофага, но надо понимать, что есть некоторые художественные условности. Вот он прикрепился, узнал свой рецептор, происходят некие события, различающиеся в зависимости от типа бактериофага, которые в итоге приводят к введению внутрь клетки генетического материала, а сам фаг остается на поверхности. Вот этот материал. Те фаги, которые нас интересуют в контексте терапии, содержат только ДНК в качестве генетического материала, ДНК размножается внутри клетки, синтезируются компоненты фаговых частиц, они собираются — и после этого специальные ферменты разрушают оболочку клетки, и она разлетается на мелкие кусочки, высвобождая фаговое потомство. Это мы называем литическим циклом. В нем выделяется период от момента адсорбции фага на клетки до момента лизиса клетки, который называется латентным периодом. В этот момент если мы будем смотреть на количество инфекционных центров в культуре, то их число не изменяется, поскольку фаги инфицировали клетку – естественно, каждая инфицированная клетка пока представляет собой одну единую частицу, и размножения мы не видим. Потом проходит время — и довольно резко мы видим взрывообразный выход фага, его сразу становится много, и мы говорим: латентный период кончился. В пределах этого латентного периода принято говорить еще об эклипс-периоде, это время с момента инфекции, но до того этапа, когда в клетке появятся первые готовые вирусные частицы. Если мы в этот момент клетку бактерии убьем, то фаг погибнет вместе с ней, если мы ее убьем аккуратно хлороформом позже, то уже готовые фаговые частицы смогут выйти, и мы можем увидеть их активность. Вот такая схема событий, так называемый литический цикл и составляет основу размножения бактериофагов. Несколько позже литического цикла был описан вариант, который называется лизогенный цикл, отличающийся тем, что некоторые фаги, так называемые умеренные, могут после введения своей ДНК не размножаться сразу, а в некотором небольшом проценте клеток встраивать свою ДНК в геном бактерии — или не встраивать, она может существовать в цитоплазме отдельной молекулой, плазмидой. И  получаются так называемые лизогенные клетки, сейчас мы это увидим, которые живут достаточно долго, делятся, размножаются, и фаговый геном внутри них существует в так называемом выключенном состоянии. В какой-то момент может произойти индукция профага, то есть под воздействием какого-нибудь события или просто случайно эта ДНК активируется, вырезается из генома и вступает на литический путь. Фаги, умеющие делать такое, называются умеренными фагами, а те, которые размножаются только в литическом цикле, называются вирулентными. Это не очень удачный термин, но так уж повелось — и поэтому я должен сразу сказать, что в фаговой терапии по современным стандартам принято использовать только вирулентные фаги, использование умеренных фагов крайне нежелательно по ряду причин, и из-за недостатка времени я сейчас не буду на них подробно останавливаться. Среди них, например, иммунность лизогенных бактерий повторному заражению этих же фагов, а также способность многих умеренных фагов приносить в клетки какие-то гены, которые изменяют их свойства, улучшая выживаемость, то есть можно с помощью умеренного фага сделать бактерию еще более патогенной, поэтому умеренные фаги в фаговой терапии запрещены, а все, о чем мы будем говорить, — это фаги вирулентные, которые размножаются только в литическом цикле.

Итак, адсорбировались, ввели в ДНК, сделали фаговые частицы, клетка лизируется через определенное регулируемое фагом время – во и весь литический цикл.

Пока шли работы по выяснению работы жизненного цикла, во всяком случае — литического, появились первые электронные микроскопы, фирма Siemens начала их продавать, по-моему, с 1939 года, и в начале 40-х появились первые электронные микрофотографии бактериофагов. Одна из них приведена на рисунке, и дальнейшее развитие этой техники к нашим дням позволило сделать очень подробные реконструкции внешнего вида и молекулярного устройства бактериофагов. Здесь представлены представители трех основных семейств так называемых хвостатых фагов, tailed phages по-английски, которые используются в фаговой терапии. Существует еще полтора десятка семейств не хвостатых фагов, но они нас сейчас не очень интересуют, потому что в природе они составляют некое меньшинство, не больше 5%, и в фаговой терапии не используются. Хвостатые фаги бывают с коротким хвостом, они называются Podoviridae, с длинным хвостом — Siphoviridae и с длинным хвостом, способным к сокращению, которые называются Myoviridae. Эстетика этих вирусов, похожих на какие-то космические аппараты, вдохновила многих фантазеров-художников, есть небольшая галерея рисунков, к сожалению, здесь слишком много света, чтобы увидеть фоновый рисунок. Кстати, интересно, что эта фотография на недавнем российском конкурсе заняла какое-то место в конкурсе научной иллюстрации, несмотря на то, что в ней допущена грубая ошибка: у этого фага 8 ножек, длинных фибрилл, а их должно быть 6 — это существенная ошибка, поскольку симметрия этих частиц — это очень важный эволюционный момент. Однако прогресс молекулярной биологии мы пока оставляем за бортом, для это потребуется читать еще одну лекцию, а может, и не одну — чтобы рассказать о том, как все устроено и работает.

 Остановимся подробнее на экологии фагов. Что же происходит в природе? До самого конца XX века считалось, что в естественных средах фагов немного, но под занавес века, в 1989 году, появились исследования, где были применены прямые методы наблюдения, то есть их не пытались выращивать, а просто взяли воду из моря, сконцентрировали ее с помощью специальной центрифуги и посмотрели в электронный микроскоп. И выяснилось, что подавляющее большинство вирусных частиц, в основном представляли собой бактериофаги, а не вирусы эукариот, очень много. Некоторые из них изображены стрелочками разного размера, а эти штуки – бактерии, и в большинстве образцов воды количество вирусных частиц в 2-10 раз больше, чем количество бактерий, то есть неожиданно выяснилось, что бактериофаг — это наиболее широко распространенная сущность в природе. Можно даже было увидеть уже инфицированных бактерий, забитых внутри бактериофагами и, посчитав их количество, оценить вклад фагов в смертность бактерий водных систем, и оказалось, что они убивают от 15 до 70% в зависимости от условий среды – в любом случае, это очень много. Они вносят существенный вклад — и экологи, в первую очередь, специализирующиеся на водных системах, и потом не только водные, обомлели, потому что это было совершенно фундаментальное открытие. Это говорит о том, что их реконструкция пищевых цепей в морского планктона сделана неверно. Дальше были предложены красивые способы подсчета, когда фагов смотрят не в электронный микроскоп, а в люминесцентный – эти яркие точки — это бактерии, прокрашенные красителем, связывающимся с ДНК, а маленькие точечки – это вирусные частицы, и мы видим, как их много в воде, сконцентрированной с помощью специальной установки ультрафильтрации. Естественно, потребовалось объяснить, как же так получается, что в природных условиях у нас есть бактерии, есть специфичные к ним фаги, естественно, они никуда не деваются — ни те, ни другие, — следовательно, бактерии к фагам чувствительны, это можно показать экспериментально, но, тем не менее, они сосуществуют довольно стабильно, длительно никого не убивая под корень, хотя если мы берем пробирку с плотной бактериальной культурой и туда  помещаем одну или несколько фаговых частиц, то через пару-тройку часов видим сплошной лизис. В этом удалось довольно быстро разобраться. Выяснилось, что есть несколько эффектов, которые обеспечивают укрытие для бактериальных клеток, то есть не то чтобы совсем делают их недоступными для фагов, а позволяют уменьшить действие фаговой инфекции на эту бактериальную популяцию. Королем этих укрытий является так называемое численное укрытие или, как говорят по-английски, numerical refuge. Что это такое? Абсолютные концентрации бактерий и фагов в среде довольно небольшие, тем более что бактерий много разных, фагов много разных, и они подходят к друг к другу достаточно строго. То есть фаги, специфичные для других бактерий, данную конкретную совершенно не волнуют, она боится только своих собственных фагов, и поскольку их концентрации низки, то вероятность встречи для каждой конкретной клетки невелика. И поэтому клетка успевает спокойно поделиться, и не один раз, пока одна из ее дочерних клеток наконец не будет лизирована фагом. Поэтому фаги время от времени подкармливаются редкими встречами, и бактерии вроде как размножаются. Если мы представим себе, что бактерия имеет размер примерно с человека, то окажется, что фаг имеет размер где-то с яблоко, тогда миллилитр жидкости будет представлять собой объем среднего размера озера. Как вы понимаете, если мы имеем одну бактерию, одного фага в миллилитре, они могут там жить почти бесконечно, никогда не встречаясь. Это соображение является принципиально важным, многие другие соображения немного изменяют количественные характеристики, влияющие на возможность встречи. Помимо численного укрытия существует физиологическое.

Некоторые бактериальные клетки в силу своего физиологического состояния могут быть невосприимчивы к фаговой инфекции. Обычно это разного рода покоящиеся формы или голодающие клетки. Есть разные степени невосприимчивости, я не буду сейчас на этом подробно останавливаться. Бывает физико-химическое убежище, связанное с тем, что в некоторых средах какие-то факторы среды – например, в рубце жвачных животных было показано, что это таниновые кислоты, — почему-то препятствуют адсорбции бактериофагов. То есть фагов довольно много, бактерий тоже, но есть некая химия, которая мешает им к бактериофагам липнуть, но не то чтобы совсем мешает на 100%, некоторые все-таки липнут, поэтому фаги там поддерживаются, но перебить все бактерии они не могут. Наконец, может существовать пространственная изоляция. Скажем, бактерии могут быть укрыты какой-нибудь слизью.  Они вообще любят формировать так называемые биопленки, о которых мы еще сегодня вспомним, на границе раздела фаз, например, твердого и жидкого. Они разрастаются на поверхности воды или на каких-то твердых объектах в воде, выделяют большое количество полисахаридов и в этой массе живут, и фагам туда пролезть тяжело. Опять-таки — не то, чтобы невозможно совсем, но затруднительно. Таким образом все это существует, но из того, что я говорю, из соображения, что ведущим здесь является нумерическое укрытие, все остальное влияет по большей части на коэффициент диффузии или на константу адсорбции. Из этого следует очень любопытное утверждение, что фаги представляют собой бактерицидных агентов, активность которых в природных условиях зависит от концентрации видовой или штаммовой популяции. Что я имею в виду? Если у нас есть много видов бактерий — представим себе, что все присутствующие в этой комнате являются бактериями и каждая относится к своему виду, — то фаги, присутствующие одновременно, будут довольно мало влиять на каждого из нас, и мы сможем делиться. Но если кто-то будет делиться слишком успешно и начнет составлять большой процент, то смертность такой популяции от фагов будет выше, чем у остальных, и его будут немедленно придавливать. Но если в силу какого-то успеха какая-то популяция размножается феерически и заполоняет все, то ее может ждать фаговый коллапс, как это иногда бывает при цветении воды, вызванном цианобактериями, тогда она нарастает в таком количестве, что возможен массовый лизис с накоплением огромных количеств фагов. Получается, что фаги занимаются робингудством на молекулярном уровне, они отнимают органическое вещество у богатых и раздают его бедным — и это не преувеличение, поскольку если бактерию съело простейшее, какая-нибудь амеба или на самом деле жгутиконосцы — активные поедатели бактерий, то она превратит её биомассу в свою энергию, СО2 и Н2О, и другим бактериям от этого ни жарко, ни холодно, а если бактерию лизирует фаг, то большая часть органики, в ней содержащейся, вытечет наружу и станет доступна другим бактериям, то есть получается, что фаги отнимают энергию и вещество от наиболее успешных видов и передают их другим. И в результате оказывается, что в природных условиях вирусный лизис — как первичных продуцентов, так и наиболее успешных гетеротрофных бактерий, питающихся органикой, — активно стимулирует вращение вещества цепи, которая называется «микробная петля», ведь большая часть свободно живущих бактерий живет за счет растворенного органического вещества. Соответственно, чем больше происходит вирусный лизис, тем активнее оно высвобождается — и тем больше разнообразие, поскольку мы придавливаем слишком успешных, позволяя жить остальным, и тем больше общая метаболическая активность, поскольку ускоряется обращение этого вещества. Если хотите другую аналогию, то фаги, может быть, — аналог не столько робингудства, сколько реально работающего антимонопольного комитета – нам бы такой завести в нашем государстве.

 Исходя из вышесказанного: выяснилось, что все эти пищевые цепи, на самом деле в моделях пищевых цепей не сходятся концы с концами, если мы не учитываем фагов. Это действительно одна из ведущих сил в мировой экологической среде в микробном мире. И эта фраза, за которую меня не любят производители фаговой терапии, я ее прочитаю: «Сложная игра между бактериями и фагами продолжается с большим азартом в течение всей обозримой истории биосферы, около 3 миллиардов лет, и вмешательство человека в эту игру, например, при осуществлении фаговой терапии является некоторого рода шулерским приемом, и для того, чтобы жульничать по-крупному, нам надо хотя бы полноценно усвоить правила этой игры». Если вдуматься, это практически полная аналогия, поскольку, как мы видим, в реальных природных системах концентрации бактерий, фагов и их активности зависят друг от друга. Не может взяться ниоткуда, там высокая концентрация фага — и долго никуда не деваться. Если мы создаем искусственно, это действительно жульничество, туз из рукава, но успех этой игры нам вовсе не гарантирован, потому что мы можем не понимать, что и как дальше будет происходить. Еще одно принципиальное отличие природной обстановки от лабораторной состоит в том, что в природной обстановке — как в организме человека и животных, так и в морях и океанах — фаговые частицы тоже смертны. Почему мы можем убить бактериальную культуру одной частицей в пробирке? Потому что она нашла первую клетку, произошло размножение, концентрация фагов несколько выросла, бактерии тоже могут расти за это время, однако фаги никуда не деваются, время их полураспада в пробирке значительно больше, в десятки раз, чем время размножения бактерий, и рано или поздно мы накапливаем большую концентрацию  вируса, успешно убивая всех, кто к этому фагу чувствителен. В природе так не будет. Если фаговых частиц ввести много, они уничтожаются солнечным светом, они подвергаются механическому разрушению, окислению, крупных фагов могут съесть простейшие, мало ли ещё какая судьба может их постичь! Время полужизни фага в море порядка суток, это сильно зависит от условий, то есть там действительно существует некое истинное равновесие между их продукцией, которая зависит от плотности бактерий-хозяев, и распадом. Это напоминает карточную игру, и не всякая попытка нарушения этого равновесия приведет к выигрышу соответствующего игрока, несмотря на все его усилия. Мало иметь туза в рукаве, надо знать момент, когда его выпустить.

Нам, конечно, значительно любопытней знать, что творится с фагами и их хозяевами в нашем собственном организме, чем в морях и океанах и даже, несмотря на то, что первые эксперименты в этой области начал лично Феликс д’Эрель, и они опубликованы в 20-х годах, в реальности понимание экологии фагов таких микробных сообществ до сих пор находится в зачаточном уровне, и работы по этому поводу не формируют единого фронта. Они достаточно отрывочны, но известно, что фагов в нас много, не только в нас, в разных видах животных. Особенно их много в кишечнике. Эта картинка из нашей работы — некоторые морфологические типы фаговых частиц, все хвостатые, которые выделены из одного образца фекалий лошади. Я по этому поводу даже вспомнил фразу Дмитрия Николаевича Прянишникова: «Избыток навоза не компенсирует недостаток знания о нем». Однако, понимание того, в какой мере и как эти фаги действительно влияют на количественные показатели и активность тех бактерий, которые вместе с ними живут в кишечнике, вызывают ли они селекцию устойчивых к ним бактерий – или, наоборот, бактерии не обращают на них внимание, платя им небольшую дань? В общем-то, понятно далеко не до конца, и на самом деле примерно этим и занимается наша лаборатория, то есть мы работаем в академическом институте и по большей части занимаемся не самой фаговой терапией, а всякими теоретическими вещами типа экологии фагов в природных сообществах. Это дает нам некое право рассуждать о том, как все эти принципы экологии мы можем приложить к практической фаговой терапии. Научные знания, которые должны лечь в основу действительно современного терапевтического использования бактериофагов… Я упустил некую важную мысль: дело в том, что хотя фаговая терапия была забыта на Западе с 40-х годов по 80-е, интерес к ней резко возрос в последнее десятилетие XX века и продолжается сейчас в связи с проблемой устойчивости бактерий к антибиотикам. Я не буду много об этом рассказывать, понятно, что устойчивые штаммы, особенно госпитальные, множатся, скорость разработки новых антибиотиков упала, и, возможно, мы уже знаем почти все принципиальные классы антибиотиков, которые можно найти. Есть некоторая надежда на новые антибактериальные препараты, но их разработка происходит очень медленно, это связано с рядом экономических причин в фармацевтической индустрии, и, кроме того, антибиотики, как всем известно, вызывают большое количество побочных эффектов: мало того, что они довольно токсичны, они еще вызывают дисбактериоз, поэтому развитие фаговой терапии — относительно безопасной и имеющей почти неисчерпаемый потенциал поиска новых антибактериальных агентов к каждому конкретному патогену — вызывает большой интерес, и с 70-х годов на Западе появляется довольно много приличных публикаций по экспериментальной фаговой терапии. Но обычно лечат не людей, а экспериментально заражённых животных. Очень здорово перенос исследований на людей сдерживается фармацевтическими правилами и разными регуляциями, которые значительно свободнее в нашем отечестве, поэтому у нас лечат направо и налево, но, к сожалению, не очень применяя научный подход, поэтому получается, как говорил покойный Виктор Степанович, «как всегда». На мой взгляд, чтобы создать современную фаговую терапию и современные препараты, нужно учитывать примерно следующее: во-первых, надо разобраться в фармакодинамике фагов как антибактериальных препаратов. Понять, что они делают с бактериями в организме — и не только с каждой конкретной клеткой, с этим, конечно, понятно, а что они делают с популяцией. В частности, надо понять, как влияют особенности жизненного цикла, какой фаг лучше – тот, который, например, лизирует бактерию быстрее, но делает меньше фаговых частиц в расчете на одну клетку, или тот, который ждет дольше, но делает их больше. Соответственно — как действует специфичность хозяина, играет ли существенную роль появление in situ в каждом конкретном пациенте фагоустойчивых бактерий, ведь устойчивость к фагам, я сейчас об этом расскажу, развивается на раз, значительно легче, чем к антибиотикам, другое дело, что всегда можно найти другого фага к этому устойчивому мутанту и решить проблему. Вопрос о том, является ли это затруднением для каждого конкретного пациента или только для разработки препаратов вообще, остается открытым. Какие возможны варианты взаимодействия с клетками и с популяциями бактерий, и, как я сказал, фаги сожительствуют с бактериями 3 миллиарда лет и вовсе не стремятся их всех перебить, и иногда популяция бактериофагов образует очень любопытные, длительно существующие консорциумы, вовсе не желающие сразу умирать или терять один из своих компонентов. Во-вторых, существует проблема фармакокинетики фагов. То есть мы вводим препарат тем или иным способом,  в организм человека или животного, мы должны понимать, куда он проникает, с какой интенсивностью, как он выводится из организма, где оседает, и как на это можно влиять, и как это приводит к какому-то эффекту. И, наконец, остается проблема безопасности фаговых препаратов, в частности — возможность их влияния на эволюцию патогенных бактерий, возможность других активностей фагов кроме антибактериальных, влияние примесей, которые неизбежно содержатся в этих препаратах. Ведь если требовать высокой степени очистки,  они становятся очень дорогими, и так далее. Я пытался составить более или менее полный список, приведённый на слайде.

Теперь давайте пройдемся по стадиям жизненного цикла фагов и рассмотрим их с точки зрения фаговой терапии. Адсорбция и инжекция ДНК. Тут для нас важно, что адсорбция фага на поверхности клетки — это высокоточное молекулярное узнавание, например, частица фага Т4, которая своими адгезинами узнала какие-то рецепторы на бескрайней поверхности бактериальной клетки. Схема процесса для фага Т4 изучена в больших деталях, в том числе благодаря работам лаборатории, где я в свое время защитил кандидатскую диссертацию, Вадима Викторовича Месянжинова, и других лабораторий, показано, что сначала происходит взаимодействие длинных фибрилл, потом из-под базальной пластинки внизу хвоста разворачивается дополнительный комплект коротких фибрилл — и они связываются с другими рецепторами, происходит сокращение чехла хвоста и выдвижение вниз трубки, примерно так, как мы видели с вами в мультике. Фаг прокалывает стенку бактерии с помощью специальной белковой иголки, имеющейся на конце, эта иголка разбирается, хвост достигает внутренней мембраны бактериальной клетки и закачивает туда ДНК. Можно очень долго говорить о физике этого процесса, это очень интересно, но нас интересует то, что все начинается с очень точного узнавания фаговыми адгезинами каких-то конкретных молекул на поверхности бактерии. Вот некий список молекул, которые разные фаги узнают на поверхности своих бактерий хозяев. Нет необходимости его читать, можно увидеть, что они довольно разные. А эта схема для нас важна. Это рентгеновская структура – т.е. схема устройства белковой молекулы, которая существует на поверхности кишечной палочки, это белок, образующий пору в так называемой внешней мембране, через которую транспортируется специальное вещество, переносящее железо. Бактериофаг Т5, один из классических модельных объектов молекулярной биологии, узнает этот маленький кусочек этого белка,  примерно 7 аминокислотных остатков. Очевидно, что, с одной стороны, можно немного изменить белок — и тогда клетка будет полностью устойчива к бактериофагу Т5, но, с другой стороны, оказывается что если мы отбираем бактерии в условиях жесткой селекции, то есть мы взяли и всю популяцию затравили фагами, соответственно, выживают немногие, с которыми что-то случилось, так что фаг к ним не адсорбирует. Большинство таких «выживантов» — это те, кто этого белка не имеют совсем. Этот белок где-то у них сломался, и его функция утрачивается вместе со способностью адсорбировать фаг. С одной стороны, для бактерий это хорошо: фаг ее не убьет, но, с другой стороны, такой мутант часто бывает (хотя не всегда) менее здоровым, менее жизнеспособным, чем родительский фагочувствительный генотип. И поэтому если фагоустойчивые мутанты отбираются, они часто бывают менее патогенными, менее вирулентными, менее способными к колонизации какого-то эпителия, и если фагов убрать, то родительские фагочувствительные виды часто их вытесняют. Такие феномены описаны. Однако если бактерии существуют без всяких фагов, то в них возникают разные мутации и возникают другие штаммы кишечной палочки, у которых, например, возникла замена аминокислотного остатка, не влияющего на функцию этого белка в целом. Она с ней живет, но в качестве бонуса получает еще то, что на ней не адсорбируется фаг Т5. Поэтому если мы найдем другой природный штамм, устойчивый к фагу Т5, это вовсе не значит, что он будет слабее чувствительного. Отсюда получается, что, с одной стороны, отбор фагоустойчивых мутантов на месте часто не очень спасает бактериальную популяцию, но, с другой стороны, для каждой конкретной бактерии фага надо подбирать. То есть фаги зачастую имеют штаммовую специфичность, то есть они убивают, как правило, не только бактерии определенного вида, а бактерии определенной группы штаммов в пределах этого вида. На этих таблицах данные из двух работ — одна из нашей лаборатории, другая из зарубежной публикации, — где для цели неких исследований люди посмотрели чувствительность определенного набора штаммов бактерий кишечной палочки к определенному набору фагов. И мы видим некую чехарду плюсов и минусов, то есть «да», «нет» и мы понимаем, что каждый фаг один штамм убивает, а другой – нет. В обоих случаях все эти штаммы — это полевые изоляты кишечной палочки из разных естественных источников. То есть для нас важный момент в адсорбции состоит в том, что она высокоспецифичная, хорошо это или плохо, судите сами. Прошла адсорбция — происходит внутриклеточное размножение фагов. Я сохранил этот слайд для того, чтобы сделать на нем паузу. Мы о ней говорить не будем, это содержание молекулярной биологии XX века, большого ее куска, безумно интересная тема, но нас интересует только то, что в большинстве случаев, если инфекция бактерий произошла вирулентным фагом, то бактерия обречена. Не всегда размножение фага в ней успешно, но, как правило, оно происходит — и бактерия лизируется. Существуют некоторые системы устойчивости бактерий, которые позволяют фаг внутри клетки заингибировать. Иногда клетка при этом выживает, иногда — нет, но давайте на этом феномене подробно останавливаться не будем, хотя он тоже может быть иногда важен для фаговой терапии.

Наконец, когда приходит время, в клетке синтезировано большое число фагов. На этой схеме вы видим схему того, как они собираются из разных групп. Я позволю себе даже не комментировать, чтобы не уйти в дебри. Это как конвейер, на котором одни частицы уже готовы, другие только начинают собираться, количество фагов накапливается — и в какой-то момент специальные белковые системы говорят: «Все, хватит!» — и клетка взрывается, не исчерпав на 100% свои ресурсы, и фаги выходят наружу. Выглядит это так – это электронная микрофотография лизированной фагами клетки, эти штучки – фаговые частицы, которые из нее лезут. Что там происходит? Внутри клетки накапливается фермент, способный разрушать жесткий слой ее оболочки, но он не может вылезти за пределы клеточной мембраны до тех пор, пока другой белок фага, так называемый холин, не сделает в нем дырку, а процесс образования дырки строго контролируется, он происходит через заданное время. Как только сделаны дырки, фермент сразу вытекает из клетки и довольно быстро разрушает клеточную оболочку — и клетка разрушается. С чем и связано это свойство переведения большей части органики этой клетки в растворимое состояние. Для фаговой терапии это свойство не очень актуально, а для морских экосистем мы это обсуждали выше. Интересно то, что фермент, который это делает, обычно не утекает далеко из лизированной клетки, потому что у него есть домен, кусок, который связывается с каким-то участком клеточной стенки вокруг, рвет все связи. В советских фильмах про грабителей показывали, когда они делали дырку в стеклянных дверях алмазным стеклорезом с присоской: прилепили, обвели круг и открыли. Эта штука работает таким же образом, поэтому фаговые лизины предложено использовать в качестве самостоятельных антибактериальных препаратов, ибо они способны связываться с определенными бактериями и избирательно убивать их. Особенно это хорошо получается с так называемыми грамположительными бактериями, кто знает, что это, – хорошо, а если кто-то не знает, то и Бог с ними, потому что для нашего разговора сейчас это не очень актуально. Правда, здесь тоже есть свои затруднения, которых мы тоже пока касаться не будем.

Следующий важный момент, который диктует нам структура фагового цикла, – это пороговый характер роста. Эта публикация, цитированная здесь, цитируется очень часто, хотя сама по себе работа не очень интересная. Люди заметили, что если поместить в пробирку фаг и бактерию и посмотреть, как они растут, то размножение фага начинается часто не сразу, а тогда, когда концентрация бактерий достигает определенного предела — порядка 104 клеток в миллилитре — и этот предел примерно соблюдается для различных систем фаг — бактерия. Почему? Поначалу было непонятно, хотя что тут непонятного, мне сложно сказать, все дело в простой математике, хотя искали физиологическое объяснение, но, на мой взгляд, оно значительно проще. Я понимаю, что эти выкладки вызывают некоторое неудовольствие у части аудитории, но давайте вспомним о том, что адсорбция фага — это взаимодействие двух частиц: бактерии и фага. Они как-то болтаются в броуновском движении, соударяются, и некоторые соударения приводят к тому, что они слипаются. Из школьного учебника по химии мы знаем, что обычно такие реакции имеют кинетику второго порядка, то есть скорость реакции зависит от концентрации обоих компонентов — концентрации бактерий, концентрации фагов. Если мы рассматриваем случай, когда бактерий много больше фагов, они при этом не тратятся, то получаются такие уравнения. Я прошу мне позволить не пытаться демонстрировать их вывод, я не очень хороший математик, но, поверьте мне на слово, это действительно следует из этого дифференциального уравнения. О чем это говорит? Это говорит о том, что время, которое нужно фагу для того, чтобы половина наличных частиц адсорбировались на бактериях, зависит от концентрации бактериальной популяции. Если бактерий много, примерно 108 клеток на мл, то время полуабсорбции среднестатистического бактериофага будет порядка 3,5 минут при константе примерно 2х10-9 мл/минуту. Если бактерий будет 106 в миллилитре, то есть миллион в миллилитре, на абсорбцию половины фага необходимо будет потратить 350 минут – это почти 6 часов, изрядное время. Адсорбция половины фага — это не очень значимый для эксперимента параметр, поскольку для того, чтобы увидеть его размножение, достаточно абсорбции меньшего количества, порядка 2%, потому что в среднем из одной клетки получается где-то сотня частиц — иногда больше, иногда меньше. Даже если взять 50, то 2% фагов отсорбировались, лизировали клетки и уже общее количество удвоится. Время, которое необходимо, чтобы адсорбировать 2%, будет примерно 10 минут при концентрации бактерий миллион в миллилитре и тысяча минут при концентрации 10 тысяч бактерий в миллилитре. То есть если время полураспада фаговых частиц в этой системе будет больше, чем время, которое необходимо, чтобы они адсорбировались так, чтобы размножиться в 2 раза, то мы будем видеть их рост – это простая арифметика. Отсюда следует, что если мы не будем накапливать фага, у нас есть его достаточно мощный сток в нашем организме. Это так, потому что фаговые частицы разрушаются в нашем организме довольно интенсивно, то тогда мы будем видеть с вами такие ситуации. Принципиальное отличие фага от антибиотиков и других антибактериальных препаратов состоит в том, что это дискретные частицы, каждая из которых потенциально способна убить бактериальную клетку. То есть с точки зрения популяции — да, существует  концентрация фага, и она очень важна, с точки зрения конкретной клетки никакой концентрации фагов нет. Если она встретилась с одним-единственным фагом, то этого достаточно, чтобы умереть. Может быть, это один единственный фаг во всей Вселенной, специфичный к этой клетке, но ей просто не повезло. Если ей повезло больше, то фагов вокруг может быть много, а ей ни одного не досталось. Даже если у нас есть 10 фагов на каждую клетку, причем не просто вообще есть, а 10 фагов в среднем адсорбировалось на каждую клетку, то можно посчитать, что примерно 5 клеток из 100 тысяч фага не получат вообще, потому что какие-то получат больше 10. Отсюда получается, что есть два вывода. Во-первых, существует пороговый характер действия этого фага, существует концентрация бактерий, минимально необходимая для того, чтобы фаги росли, обычно это 104 и больше бактерий в миллилитре, если ничего им не мешает, и существует концентрация фага, которая позволяет остановить рост бактерий здесь и сейчас, не когда-нибудь потом, когда фаги накопятся, а прямо сейчас половину бактерий заразить, прежде чем они успеют поделиться – это концентрация порядка 107 фагов в миллилитре, это важно для терапии. Следующий вывод состоит в том, что фаги никогда в открытых системах, то есть там, где они не накапливались, там где есть сток, бактериальную популяцию под корень не выбьют, они просто не смогут долго поддерживать должную концентрацию, они убьют много бактерий, их самих станет много, но потом фаговый щит тоже разрушится, и какие-то выжившие бактерии, в том числе чувствительные к фагам останутся. Поэтому добивать патогена должна иммунная система. В связи с этим я считаю бесполезными модные идеи разработки фаговой терапии, например, для того, чтобы помочь детям, больным муковисцидозом, у которых в легких плещется экссудат, заражающийся всякими бактериями, — просто потому, что там можно с помощью фагового препарата снизить концентрацию патогенных бактерий, но никогда не до нуля, и если мы уберем фаг, она размножится обратно. Если мы говорим о раневой инфекции у относительно здорового человека, то шансы на успех гораздо выше. Грузины рапортовали, что у них получилась терапия на больших минновзрывных ранениях во время абхазских войн, то там все замечательно получается. Мы сводим популяцию бактерий к некоторому минимуму, когда иммунная система с ней уже справляется. Отсюда следующий вывод: фаговая терапия может быть активной, то есть в ситуации, когда разложение фага прямо в организме достаточно для того, чтобы поддерживать его действующую концентрацию, то есть больше, чем пороговая численность, нужная для того, чтобы подавить размножение бактерий. Это может быть, например, когда мы лечим какую-нибудь кишечную инфекцию, связанную с диареей. В некоторых экспериментах на коровах показано, что достаточно подержать корову в невычищенном стойле, где была корова, которую лечили фагами, для того чтобы она была защищена от экспериментального заражения неким коровьим диарейным микробом (там  использовались штаммы шигелл).  Примерно так может получиться, если патоген в крови. В данном случае проведены результаты эксперимента по лечению мышей от экспериментальной инфекции золотистым стафилококком. На графике — мышь, которую лечили фагами от бактерий в крови. Они выросли, поддерживались, затем добавили фага — и они упали почти до нуля. То же самое происходит практически во всех органах несчастной мыши. Почему несчастной? Потому что ее все равно потом убили, вытащили органы и померили там концентрацию фагов. В этой ситуации размножение фагов в мышах достаточно, и в полном соответствии с рекламными проспектами ФГУП Микроген, который производит фагов, достаточно одной частицы,  чтобы вылечить животное. На самом деле вряд ли одной, 105 будет достаточно. Бывает также пассивная фаговая терапия. Ситуация, когда фаги разрушаются быстрее, чем они могут размножаться, но это не значит, что они не убивают бактерий. Мы можем лить их долго и упорно — и мы достигнем эффекта. Вот та же самая история. Если мы на мышах производим кожное заражение и обрабатываем их фагом сразу же вместе с бактериями, то все хорошо, не образуется абсцессов. Эти столбики отражают размер и число абсцессов на коже у мышей. Если мы действуем фагом несколько погодя, то абсцессы образуются, но их величина и размер каждого уменьшается, то есть в этой связи мы говорим о том, что у нас осуществляется пассивная фаговая терапия, мы вносим фага извне и долбим эту популяцию до тех пор, пока не задолбим. Отчасти это связано с тем, что бактерии любят делать биопленки – это такие разрастания, их иногда называют городами микробов, когда на какой-то поверхности образуются микроколонии бактерий, выделяющие специальную слизь, которая защищает их много от чего, в том числе — от фагов. Кроме того, они там приобретают особое физиологическое состояние, поэтому в этих биопленках обычно есть дырки, которые обеспечивают ток воды. Это реальный снимок на сканирующем микроскопе. Это бактерии, это слизь, их скрепляющая. Фаги могут инфицировать эти биопленки, но инфекция распространяется вглубь — медленно, но распространяется. Этому делу можно помочь, сделав генно-инженерного фага, который заставляет бактерию не только делать новых фаговых частиц, но еще делать внутри себя фермент, разрушающий мактрикс биопленки — и тогда пленка разрушается. И даже если фаги не добьют бактерии до конца, то нарушение структуры биопленки делает патоген доступным клеткам иммунной системы, и его могут доесть макрофаги. Так что применение фаговых препаратов зачастую оказывается более эффективным, чем применение антибиотиков, в ситуациях труднодоступных локализаций бактерий. Например, грузинские исследователи очень гордятся своими опытами лечения остеомиелитов у больных с инфекцией костей, в которых даже возбудители чувствительны к антибиотикам, но эти антибиотики туда плохо проникают. А фаги попадают в какое-то место, лизируют здесь бактерию, лизируют еще несколько бактерий в округе, потом эта волна достигает дырок в биопленке, естественно, фаги рассеиваются — и распространение массового лизиса на весь кусок биопленки не получается. Но мы добавляем фага еще и еще, ведем терапию в течение длительного времени и в конечном итоге достигаем успеха. Кроме того, в биопленках, когда мы их лечим антибиотиками, сохраняются так называемые клетки персисторы – это специальное состояние бактериальной клетки, когда она как бы спит, в ней подавлены многие биохимические процессы, я не буду останавливаться на том, как это достигается, но очень многие бактерии, примерно 10-4 клеток в популяции, впадает в такую спячку на всякий случай, и антибиотики на них не действуют. Не потому что они имеют какие-то специальные гены устойчивости, а потому что в них временно не работают те процессы, которые антибиотики нарушают. Зато эти персисторы выживают, и при исчезновении антибиотика они растут. Здесь мы видим эксперимент, очень знакомый тем из вас, кто имеет дело с генной инженерией. Если оставить эту колонию бактерий, она устойчива к ампициллину, который есть на этой чашке Петри. Устойчивость к ампициллину связана с умением бактерий разрушать антибиотик. Сначала выросла эта колония, она разрушила антибиотик — и потом вокруг нее вдруг начали расти мелкие колонии. Эти бактерии лежали на этой чашке, эти были клетки персисторы — и дождались своего часа, а большая часть других, которые были активны, погибли, а эти дождались и стали расти, хотя если мы их высеем отсюда на свежую чашку, то мы убедимся, что они чувствительны к ампициллину. Прелесть фагов состоит в том, что, по некоторым довольно скудным данным, они и персисторов тоже инфицируют, правда, не могут в них сразу размножаться, во всяком случае, некоторые не могут, но все равно инфицированная клетка персистор больше никого беспокоить не будет, потому что при ее активации наступает размножение фага, лизис и смерть клетки. Поэтому в некоторых случаях можно проводить длительные курсы фаговой терапии, эти фотографии любезно предоставлены Анджеем Горским, польским ученым, вице-президентом Польской Академии наук, который был у нас в лаборатории.  Это терапия хирургической инфекции после масштабной операции на сердце, которая (терапия) продолжалась в течение 7 недель. И мы видим, что был достигнут существенный клинический результат, и стафилококковые инфекции шва были уничтожены, однако потом случился рецидив, и дополнительный цикл фаговой терапии опять позволил долечить этого пациента, который избавился от своей инфекции. Вся эта история относилась к вопросу о фармакодинамике фагов, то есть как они действуют на популяцию.

Остается еще немного поговорить о фармакокинетике. Как фаги распределяются в организме? Вообще-то, если мы купим фага российского производства в аптеке, то там написано, что эти препараты можно применять местно, это на самом деле правильно, правда, если вам еще повезет найти хорошую баночку, в которой фага будет достаточно много, они, к сожалению довольно вариабельны в этом отношении, но если повезет, то их можно применять местно, и стафилококковые инфекции на коже можно так победить. От системных или внутренних инфекций их предлагают пить. Есть некоторые клинические исследования, которые говорят, что это помогает. Я не знаю, что там в реальности происходит, поскольку хороших системных исследований на человеке проникновения фага из ЖКТ в кровь нет. Есть не очень хорошие исследования, которые мне непонятны. Они выглядят примерно так: выпили стакан препарата такой-то марки — и нашли, что фаги есть в крови. Сколько было фагов в этом стакане, каких, это неизвестно. А в хороших экспериментальных исследованиях на животных обычно оказывается, что модельные фаги в кровь так просто из питья не проникают, но зато неплохо проникают туда, если мы вводим их мышам внутрибрюшинно, или внутримышечно, или подкожно. У нас истекает время, поэтому я вынужден несколько скомкать эту историю. Здесь представлены данные лечения мышей от экспериментальной инфекции синегнойной палочкой, штамм Pall 1, и если мы лечим мышей через 48 или даже через 72 часа после заражения фагами, которые мы вводим внутрибрюшинно, то в некоторых экспериментах увидели почти 100% выживаемость этих мышей. Если мы вводим их подкожно, то результат немного хуже, порядка 33-50%, а в контроле, где вообще не лечили, практически все мыши погибли. Исследования содержания фагов в разных частях мышей показывают, что они появляются в крови, но довольно быстро исчезают оттуда, а накапливаются они в печени и селезенке, где разрушаются так называемой ретикуло-эндотелиальной системой, то есть клетками-макрофагами в тканях человека или животных. Однако выясняется, что существует возможность получать мутантов фагов, хуже распознаваемых макрофагами. Впервые это было опубликовано в конце 90-х годов, оказалось достаточно  одной аминокислотной замены в белке головки фага, но этого белка довольно много, поэтому понятно, что это влияет. Этот мутант может циркулировать в крови в тысячу раз дольше, чем дикий тип, и, естественно, оказывается более эффективным в терапевтических воздействиях. Здесь показаны результаты исследования распределения двух фагов. Фаг W-дикий тип, wild, довольно быстро исчезает из крови, через 24 часа мы его не видим в крови, он оказывается в селезенке и печени, а фаг D-мутант остается в течение всего эксперимента в крови, и даже его количество в конце оказалось больше, чем вначале, что, видимо, связано с тем, что этот фаг размножался некоторое время в кишечнике мышей. В дополнительных экспериментах показано, что если мы вместе с таким фагом дадим мышам еще немного бактерий, то, во-первых, они их спасают от этих бактерий, а во-вторых, остаются в крови до 38 суток, правда, за это время в мышах начинают вырабатываться противофаговые антитела, и они, боюсь, их уничтожат. Оказывается, если влезть в это дело несколько глубже и поработать с конкретным фагом, то можно его, как говорят, доработать напильником, можно заставить его циркулировать дольше и, может быть, можно улучшить его проникновение из ЖКТ в кровь. Мы пытаемся организовать такие исследования, но это довольно тяжело логистически. Есть некие обнадеживающие данные, которые говорят о том, что проникновение частиц фагов в кровь из кишечника — это не пассивный процесс, активный, то есть определенные молекулы на поверхности клеток эпителия кишечника связываются с частицами и с какими-то целями перетаскивают их через этот барьер. Можно долго рассуждать о физиологии и биологическом смысле такого перетаскивания, но было продемонстрировано, что это действительно так, и, по всей видимости, есть надежда подобрать специальные генетические – или, может быть, не генетические изменения поверхности фагов, которые будут улучшать его перенос из поверхности кишечника в кровь. Но я не уверен, что то, что мы можем подобрать мышам, будет работать в людях, но все мои попытки организовать такой эксперимент на людях – кстати, довольно безопасный эксперимент: надо дать попить фага добровольцам или даже больным и потом брать кровь, — вызывает большие затруднения организационно-практического характера, врачи, например, говорят: «А как мы с вами будем обосновывать необходимость такого частого взятия крови?» Мое время практически истекло, поэтому я думаю, что на этом нам стоит разговор завершить. Я благодарю вас всех за внимание и буду рад ответить на вопросы.

 

Обсуждение лекции

Борис Долгин: Когда речь шла о том, что взяли океанскую воду и проанализировали, прозвучала мысль о том, что пришлось существенно пересмотреть представления о пищевых цепочках. А как пересмотреть? Как это выглядит теперь? Что изменилось?

Андрей Летаров: Оказалось, что необходимо учитывать, что определенный, довольно значительный процент биомассы, причем разных групп — как продуцентов, так и прочих микроорганизмов — подвергается вирусному лизису, и это органическое вещество перераспределяется между другими бактериями, и если мы пытаемся предсказать активность и численность разных видов, рассчитывая, сколько им достанется пищи, то мы сделаем серьезную ошибку, если мы не учтем…

Борис Долгин: То есть это просто нормальные изменения параметров в уравнениях?

Андрей Летаров: Да. Выясняется, что в этих моделях не сходятся концы с концами, если не учесть фагов и все остальное померить аккуратно.

Борис Долгин: Теперь сходится?

Андрей Летаров: Утверждается, что да — до тех пор, пока не откроют какой-нибудь еще… Вообще на самом деле так часто бывает, какое-нибудь явление везде, мы постоянно стукаемся об него лбом и не замечаем до тех пор, пока не найдем кнопку. Как только мы можем им немного поуправлять, допустим, на чашке вырастить или еще как-то…

Борис Долгин: То есть побыть инженерами своего рода.

Андрей Летаров: Да. Люди столько лет делали пиво до тех пор, когда Луи Пастер не сказал: «Елки-палки, дрожжи его делают», — и, причем, с ним долго спорили долго.

Борис Долгин: А как выглядят фаги в эволюционной перспективе: что это, кто это, как это, когда это?

Андрей Летаров: На самом деле, очень тяжело ответить на этот вопрос по той причине, что все попытки реконструировать уходят в настолько глубокое прошлое, что возникает впечатление, что фаги были уже в тот момент, когда не только грамположительные, грамотрицательные бактерии разделились, это 3 миллиарда лет назад, а еще одна ветвь архей была недалеко, поскольку у них бывают похожие вирусы, и как оно вышло, можно только гадать. Гадать пробовали, я тоже пробовал — на картах, на кофейной гуще, — и у меня получилось, что, скорее всего, фаг — это продукт развития так называемых эгоистических ДНК, типа плазмид или транспозонов и, видимо, первый фаг на самом деле не размножался эффективно в литическом цикле, а переносил плазмиды от одних клеток к другим и за счет этого жил. По этому поводу была моя первая серьезная публикация, это было довольно нагло для аспиранта, который еще не опубликовал ни одной нормальной статьи, хотя, нет, одна у меня была, я написал по этому поводу обзор в 1998 году, могу дать почитать.

Борис Долгин: Да, спасибо. Тут прозвучали еще, видимо, «археофаги»… Или как их называют?

Андрей Летаров: Назовем их вирусы архей.

Борис Долгин: Вирусы архей. А в чем сходства, различия, объединяют ли их как-то вместе?

Андрей Летаров: Поскольку и те, и другие считаются формально прокариотами…

Борис Долгин: В смысле — бактерии и археи.

Андрей Летаров: Бактерии и археи. Соответственно, какое-то дежа вю, когда я где-то говорю о фагах, все это скатывается к разговору об отличии архей от бактерий. Есть две ветви архей: Euryarcheota и Crenarcheota. У эвриархеот, которые с виду немного поближе к бактериям, не то чтобы филогенетически, скорее — по организации, есть фаги, похожие, в том числе, и на хвостатые фаги нормальных бактерий, а у кренархеот вирусы совершенно странные, похожие на какие-то лимоны, на какие-то палки, некоторые из них не лизируют клетки, а выращивают там какие-то пирамидки, которые прокалывают стенку. Их разнообразие очень велико, семейства описываются чуть ли не ежегодно, по-моему, всего 2-3 лабораториями, одна из них, кстати, руководима Давидом Прангишвили, бывшим советским грузинским ученым, который теперь работает в институте Пастера в Париже, и, к сожалению, они успевают характеризовать их геномы, немного посмотреть на циклы, но разобраться подробно – это дело некого будущего, то есть действительно археи — это мир совсем другой, но они патогенными не бывают, поэтому к фаговой терапии это никакого отношения не имеет.

Борис Долгин: Поскольку бороться не так актуально, то изучают это медленнее.

Андрей Летаров: Не совсем так, просто руки пока еще не дошли.

Борис Долгин: Спасибо. Коллеги, вопросы и реплики. Просьба представляться.

Константин Иванович: Скажите, пожалуйста, вы не сказали, насколько чувствительны фаги к температурным режимам и к влажности, и связано ли это с сезонными заболеваниями — зима, весна, лето, осень? Спасибо

Андрей Летаров: Спасибо, Константин Иванович, вопрос понятен. На самом деле чувствительность фагов к разным биоцидным агентам очень здорово отличается от фага к фагу. Как правило, они неплохо переносят нагревание градусов до 45-50 и довольно кислую и довольно щелочную среду. Высушивание их часто губит, но не до конца. Есть, например, замечательный фаг Т1 – гроза производств, основанных на кишечной палочке, например, рекомбинантного инсулина, потому что он отлично переносит высушивание и если где-то заводится, то вывести его из производственного помещения будет тяжело. С сезонными заболеваниями вряд ли это связано, хотя это хорошая мысль. Еще д’Эрель — по этому поводу был чуть ли не скандал в те далекие годы — считал, что фаги — это важное звено иммунитета, и до сих пор есть некие теории, говорящие о том, что природные фаги в естественной микрофлоре могут составлять некоторую защиту от бактериальных патогенов. Я, честно говоря, не думаю, что они напрямую эту роль выполняют, но думаю, что в связи с тем, что гомеостаз организма работает довольно хорошо, даже в очень жаркую погоду температура внутри нас не сильно выше, чем в холодную погоду, если мы живы, конечно, поэтому вряд ли сезонные заболеваниями связаны именно с этим.

Борис Долгин: Спасибо. Еще. Просьба представляться.

Валерий, Биохим, МПГУ: Скажите, пожалуйста, а геном бактериофага — насколько он большой относительно бактериофага λ, то есть у него есть 50 тысяч нуклеотидных пар и какой геном, например, у трансгенных бактериофагов, которые делает человек?

Андрей Летаров: Спасибо, вопрос понятен. Я не сказал фразу, которую думал. Естественно, когда мы с вами говорим бактериофаг — если мы биологи, к сожалению, врачи иногда употребляют это слово иначе, — для нас бактериофаг — это вполне конкретная биологическая сущность, конкретный вид, штамм фага, конкретный вирус. Так вот, геномы фагов бывают, я имею в виду хвостатых фагов, давайте на них остановимся, от примерно 10 тысяч пар до более 500. Типичные размеры — это либо 40-60, либо 130-200, бывают и промежуточные, но их поменьше. Что касается трансгенных фагов, то их геномы примерно такие же, как у тех, из которых эти трансгены сделаны, за исключением ряда специфических ситуаций, когда кто-то поработал над изменением размера головки. Это иногда удается сделать в специальных целях, но в среднем примерно то же самое, поскольку задача состоит не в том, чтобы запихнуть как можно больше какого-то нового материала, а в том, чтобы направленно изменить нужные свойства. Я воспользуюсь случаем, чтобы еще раз подчеркнуть, когда мы видим банки, на которых написано «Бактериофаг синегнойный», купили в аптеке, это не значит, что нам продали штамм фага, это значит, что нам продали какой-то коктейль, где этих фагов может быть довольно много разных, и на самом деле — открою вам тайну, что даже производители не знают, сколько и каких. Это большая проблема. Часто доктора говорят: «Есть «Бактериофаг синегнойный» уфимского производства, и мы протестировали, что эти бактерии к нему чувствительны», мне как биологу это вообще ни о чем не говорит, это значит, что накапали из этой баночки капельку и увидели там какой-то лизис. Ко всем фагам в этой банке чувствительны бактерии, к некоторым, или это вообще не фаг, а консервант (такое тоже бывает)? Тут требуется вдумчивый подход.

Борис Долгин: Когда-нибудь объединение усилий ученых и производителей ожидается? Так, чтобы производители знали, что они производят, ученые примерно понимали, что же…

Андрей Летаров: Знаете, работают. На самом деле нет никаких отвратительных злодеев — и производители хотят делать хорошие фаги, и ученые не прочь над этим поработать, но не всегда удается все это воедино свести, например, для того, чтобы понимать, нужно перестроить все производство – это довольно дорого стоит. Какие-то исследования, сейчас, я знаю, лаборатория в Институте биоорганической химии моего хорошего знакомого Мирошникова, и с моими коллегами они занимаются созданием специальных систем, которые позволят производителям хотя бы приблизительно с помощью дешевых экспресс-тестов разобраться, что же они там такое произвели, хотя они в принципе думают о переходе на другой уровень техники, которая позволила бы делать более современные фаговые препараты.

Максим: Добрый день! У меня такой вопрос: есть ли данные об исследованиях лизиса бактериофагами грибных клеток?

Андрей Летаров: Данные есть. Грибные клетки фагами не лизируются никогда ни за что, но у грибов есть свои вирусы грибов, но это эукариотические вирусы, в которых я не разбираюсь.

Евгений: Добрый день! Скажите, правильно ли я понял, что сейчас неизвестно, каким образом фаги поступают из желудочно-кишечного тракта в кровь и дальше из крови?

Андрей Летаров: В сущности, да, вы правильно поняли.

Евгений: То есть, судя по мышам, они как-то поступают, но как – неизвестно.

Андрей Летаров: Судя по мышам, они не очень поступают. Тут, правда, есть одна тонкость — проницаемость разных барьеров, в том числе — в мышах, может сильно различаться у больных мышей и у здоровых. Еще в 1943 году было опубликовано очень красивое исследование, где мышей заражали возбудителем дизентерии в мозг. Я, честно говоря, не очень понимаю, что нужно делать в практической жизни, чтобы получить дизентерийный менингит, но оказалось, что у этих мышей фаги из внутрибрюшинной инфекции проникали в мозг, размножались там и спасали от мозговой дизентерии, а если этих фагов вколоть здоровым мышам, то в мозгах их не обнаруживалось, то есть гемато- энцефалический барьер почему-то по проницаемости для фагов различался, во всяком случае, в 1943 году, у мышей кардинально в зависимости от физиологического состояния. Поэтому я не исключаю, что при каких-то кишечных расстройствах, может быть, фаги проникают в кровь значительно лучше, чем у здоровых животных.

Евгений: То есть, в общем, они все-таки проникают, просто пока неизвестно, как и что этому способствует?

Андрей Летаров: Есть русские работы, и люди серьезно говорят, что они пользуют фагов в урологии, что они мало что проникают, так еще выделяются с мочой. Я не очень понимаю, как частицы размером в сотни нанометров будут фильтроваться через базальную мембрану капилляров почечных клубочков, но, тем не менее, может, при нефритах, если белок есть в моче, то почему бы не быть фагу, может, оно и работает, но это все надо исследовать с особым цинизмом, и, к сожалению, может выясниться, что у мышей это так, а у людей — совсем иначе. С другой стороны, если есть такие успехи у клиницистов, это заслуживает серьёзного внимания.

Евгений: И вдогонку еще один вопрос. А не может ли быть, даже если фаг не проникает, но он «вычищает» желудочно-кишечный тракт, освобождает иммунитет от этих забот и поэтому иммунитет лучше работает?

Андрей Летаров: Фаги высокоспецифичны, и если у вас, допустим, какой-нибудь стафилококк в почках, то убиение его в кишечнике может не состояться, потому что его там нет.

Борис Долгин: И ничего другого не убьет.

Андрей Летаров: Да, стафилококковый фаг ничего другого не убьет потому что они не только видо-, они еще и штаммо-специфичны, за редким исключением, и, может быть, они могут обладать прямым действием на иммунную систему, этой идеей очень увлекаются польские коллеги, но это вообще отдельные дебри, в которых, может быть, лет через 10 удастся разобраться. Они утверждают, что фаговые частицы сами по себе взаимодействуют с иммунокомпетентными клетками и как-то на них влияют, например, уменьшая миграцию опухоли, но это действительно к антибактериальной активности не имеет никакого отношения, и есть еще один важный момент — большинство препаратов, которые сейчас продаются, — почему их предлагают пить, а не вводить внутримышечно? Потому что это просто грубые лизаты бактерий, немного очищенные центрифугированием и фильтрованием, скорее фильтрованием, они содержат довольно много обломков бактериальных клеток, и эти обломки часто обладают своей собственной, в том числе иммуностимулирующей активностью. До недавнего времени в Соединенных Штатах производили некий фаговый лизат, который с успехом употребляли как иммуностимулятор, то есть действие препарата из аптеки может не полностью заключаться только в антибактериальной активности.

Борис Долгин: Потому что вызвано его совершенно другим составляющими.

Андрей Летаров: Может быть вызвано не только фаговой составляющей, но на мой взгляд, лучше мухи отдельно — котлеты отдельно.

Даша, ИНМИ: Здравствуйте, скажите, пожалуйста, а что известно о бактериофагах гипертермофилов, гипертермофилах вообще, и как они выживают при таких условиях, и как на них действует автоклавирование?

Андрей Летаров: Спасибо, Даша. Про бактериофагов гипертермофилов известно, что они есть. Это, как правило, археи, и у них самые странные вирусы во множестве выделены, или зачастую они даже их не лизируют с образованием бляшек, например, накапливаются очень часто в культуре, они являются в наших терминах умеренными и выделяются лизогенными археями. Как они выживают в этих условиях, Бог их знает, но, вероятно, благодаря тому, что они имеют термостабильные белки, так же, как и их хозяева. Что касается их автоклавирования, я никогда не пробовал их автоклавировать, но я полагаю, что…

Борис Долгин: Что такое автоклавирование?

Андрей Летаров: Автоклавирование — это прогревание паром под давлением, то есть скороварение, грубо говоря.

Я никогда не слышал о таком эксперименте, но это хорошая идея. У тех, которые живут в гипертермофилах под водой, в «чёрных курильщиках», где и вода, и давление, и температура 120°, наверное, если у них есть фаги, то они должны быть устойчивы к автоклавированию, но мне в руки такой объект никогда не попадался, я обязательно попробую посмотреть в литературе, можно даже написать Давиду Прангишвили и спросить, что он думает.

Ибрагим: Здравствуйте, скажите, а от лечения бактериофагами наблюдаются какие-нибудь побочные негативные воздействия?

Андрей Летаров: Побочные эффекты?

Борис Долгин: И как выделить в этих эффектах воздействие бактериофагов, а не прочих примесей?

Андрей Летаров: На удивление мало сообщений о существенных побочных эффектах от лечения бактериофагами. Часть таких сообщений носит характер устного предания: «Мы попробовали — стало хуже». Что и от чего стало хуже, непонятно, поскольку, во-первых, случаи единичные, и не очень понятно, связано ли действие с бактериофагами или с тем, что просто человеку просто так совпало, что стало хуже. Вы понимаете, когда людей много, то кому-нибудь обязательно станет хуже на следующий день после приема фагов, даже если всем будем давать плацебо.

Борис Долгин: То есть, строго говоря, нормальных экспериментов, которые бы давали негативные результаты…

Андрей Летаров: Эксперименты с контролем безопасности были. Научных результатов, говорящих о том, что от них становится сильно хуже, нет. Недавно были осуществлены несколько safety trail по современным европейским стандартам бельгийцами и швейцарцами другими фагами, у них получились результаты, что — да, это совершенно безопасно. Есть некоторые осуществляемые попытки — в том числе, и нами — разобраться, как действуют фаги на кишечные бактерии. Особенно интересуют фаги кишечной палочки, потому что некоторые штаммы кишечной палочки патогенны. Насколько они могут действовать на резидентную кишечную палочку, это довольно интересный вопрос, до сих толком пор не выясненный, но из общих соображений я думаю, что вряд ли можно фагами убить всю резидентную кишечную палочку и вызвать серьезный бактериоз. В некоторых случаях можно предполагать, что могут быть осложнения, если в ситуации, где очень много доступных бактерий для фагов в организме присутствует, они начинают дружно лизироваться, и кусочки бактерий могут вызвать токсический шок. Такая возможность теоретически обсуждалась, но ни одного подтвержденного случая токсического шока из-за фаговой терапии в литературе, я, во всяком случае, не видел. Есть еще одно очень активно дискутируемое опасение о том, что фаги могут переносить бактериям и какие-то нежелательные гены. И действительно, теоретически могут, но во-первых, с одной стороны, неиспользование умеренных фагов сильно ограничивает эту возможность, а кроме того, бактерии, в общем-то, и без нашей помощи энергично обмениваются генами, и за все время реального опыта человечества в области фаговой терапии я не видел и не слышал ни одного ни устного, ни письменного сообщения о том, что in vivo был образован какой-то убийственный штамм, который что-то сделал. У меня такое ощущение, что это на самом деле больше теоретическое опасение. Теоретически такое возможно, но, на мой взгляд, иногда надо рисковать. Мы, например, точно знаем, что антибиотики вредны и, тем не менее, их применяем, потому что некуда деваться. Мы предполагаем, что, может быть, теоретически в очень небольшом проценте случаев от фаговой терапии можно помереть, но соответственно, от антибиотикотерапии можно помереть с вероятностью порядка на три больше. Надо выбирать.

Голос из зала: Скажите, пожалуйста, есть ли фаги против особо опасных инфекций, какая их реальная значимость против этих инфекций?

Андрей Летаров: Фаги против особо опасных инфекций есть. Я упомянул, что еще д’Эрель лечил чуму, кстати, чума — это энтеробактерия, поэтому к ней довольно много фагов, холеру, причем история в Индии была очень забавная. Они пытались поставить контролируемое исследование, то есть в определенных областях назначенные опытные фаги давали населению, в других – нет, и через некоторое время был достигнут настолько хороший эффект, что индийское правительство решило прервать эксперимент и давать фагов всем, потому что так можно спасти людей, но зато найти нормального доказательства концепции, к сожалению, не удалось, хотя результаты были очень обнадеживающие. Есть фаги противосибиреязвенные, я не говорю, что есть лечебные противоосибиреязвенные препараты, хотя в литературе обсуждались, но фаги у этих организмов присутствуют, а чумные и холерные были даже использованы на практике. Подробнее — это, к сожалению, не очень ко мне, поскольку этим занимаются довольно специфические органы.

Голос из зала: Скажите, пожалуйста, а какие вообще болезни лечатся фагами? Меня, прежде всего, интересуют аллергии, экземы, можно ли применять? Потому что процесс идет, постоянно образуются клетки.

Андрей Летаров: При аллергии довольно бессмысленно: фаги не иммуносупрессоры в прямом смысле. Лучше всего из того, что лечится сейчас, похоже, получается со стафилококковыми инфекциями, вызванными золотистым стафилококком, кстати, в том числе и знаменитым метициллин-резистентными стафилококками, MRSA, поскольку устойчивость к антибиотикам с устойчивостью к фагам особо не коррелирует. Успех этого предприятия во многом обусловлен тем, что почему-то среди стафилококковых фагов много вирусов с очень широким спектром, которые покрывают одним штаммом очень большое количество штаммов стафилококков. Можно лечить много разных бактериальных заболеваний, где есть какая-то популяция патогена либо расположенная внеклеточно, либо так, чтобы до нее можно было хоть как-то добраться, например, иногда бактерии внутри макрофагов фагами тоже можно достать, если скормить им зараженные клетки бактерий. Такие эксперименты тоже делались. Мне кажется, что вряд ли получится лечить фагами туберкулез, потому что это медленная инфекция со своими патологическими особенностями локализации. Явно бессмысленно лечить фагами хламидиозы или риккетсиозы. Кишечные, особенно Е.coli инфекции, то, что связано с диареей, правда, дизентерийная бактерия, в том числе, и внутриклеточно может размножаться, но практика показывает, что, видимо, внеклеточная популяция тоже очень важна, и подавление ее сильно улучшает ситуацию. Кожные инфекции – это хорошая мишень, поскольку можно применять фаги местно. Раневые инфекции, в ожоговой терапии пытались активно. Вроде бы хорошие результаты получаются у урологов с кишечно-палочными нефритами и циститами, но тут мы только что обсуждали вопрос о том, как они туда должны проникнуть, там придется вводить либо катетером, либо уповать на то, что они действительно выделяются с мочой, что крайне странно. Вот так примерно.

Юрий Дуреба: Здравствуйте. Скажите, пожалуйста, если принимать фаг как кусок кода после того, как он инфицировал клетку, он после этого становится без части своего кода, правильно?

Андрей Летаров: Не понял.

Юрий Дуреба: Он часть свою вовнутрь клетки…

Борис Долгин: Меняется код фага после того, как…

Андрей Летаров: Теперь понял.

Юрий Дуреба: Он активный после этого остается, он воспроизводится сам — фрагмент, который он ввел в середину, или он становится холостой?

Андрей Летаров: То, что вы называете кодом, наследственная информация вируса — это нуклеиновая кислота, которая внутри, молекула ДНК. Вся эта сложная конструкция снаружи — это средство доставки, она действительно остается снаружи и потом больше не используется, он одноразовый, но молекула ДНК, введенная в бактерию, заставляет эту бактерию делать внутри себя, во-первых, еще такую ДНК, то есть она копируется, а кроме того, она заставляет делать белки, из которых собираются новые частицы, и ДНК в них упаковывается, поэтому фаговое потомство воспроизводится полностью. Части, которые остались снаружи, потом вырабатываются в клетке новые.

Юрий Дуреба: То есть он живет только до оплодотворения, потом он погибает?

Андрей Летаров: Оплодотворение в данном случае не очень хороший термин. До инфекции.

Юрий Дуреба: Хорошо. Еще такой вопрос: существуют ли клетки, у которых нет фагов?

Андрей Летаров: В смысле — бактериальные, бактерии?

Юрий Дуреба: Любые.

Андрей Летаров: Фаги — по определению вирусы бактерий, то есть если это клетки не бактерий, у них, конечно, нет никаких фагов. Другой вопрос, существуют ли виды бактерий, у которых нет фагов. Ответить на него сложно. Как правило, если для какого-то вида бактерий фага очень хорошо поискать, то он рано или поздно находится, но это не относится к хламидиям, рикециям. Есть такая забавная бактерия Bdellovibrio bacteriovorus, которая представляет собой хищника, это такая маленькая бактерия, которая крепится к другим, делает в них дырку, пролезает внутрь, там все выедает, а потом выходит, то есть она тоже может делать бляшки наподобие бактериофаговой, так вот у этой бактерии тоже нашли фага, правда не хвостатого. Фаги — это очень древняя эволюционная находка, и они есть почти у всех, потому что они были еще до того, как эти все разделились.

Борис Долгин: Я все-таки перейду к вопросам, которые нам заранее отправили. Сейчас у нас есть возможность в анонс читателям написать вопросы. Будем чередовать. Были ли попытки генетически модифицировать фаг или получить его полностью синтетически?

Андрей Летаров: Попытки генетически модифицировать фага были и производятся каждый день, в том числе есть вектора на основе фагов, это рутинная исследовательская практика. Получить его полностью синтетически — таких попыток не было, хотя можно себе представить. Некоторые довольно простые фаги можно получить в бесклеточной системе трансляции. Я не знаю, можно ли их назвать синтетическими: можно из клетки выделить белоксинтезирующий аппарат и попробовать в пробирке собрать такого простенького РНКового фага, не вижу в этом ничего невозможного.

Борис Долгин: Собственно, с попытками создать искусственную жизнь, почему бы не создать и фага?

Андрей Летаров: Можно, только что это будет доказывать? Фаг не совсем живой, и чтобы он был живой нужен хозяин, а создать искусственную бактерию довольно затруднительно, хотя тут были важные продвижения недавно.

Борис Долгин: Пытались ли вывести фаг для конкретного штамма бактерий, например, выращивая чистую линию этих бактерий, взятых у больного на питательной среде, а потом отбирая фаги, успешно ее заражающие?

Андрей Летаров: Да, пытались, это и есть наиболее правильный  modus operandi.

Борис Долгин: Насколько иммунитет больного мешает фагам, можно ли специфически подавить иммунитет против фагов хотя бы на этапе формирования иммунной системы?

Андрей Летаров: Очень хороший вопрос. Экспериментально показано, что при длительном использовании фагов или при длительных сроках после парентерального введения фагов, то есть уколов, могут вырабатываться антитела, которые их нейтрализуют. Бороться с этим сложно. Можно взять, например, другой фаг, другого антигенного типа, антитела против первого ко второму липнуть не будут. Как-то так выходить из этого положения. Подавить иммунитет, конечно, можно, но, я думаю, вас за это посадят в тюрьму.

Юрий: Большое спасибо за лекцию. У меня такой вопрос: каким образом промышленное производство бактериофагов можно наладить, как транспортировать, как быстро это можно сделать? Если, например, та же самая чума в Гаити — как быстро, если вдруг принять решение лечить людей, как быстро можно наладить, и можно ли на одном и том же оборудовании налаживать производство различных видов бактерий?

Андрей Летаров: Наладить можно. Работают производства большой мощности того же ФГУП «Микроген», который и продает все эти фаги. Это делается в ферментерах – специальные сложным образом оборудованные бочки, в которых размножают бактерии, их заражают фагами. Проблема в том, что довольно тяжело вырастить много разных фагов сразу, потому что это получается дешевле, если использовать большие бочки. Они пытаются найти некие решения. Я не хочу ругаться на «Микроген»: они на меня обидятся, и это ни к чему. Но технически действительно нетривиально, и большинстве случаев вопрос решается так: создается некий центр фаговой терапии, как в Тбилиси или в Польше, где люди лечатся полулабораторно, где в небольших количествах, например, 10 л фага выращивают. У них есть много таких бутылок, и они к нужному штамму подбирают нужный штамм из своей коллекции и делают, может быть, коктейль фагов и его выдают. В некоторых случаях подбирают или даже выделяют заново фага под больного. Это делалось, даже более того, иногда это делают специалисты того же «Микрогена», и такие индивидуализированные препараты работают в разы лучше, честно скажу. Поэтому, на мой взгляд, наиболее правильная организация фаговой терапии, наиболее эффективная — это некоторое научно-производственное объединение, в котором есть клиника, где люди приходят, либо приносят штамм, либо выделяют, подбирается фаговый препарат, есть куча других тонкостей, которые было бы желательно учесть, — и производится индивидуализированная терапия. Так примерно делают поляки, но производительность там будет меньше, чем при массовом производстве. Пытаются выйти из положения, создавая коктейли фагов, которые бьют значительную часть спектра циркулирующего в данный момент возбудителя данного вида. Получается по-разному, поэтому часто выходит, что когда вы покупаете фага в аптеке, вы как бы играете в лотерею. Люди сейчас возмущаются: как совместимо здоровье с лотереей?! В общем, совместимо, потому что вы рискуете только деньгами. Если фаг не сработает, вы вряд ли получите какой-то серьезный негативный эффект — в отличие от употребления антибиотиков, которые не подходят против вашего патогена. При этом часто говорят: «Пожалуйста, купите не просто фаг пиобактериофаг, а пиобактериофаг производства именно уфимского филиала», — потому что они действительно разные, независимые коллекции, и лучше следовать этим указаниям, хотя зачастую надо было бы сказать, что… помните, был какой-то советский фильм, забыл, где собрались за столом сотрудники винного завода в ресторане, принесли бутылку и говорят: «Слушайте, это разлито такого-то числа, вы помните, что было в этот день?» «Унесите». Банка от банки может отличаться довольно сильно, но это биология, поэтому лучше было бы, конечно, иметь центр, где все под контролем

Голос из зала: Спасибо за лекцию, она очень интересная. Но, вы знаете, я шел на лекцию в надежде на то, что услышу, что антибактериальная терапия и терапия антибиотиками зайдет в тупик достаточно скоро, и я думал, что вы нам откроете светлый путь, что лечение бактериофагами — это достаточно перспективная вещь. Этого я от вас не услышал, я понял, что это достаточно сырая вещь. Скажите, пожалуйста, с точки зрения микробиолога, какой же путь  лечения бактериальных инфекций?

Андрей Летаров: Спасибо за вопрос, я вас понял, давайте так для начала — антибиотикотерапия совсем ни в какой окончательный тупик не зайдет никогда, потому что большая часть бактериальных инфекций подхватывается нами в такой обычной среде, дома или на улице, и они, как правило, чувствительны к какому-то спектру антибиотиков, и зачастую их проще вылечить антибиотиками, чем мучиться с бактериофагами, даже несмотря на побочный эффект, и, скорее всего, так будет более или менее всегда. Существенная проблема – госпитальные инфекции, а также ситуации, когда хочется пощадить организм, допустим, у беременных, и несмотря на все мои разговоры о том, что действительно, правда, фаговая терапия — очень сырая технология, она значительно сложнее, причем она и для врача сложнее, потому что это надо держать в голове, но, тем не менее, оказывается, что зачастую даже путем каких-то простых решений удается сильно поднять успешность этой деятельности, если хотя бы следовать простым правилам: что нужно, прежде чем применять фаг, микробиологическим посевом доказать чувствительность этого возбудителя, дальше нам надо применить препарат с подтвержденной нормальной концентрацией этого фага к этому возбудителю; есть люди, которые подумали над тем, как его изготовить так, чтобы можно было ввести, чтобы он достиг цели, — то все будет получаться — хотя не настолько легко, как с антибиотиками. На самом деле, есть альтернативные подходы. Один я упомянул – это использование фаговых литических ферментов, там тоже есть много своих проблем, но больше и надежд, потому что они специфичны, но не настолько узко, как бактериофаги. Есть попытки разработать принципиально новые антибактериальные синтетические препараты, которые антибиотики, — по большей части, продукты жизнедеятельности каких-то других микроорганизмов, грибов или других бактерий, можно найти новые мишени в клетках бактерий и сделать к ним новые препараты. Я думаю, что разумно сочетать все эти подходы, и, на мой вкус, лучше всего фаговой терапии занять две ниши: некого средства, которое неплохо попробовать в не очень тяжелых ситуациях, потому что если поможет, то будет легче, чем с антибиотиками, здесь можно использовать, в том числе, и коктейли широкого спектра действия, — и некоторого последнего довода в случае, если мы имеем дело с некой сложной инфекцией, сложно локализованной или возбудителем или какой-то внутрибольничной вспышкой. В некоторых госпиталях Минобороны очень долго не могли вывести сальмонеллёз, пока им не сделали фагов микрогеновцы, и этим препаратом они справились с многолетней проблемой, были довольны. Об этом рассказывал главный эпидемиолог Вооруженных сил. Вот так примерно.

Борис Долгин: Спасибо. Еще один вопрос: в косметической компании, дальше идет название, есть гель-бальзам с бактериофагами. Может ли он и подобные средства устранить причину воспаления, вредные бактерии, если да, то, как его правильно применять?

Андрей Летаров: Давайте начнем с конца – правильно применять путем намазывания на место воспаления. Может ли он устранить? Честно скажем, теоретически — да, на практике – вряд ли, поскольку я себе тяжело представляю изготовление и распространение этого бальзама, который бы действительно содержал эти бактериофаги в течение должного времени в должном количестве.

Борис Долгин: Спасибо. Есть еще третий вопрос, но он все-таки не имеет отношения к теме лекции.

Андрей Летаров: Да. Кто-то поставил эксперимент — он полгода не моется мылом, и что наука думает об этом? Наука не думает об этом плохо, она вообще об этом не думает.

Борис Долгин: Коллеги, еще вопросы?

Голос из зала: Еще один вопрос. Расскажите о процессе выделения бактериофагов, потому что процесс выделения микроорганизмов — относительно все понятно и просто, а с бактериофагами как? Какие-то чашки Петри засеваются какими-то культурами, и откуда-то берутся пробы – и?..

Андрей Летаров: Конечно. В принципе, это сильно зависит от того, бактериофага к которому микроорганизму мы хотим выделить. Если этот микроорганизм хорошо, нормально растет и на твердых, и на жидких средах, то это, конечно, сильно облегчит дело. Мы берем природный материал, где мы подозреваем наличие этого бактериофага исходя из экологии той бактерии, которая нас интересует и, например, сеем ее на среду с газоном бактерий. Если мы видим бляшки, то это очень хорошо, если мы не видим бляшек, можем поставить накопительную культуру в той жидкой среде, поместить там нашу бактерию и материал, содержащий природный штамм этой бактерии, и возможными бактериофагами поболтать — пускай там все это разрастается, и если есть фаги, они, може,т там вырастут, их концентрация увеличится, и мы потом супернатант этой культуры центрифугируем, осадок выкидываем. Светлое сверху – это супернатант, и это мы можем накапать на газон, и в каких-то разведениях если мы увидим бляшки, значит, выделили бактериофаг. Можно еще какие-то такие подходы придумать. Так примерно.

Голос из зала: Просто интересно — когда я занимался выделением, никогда ничего подобного не видел на культурах, и с какой вероятностью можно их терять, интересно.

Андрей Летаров: Это очень сильно зависит от конкретики. Если вы расскажете, что откуда вы выделяли, я могу попробовать посоветовать вам в частном порядке, как это улучшить, но я не то чтобы волшебник, я только учусь, и поэтому мои советы работают не всегда.

Борис Долгин: Последний вопрос.

Голос из зала: Скажите, а метагеномный подход позволил прочитать огромные кучи геномов бактерий, которые никогда не культивировались, а что насчет бактериофагов? Тоже верно?

Андрей Летаров: Да, метагеномный подход — это современно. Метагеномика бактериофагов… Я должен пояснить, что такое метагеномика. В случае бактериофагов это примерно так: мы берем, допустим, 200 литров океанской воды, концентрируем ее с помощью специальной установки фильтрации так, чтобы отделить плавающие фаги от бактерий, и получаем некий концентрат фагов, выделяем из них ДНК, ломаем её на мелкие кусочки и определяем последовательности большого количества этих самых мелких кусочков, чтобы судить о разнообразии бактериофагов, находящихся в исходном образце. Благодаря изобретению новых высокопроизводительных методов чтения последовательности ДНК типа пиросеквенирования и всяких прочих подходов такого рода, илюминовских технологий и так далее, можно получить феерическое количество данных о ДНК этих бактериофагов. Некоторые из присутствующих коллег, я даже подозреваю, лично этим занимались. И дальше можно сравнить — во-первых, попробовать некоторые кусочки склеить между собой, потому что если они перекрываются, их можно собрать в так называемые контиги – какие-то большие куски геномов бактериофагов восстановить отдельно, а дальше все это сравнивается с базами данных, но обычно в среднем 30-40% последовательностей из таких вирусных метагеномов из природных источников оказываются похожи на что-нибудь в базах данных, и ,как это ни удивительно, пока биологически осмысленной информации, которую можно из вирусных метагеномов извлечь, она бывает немного разочаровывающей. Эти выводы можно сделать намного проще и дешевле, но мне кажется, что тут есть определенные перспективы, можно попробовать сочетать морфологические и метагеномные исследования, в некоторых ситуациях можно пощупать наиболее представленные бактериофаги, потому что они могут, например, инфицировать бактерии, которые мы не умеем выращивать, их там много, а в лаборатории их нет. Зато мы можем как-то изучить и потом, например, с помощью прочих технологий типа ПЦРа отследить их биогеографию, динамику. Таких работ штук 20-30, по метагеномике фагов.

Борис Долгин: Спасибо большое.

Андрей Летаров: Спасибо за внимание.

Бактериофаги «Микроген» используют для спасения детей от сальмонеллеза в Хакасии

Интести-бактериофаги научно-производственного объединения «Микроген», входящего в «Национальную иммунобиологическую компанию» Госкорпорации Ростех, используются для экстренного лечения детей от сальмонеллеза в Республике Хакасия.

В поселке Шира Ширинского района (Хакасия) с применением бактериофагов «Микроген» проводится экстренная профилактика и лечение 16-ти человек от сальмонеллеза. В их числе  – 12 детей. Все контактировавшие с заболевшими также проходят профилактику с применением интести-бактериофагов.

По данным Управления Роспотребнадзора по Республике Хакасия, все инфицированные употребляли в пищу кондитерские изделия местного производства.

«Применяемые интести-бактериофаги являются комплексными препаратами для борьбы сразу с несколькими видами заболеваний, вызванных бактериями сальмонеллы, дизентерии, эшерихиями коли, протеем, энтерококками, стафилококками, псевдомонас аэругиноза. Их применение является не только оперативным инструментом реагирования в таких экстренных ситуациях, поскольку препарат действует комплексно на многие виды бактерий и даже на их сочетание, но и является безопасным для детей любого возраста», — отметил Кирилл Гайдаш, врио генерального директора НПО «Микроген».    

Бактериофаги представляют собой нетоксичные препараты, избирательно поражающие бактериальные клетки. Они не поражают всю микрофлору организма, в отличие от антибиотиков, и могут безопасно применяться беременными, кормящими матерями и новорожденными для лечения широкого спектра бактериальных инфекций. 

По данным на июль этого года, в Тюменской области в районах наводнений, вызванных паводками, для предотвращения вспышки дизентерии и других кишечных инфекций с использованием бактериофагов «Микроген» профилактику и лечение прошли более 4000 жителей области, включая 700 детей.

Всего за последние три года в Сибирском федеральном округе, Приморском крае, Северной Осетии и Дагестане при чрезвычайных ситуациях за счет применения бактериофагов удалось избежать заражения дизентерией более 67 тысяч человек, из которых около 15 тысяч – дети.

НПО «Микроген» является единственным в России производителем лечебных препаратов бактериофагов. Сегодня предприятие разрабатывает первый в мировой практике универсальный бактериофаг от гнойно-воспалительных ЛОР-заболеваний, хирургических инфекций, инфекционных заболеваний детей первого года жизни, дисбактериоза кишечника и других болезней, вызванных бактериями рода Enterobacter. В начале 2017 года завершилась вторая стадия клинических исследований препарата.

Сальмонеллез — БУЗ ВО Великоустюгская ЦРБ

Сальмонеллёз – это группа острых инфекционных заболеваний, вызываемая многочисленными бактериями рода сальмонелл и характеризующаяся преимущественным поражением желудочно-кишечного тракта, приводящим в дальнейшем к обезвоживанию, интоксикации и присоединением полиморфной клиники в дальнейшем.

Причины заражения сальмонеллезом:

Источник – домашние и сельскохозяйственные животные (крупный рогатый скот, свиньи), домашние птицы (куры, гуси утки), кошки, птицы, рыбы, больные люди и бактерионосители.

Пути передачи:

• алиментарный (через яйца, молочные и мясные продукты).
• контактно-бытовой (через заражённые предметы обихода, полотенца, игрушки, горшки, руки матерей).

Клиника

У взрослых и детей старшего возраста (после 3 лет) чаще всего встречается желудочно-кишечная форма сальмонеллеза, протекающая по типу пищевой токсикоинфекции. При этом заболевание может характеризоваться признаками гастрита, гастроэнтерита, гастроэнтероколита. Длительность инкубационного периода при этой форме составляет от нескольких часов до 2–3 дней.
Характерно острое начало заболевания с тошнотой и повторной рвотой, температура тела повышается до 38–39°С, отмечается полное отсутствие аппетита, появляются боли в животе. Затем спустя несколько часов возникает жидкий водянистый понос, испражнения обильные, иногда может быть примесь слизи и крови. Вскоре присоединяется обезвоживание, заболевание сопровождается выраженным токсикозом (иногда вплоть до судорог).
У детей раннего возраста доминирует контактно-бытовой путь инфицирования, но и у них гастроэнтерит и гастроэнтероколит – самые частые формы заболевания. Начало заболевания менее острое, с максимальным развитием всех признаков к 3–7-му дню заболевания. Температура высокая, отмечаются выраженная вялость и бледность кожи с легкой синюшностью носогубного треугольника. Рвота может начаться с первых часов, но может присоединиться и позже, у некоторых детей она носит упорный характер. Быстро развивается обезвоживание. Характерен стул больных: он жидкий, калового характера и постепенно приобретает темно-зеленую окраску (цвет болотной тины), с примесью слизи, нередко и крови, хотя сохраняется большой объем испражнений.

Лечение

Лечение при сальмонеллезе должно быть строго индивидуальным и назначаться только врачом. Основная роль принадлежит диете и коррекции обезвоживания, а также выведению токсинов из организма.
1. Следует соблюдать диетическое питание, исключающее жирную, консервированную пищу, кондитерские изделия, сырые фрукты, молоко.
2. Основной акцент при лечении уделяется регидратации и снятию интоксикации у больных. При длительном поносе для коррекции обезвоживания используют специальные солевые растворы: Регидрон, Глюкосолан, Оралит. Солевые растворы следует пить часто, по несколько глотков за раз (по 5 мл каждые 5 минут). За 6 часов взрослому человеку необходимо выпивать 300 мл каждый час, в последующем следует после каждого стула пить еще по 100-200 мл.
3. Для нормализации функции пищеварительной системы врачом могут быть назначены ферментные препараты.
4. Для восстановления микрофлоры и профилактики дисбактериоза кишечника, который возникает при сальмонеллезе, после острого периода назначают пробиотики, прием которых должен быть как минимум 20 дней.
5. Внутрь принимают сорбенты – это помогает токсинам бактерий связываться и выходить с калом, а не оказывать свое патогенное действие на весь организм.

Как избежать заражения:

• Соблюдение личных гигиенических мероприятий. Мойте руки перед едой – самое важное правило, знакомое с детства, но для профилактики сальмонеллеза и прочих кишечных инфекций является самым действенным.
• Отдельный нож для сырого мяса и рыбы – это касается и разделочной доски, которую вместе с ножом после использования следует тщательно мыть и споласкивать кипятком.
• Не ешьте плохо прожаренное мясо – мясо и птицу следует варить как минимум 1 час.
• Не ешьте гоголь-моголь и не пейте сырые яйца, варить их необходимо 20 минут, в случае необходимости использования сырого яйца следует его тщательно помыть с мылом.
• Пейте только кипяченое молоко, а также в летний период избегайте употребления сыра и творога, приобретенного в сомнительных торговых точках.
• Избегайте общественного питания в сомнительных заведениях в летний период времени.

границ | Оптимизированный коктейль бактериофагов может эффективно контролировать сальмонеллу in vitro и Galleria mellonella

Введение

Небрюшнотифозный Salmonella spp. являются основной причиной острого гастроэнтерита у человека. Ежегодно инфекция Salmonella является причиной около 155 000 смертей и 93,8 млн случаев пищевых отравлений во всем мире, из которых 85% всех случаев связаны с пищевыми отравлениями (Majowicz et al., 2010; Eguale et al., 2015; Balasubramanian et al., 2019). Основным путем передачи инфекции человеку является потребление пищевых продуктов, зараженных Salmonella , особенно продуктов из птицы и свинины (Foley et al., 2008). Куры, индейки и свиньи могут заразиться Salmonella из зараженных кормов, окружающей среды или при контакте с другими инфицированными животными в загоне (Atterbury et al., 2007). После заражения животные могут оставаться бессимптомными или у них могут развиться симптомы кишечной инфекции.В любом случае их кишечник колонизируется Salmonella , и бактерия может распространяться между животными фекально-оральным путем (Bonardi, 2017; Martinez-Avilés et al., 2019). Помимо передачи, существует риск заражения Salmonella от одной туши к другой во время убоя и переработки мяса (Smith et al., 2018). Следовательно, каждый этап обработки от фермы до вилки представляет собой потенциальную точку риска заражения и заражения Salmonella (Акил и Ахмад, 2019).Таким образом, разрыв цикла инфекции в пищевой цепи до того, как продукты станут доступны для потребления, представляет собой желательный подход к профилактике и контролю этой инфекции у людей.

Серотипы Salmonella , обычно связанные с инфекциями домашней птицы и свиней, а также с фекально-оральным путем передачи от человека к человеку: S . Тифимуриум, S . 1,13,23:i:, S . Enteritidis, S . Инфантис, S . Огайо и S .Сефтенберг (Antunes et al., 2016; EFSA, 2018; Ferrari et al., 2019). Все большее число штаммов этих серотипов становится устойчивыми к антибиотикам первой линии, используемым для борьбы с Salmonella на фермах, в том числе к антибиотику последней инстанции колистину (Anjum et al., 2016). К сожалению, Европейское управление по безопасности пищевых продуктов (EFSA) сообщило, что 94,4% из 659 S . Штаммы Infantis, выделенные от бройлеров, были устойчивы к одному или нескольким антибиотикам и 64,2% 123 S .Штаммы Typhimurium, выделенные из туш свиней, обладали множественной лекарственной устойчивостью (MDR; EFSA, 2018). Как следствие этого, штаммы MDR попали в пищевую цепь человека, и поэтому необходимы альтернативные противомикробные препараты для лечения и контроля распространения штаммов MDR Salmonella как у животных, так и у людей.

Бактериофаги (фаги) — это естественные вирусы бактерий, и поэтому их можно разработать, чтобы предложить жизнеспособную альтернативу антибиотикам (Salmond and Fineran, 2015; Czaplewski et al., 2016). Исследования показали, что фаги способны лизировать штаммы MDR Salmonella (Jung et al., 2017; Thanki et al., 2019; Li et al., 2020) и, следовательно, могут быть инструментом для ограничения распространения этих штаммов. в пищевой цепи. Из-за этой возросшей потребности в новых противомикробных препаратах исследования терапевтического использования литических фагов, известные как «фаговая терапия», растут в геометрической прогрессии (Nobrega et al., 2015). Для наиболее эффективного использования в терапии фаги можно комбинировать в виде «коктейлей» для расширения круга хозяев, повышения эффективности уничтожения или ограничения развития резистентности к фагам (Chan et al., 2013). Многие фаговые коктейли были разработаны против Salmonella , и их эффективность была проверена в исследованиях заражения свиней и домашней птицы (Zhang et al., 2015; Martinez et al., 2019). Их использовали в различных точках вмешательства, и предубойное исследование показало, что введение четырехфагового коктейля в корм (∼10 7 БОЕ/г) способно снизить колонизацию Salmonella в слепой кишке цыплят на 1 log 10 КОЕ/г в течение 14 дней (Sklar and Joerger, 2001).Точно так же коктейль из шестнадцати фагов (5 × 10 9 БОЕ), вводимый одновременно с S . Typhimurium (5 × 10 9 КОЕ) снижал колонизацию Salmonella на 2–3 log 10 КОЕ/г в слепой кишке, подвздошной кишке и миндалинах поросят-отъемышей (Wall et al., 2010). В другом исследовании коктейль из пяти фагов, введенный после убоя, эффективно снижал S. Enteritidis на коже цыплят на 1,0 log КОЕ/см 2 при введении при несколько высокой множественности заражения (MOI) 10 000 (Hungaro et al., 2013). И, наконец, весьма обнадеживающее, аналогичное исследование показало применение четырехфагового коктейля при MOI 10 и 100 на коже свиньи, зараженной S . Typhimurium снижал количество бактерий до уровня ниже уровня обнаружения через 96 часов (Hooton et al., 2011).

Хотя исследования подчеркивают использование фаговых коктейлей для снижения численности Salmonella как до, так и после убоя, на рынке доступно мало фаговых продуктов для борьбы с инфекцией у домашней птицы и свиней (Żbikowska et al., 2020). Чтобы продукт был эффективным в этих условиях, он должен обладать оптимальной активностью в отношении широкого круга хозяев, чтобы эффективно уничтожать различные серотипы Salmonella у животных. Поэтому, чтобы восполнить недостаток информации о борьбе с инфекцией Salmonella , здесь был разработан новый коктейль из трех фагов для выполнения первых шагов, необходимых для окончательного использования фагов в качестве лечебной кормовой добавки. Коктейль содержит два миовируса широкого круга хозяев и сифовирус, каждый из которых нацелен на распространенные изоляты домашней птицы и свиней.Ясно, что активность фагов in vitro может различаться in vivo , и поэтому необходимы дальнейшие испытания на животных. Тестирование на домашнем скоте дорого и требует много времени, поэтому, чтобы обойти эти трудности и уменьшить объем работы, необходимой для домашнего скота, фаговый коктейль был тщательно протестирован на модели инфекции Galleria mellonella личинка Salmonella . Предыдущие данные из нашей и других лабораторий показали, что модель Galleria полезна и что она коррелирует с крупномасштабными моделями животных.В более широком смысле модель G. mellonella дешева и является ценным биологическим инструментом для изучения вирулентности и патогенности патогенов, включая Salmonella , и фармакокинетики противоинфекционных препаратов, включая фаговую терапию (Thomas et al., 2013; Nale et al. др., 2016а, 2020). В этом исследовании личинок G. mellonella были колонизированы репрезентативными изолятами, и были получены и представлены подробные доказательства эффективности различных схем фаготерапии для предотвращения и уменьшения колонизации в модели.

Материалы и методы

Бактериальные штаммы и сопоставление, выделение и размножение фагов

Всего в этом исследовании было исследовано 35 штаммов Salmonella . Он состоял из двадцати трех домашних птиц и десяти свиных штаммов Salmonella , которые были выделены и любезно предоставлены Агентством по охране здоровья животных и растений (APHA) Вейбриджа, Соединенное Королевство (дополнительные таблицы S1, S2). Хозяин, размножающийся фагом, Salmonella enterica , серовар Typhimurium SL1344 (инвентарный номер FQ312003), был получен от Dr.Primrose Freestone в Лестерском университете и ранее была охарактеризована в нашей лаборатории и в других местах (Viegas et al., 2013; Thanki et al., 2019). S. enterica , серовар Typhimurium T4, является обычным лабораторным штаммом и использовался в качестве эталонного штамма для разработки фагового коктейля и тестирования in vivo . Бактерии обычно выращивали на агаре с ксилозо-лизин-дезоксихолатом (XLD) (Oxoid, Великобритания) в течение 18 ч при 37°C, а затем культивировали в бульоне Луриа-Бертани (LB) (Oxoid, Великобритания) в течение 18 ч при 37°C при 100 об/мин.

Здесь были испытаны двадцать два фага Salmonella . Двадцать были ранее выделены и охарактеризованы в нашей лаборатории, а двое также были ранее выделены и охарактеризованы в Таиланде (thanki et al., 2019; Phothaworn et al., 2020). Все бактериальные и фаговые штаммы длительное время сохранялись в криогенных флаконах Viabank (Abtek Biologicals Ltd., Великобритания) при -80°C.

Размножение фага

Для размножения фагов отдельные фаги добавляли к отдельным экспоненциально растущим жидким культурам SL1344 при OD 600 ∼0.2 (10 8 КОЕ/мл) в бульоне LB при MOI 0,1 и далее инкубировали при 37°C при встряхивании при 100 об/мин в течение 6 часов. Культуры лизированных бактериальных клеток центрифугировали при 5000 g в течение 15 мин, супернатанты фильтровали через фильтры с размером пор 0,2 мкм (Merch Millipore Ltd. Cork, Ирландия) и временно хранили при 4°С. Титры фагов определяли методом двойного агара с верхним бактериальным газоном, приготовленным в 4 мл 0,7% LB-агара, и 150 мкл ночных культур (полученных путем инокуляции одной колонии бактериальных культур в 5 мл LB-бульона и инкубации при 37°C в течение 18–24 ч) на 90-мм чашках с 1% LB-агаром (Kropinski et al., 2009) и выражали в БОЕ/мл. Равные объемы фаговых лизатов с одинаковыми титрами смешивали для получения коктейля.

Диапазон хозяев фага и анализ вирулентности на изолятах цыплят и свиней

Диапазон хозяев каждого фага определяли путем добавления 10 мкл 10 8 БОЕ/мл объемов лизатов к конфлюэнтно выращенным бактериальным штаммам, приготовленным, как указано выше, и инкубированным в аэробных условиях в течение 18 часов при 37°C. Планшеты исследовали на бактериальный лизис в трех биологических и технических повторностях.

Пять устойчивых клонов, полученных от каждой отдельной фаговой инфекции, были отобраны и очищены путем пятикратного субкультивирования на свежей среде XLD. Каждый очищенный клон считался устойчивым, если он больше не был восприимчив к заражению 10 8 БОЕ/мл фага дикого типа в анализе точечного тестирования диапазона хозяев, как описано выше. Конфлюэнтно выращенные устойчивые клоны готовили, как указано выше, и на них наносили 10 мкл фагов дикого типа. Зоны лизиса наблюдали после инкубации в аэробных условиях в течение 24 ч при 37°С.

Вирулентность фага определяли с помощью анализа уничтожения на культурах SL1344. Для этого трижды по 180 мкл каждой бактериальной культуры получали путем разведения 1:10 ночных культур в стерильном бульоне LB и инкубировали в аэробных условиях при встряхивании при 100 об/мин в 96-луночном планшете в устройстве для считывания планшетов SPECTROstar Omega (BMG LABTECH, Ltd, Великобритания) настроен на снятие показаний с 5-минутными интервалами. При достижении ОП 600 ∼0,2 культуры обрабатывали 20 мкл 10 9 БОЕ/мл отдельного фага или различных комбинаций фагов (общая МВД ∼10).Эффективность фагов для элиминации бактериальных культур устанавливали, наблюдая за самым низким снижением роста, вызванным обработкой фагом или комбинацией фагов. Низкие показания OD 600 свидетельствуют об эффективном уничтожении фагов, и это послужило основой для разработки соответствующего коктейля для последующей вирулентности, а также для анализов in vivo .

Оптимизация

Salmonella Инфекция в Galleria mellonella Модель

Разработанная оптимальная комбинация фагов была протестирована in vivo с использованием G.mellonella личинки Salmonella модель инфекции. Личинки были получены, очищены и подготовлены, как описано ранее (Nale et al., 2016a). Для колонизации личинок бактериальным инокулятом культуры штаммов MSG44-S01 (свиньи), SL1344 (куры) и T4 (лабораторные) готовили в фосфатно-солевом буфере (PBS). Для этого готовили разведение 1:10 ночной культуры каждого штамма в стерильном LB-бульоне и инкубировали в аэробных условиях при 37°C до достижения OD 600 0,2.Культуры промывали три раза в PBS путем центрифугирования при 15000 g в течение 5 минут, и каждый раз полученные осадки повторно суспендировали в PBS. Конечный осадок ресуспендировали в PBS и разбавляли для получения различных титров бактерий и использовали для колонизации личинок G. mellonella через пероральный желудочный зонд объемом 10 мкл на личинку с использованием насосов Hamilton, как описано ранее (Nale et al., 2016a).

Для определения средней летальной дозы LD 50 для каждого штамма в модели личинки однократная доза 10 5 , 10 4 , 10 3 или 10 2 КОЕ (в 10 мкл объема) каждого бактериального инокулята вводили дублирующимся группам из четырех личинок на группу для каждой бактериальной дозы.Зараженных личинок инкубировали при 37°С в течение 24 часов. Влияние бактериальной колонизации на выживаемость личинок определяли путем подсчета живых/мертвых, а LD 50 определяли по концентрации инокулята Salmonella , необходимой для уничтожения приблизительно половины популяции личинок в каждой группе в течение 24 часов. Рамка. Личинки считались погибшими, когда они становились инертными и приобретали черный цвет (Ramarao et al., 2012; Viegas et al., 2013; Nale et al., 2016a). Эта доза была выбрана для инициации колонизации для каждого бактериального штамма в исследованиях фаговой терапии in vivo .

Для дальнейшей оптимизации модели заражения было важно убедиться, что фаги стабильны в гемолимфе личинок, чтобы гарантировать терапевтическую эффективность. Таким образом, стабильность и выживаемость фагов в модели заражения определяли для предложенного максимального времени эксперимента 72 часа. Это время было выбрано, поскольку личинки будут выживать только в течение этого времени при указанной температуре, как сообщалось ранее (Nale et al., 2016b). Выживание фага в модели было достигнуто путем обработки каждой личинки ∼10 7 БОЕ суспензии фагового коктейля в объеме 10 мкл с использованием четырех личинок в моменты времени 0, 24, 48 и 72 ч.Обработанных насекомых инкубировали, как описано выше. Выживаемость личинок и количество фагов в гемолимфе каждой личинки и из объединенных фекалий личинок в каждый момент времени определяли с использованием среды, описанной выше, и ранее описанных методов (Nale et al., 2016a).

Схемы фаготерапии в модели инфекции

G. mellonella Salmonella

Три схемы фаготерапии (профилактическая, лечебная и фагово-бактериальная коинфекция), а также группы контроля бактерий и фагов были созданы для экспериментальных временных точек 0, 2, 24, 48 и 72 ч для каждого бактериального штамма с использованием четырех личинки/схема лечения/момент времени (таблица 1).Чтобы инициировать колонизацию, личинок обрабатывали дозой 10 мкл бактериального инокулята, используемой для установления LD 50 для каждого бактериального штамма в разделе «Оптимизация инфекции Salmonella в модели Galleria mellonella » (10 5 КОЕ для SL1344, 10 2 КОЕ для MSG44-S01 и 10 3 КОЕ для T4) через пероральный желудочный зонд. Были проведены три схемы фаговой терапии с использованием разовой дозы 10 мкл коктейля (при соотношении бактерий к фагам 1:10), как описано ранее для Clostridium difficile , в моменты времени, указанные в таблице 1 (Nale et al., 2016а). Вкратце, в бактериальной контрольной группе (экспериментальная группа 1) личинок обрабатывали соответствующей дозой для каждого бактериального штамма в момент времени 0 ч, а через 2 ч обрабатывали стерильным бульоном LB. Для режима коинфекции фаг/бактерии (экспериментальная группа 2) личинок обрабатывали комбинацией фагового коктейля и бактерий в 0 ч, а затем LB в 2 ч временной точки. Личинки в лечебном режиме (экспериментальная группа лечения 3) обрабатывали бактериями в 0 часов, а затем обрабатывали фагом в 2-часовой момент времени.Для профилактического режима (экспериментальная обработка 4) личинок сначала обрабатывали фаговым коктейлем, а через 2 часа вводили бактериальную дозу. Последний режим — контрольная группа с фагом (экспериментальная группа 5), здесь личинок обрабатывали фаговым коктейлем в 0 ч, а через 2 ч — бульоном LB (таблица 1). После обработки личинок инкубировали при 37°C и не кормили на протяжении всего эксперимента (Ramarao et al., 2012; Nale et al., 2016a). В каждый момент времени личинки оценивали на выживаемость с последующим вскрытием, и как бактерии, так и фаги выделяли из гемолимф на среде XLD с использованием ранее описанных методов (Nale et al., 2016а; Спасибо и др., 2019).

Таблица 1. Динамика схем лечения фагами G. mellonella , использованных в этом исследовании.

Выживаемость личинок и данные по колонизации КОЕ и БОЕ анализировали с использованием R и GraphPad Prism версии 8 (GraphPad Software Inc, США). Чтобы проверить эффективность схем лечения фагами, данные о выживаемости анализировали с использованием логарифмического рангового теста (Мантела-Кокса). Данные КОЕ подвергали тесту нормальности Шапиро-Уилка, и каждую обработку фагом сравнивали с бактериальным контролем с использованием теста Манна-Уитни.Значение было обозначено звездочками, * P <0,05, ** p <0,01, *** p <0,001 и **** p = 0,0001.

Результаты

Свойства диапазона хозяев исследованных фагов на распространенных штаммах

Salmonella , выделенных от кур и свиней

Диапазон хозяина фагов был оценен, чтобы убедиться, что они обеспечивают подходящее покрытие против группы соответствующих штаммов и для предлагаемого использования в сельскохозяйственных условиях.Таким образом, они были впервые использованы для заражения распространенных штаммов, из которых 10 обычно встречаются у свиней и 23 у домашней птицы. Диапазон хозяев был оценен in vitro с использованием «точечного теста» диапазона хозяев для всех штаммов и анализов уничтожения фагов при множественности инфекций 10 на репрезентативных изолятах, как описано ранее (Hooton et al., 2011). Штаммы на панели представляют пять основных серотипов, связанных с свиньями и птицами Соединенного Королевства (дополнительные таблицы S1, S2).

Среди исследованных изолятов домашней птицы штаммы 4–8, 14 и 19–23 были одинаково чувствительны ко всем исследованным фагам, поскольку штаммы либо полностью лизировались (бактериальные штаммы 5, 7, 8 и 14), либо лизировались с некоторой устойчивостью на зоны клиренса (штаммы 4, 6, 19–23).Хотя другие бактериальные штаммы 1–3, 9–13 и 16–18 проявляли различную чувствительность к фагам, все вместе штаммы лизировались по крайней мере одним фагом в коллекции (табл. 2). Среди исследованных свиных изолятов штаммы MSG32-S01, MSG52-S01, MSG29-S01 и MSG41-S01 показали наименьшую восприимчивость к заражению фагами, поскольку эти штаммы были наиболее устойчивыми или демонстрировали частичный или мутный лизис фагами (таблица 3). ). С другой стороны, MSG46-S01, MSG57-S01, MSG44-S01, MSG44-S02 и MSG43-S01 показали наибольшую чувствительность к фагам, при этом большинство штаммов демонстрировали либо полный лизис, либо лизис, при этом некоторые резистентные колонии наблюдались в зонах очистки. как показано в таблице 3.

Таблица 2. Активность 22 фагов в диапазоне хозяев против 23 распространенных изолятов домашней птицы, изученных в этом исследовании.

Таблица 3. Активность в диапазоне хозяев 22 фагов на 10 распространенных свиных изолятах, изученных в этом исследовании.

Из протестированных фагов STW-77 и SEW-109 продемонстрировали наибольшую эффективность в отношении лизиса как свиных, так и куриных изолятов (включая мутный лизис, лизис с устойчивостью и полный лизис) 85% (28 из 33) протестированных штаммов, которые включает несколько серотипов.Остальные фаги показали аналогичную литическую активность в отношении большинства штаммов, охватывающих от 60 до 70% протестированных штаммов (таблицы 2, 3).

Активность фагов в отношении роста

Salmonella in vitro

Для разработки максимально эффективного фагового коктейля мы исследовали и отобрали фаги с наивысшей активностью в диапазоне хозяев. Таким образом, фаги ST-W77 и SE-W109 были выбраны из-за их активности в широком диапазоне хозяев на исследованных изолятах свиней и кур (таблицы 2, 3).Фаг SPFM17 также был включен, так как это был фаг с самым широким охватом изолятов кур, который также может лизировать MSG46-S01 и MSG32-S01, которые были изолятами свиней с наименьшей восприимчивостью к другим фагам. Таким образом, фаг SPFM17 в сочетании с фагами ST-W77 и SE-W109 может лизировать более 90% бактериальных штаммов из тестируемых изолятов свиней и домашней птицы (таблица 3).

Чтобы изучить эффекты комплементации выбранных фагов, все оптимизации разработки коктейлей с использованием трех фагов были проведены на хозяине, размножающем фаг, SL1344, который также является куриным изолятом.Когда отдельные фаги были добавлены к растущей культуре при ОП 600 0,2 (через 100 мин, указано зеленой стрелкой), рост бактерии уменьшился через 100 мин после добавления фага для всех отдельных фагов, и это снижение сохранялось. в течение дополнительных 150 мин (для фага ST-W77) и 80 мин (для фагов SE-W109 и SPFM17) после воздействия фага (рис. 1А). Однако через ~200 мин (для SPFM17), 500 мин (для ST-W77) и 600 мин (для SE-W109) после обработки фагом наблюдался повторный рост бактерий (рис. 1А).Затем отдельные фаговые лизаты объединяли в равных пропорциях, чтобы сформировать коктейль с таким же общим MOI, как и при использовании фагов по отдельности, и это использовали для заражения культуры SL1344 при OD 600 0,2 при том же времени выращивания 100 мин. Рост бактерий продолжался в течение дополнительных 300 минут, но затем снизился до ОП 600 0,1 через 550 минут после обработки фагом (для SL1344), и этот уровень оставался постоянным до конца эксперимента (рис. 1В).Резистентные штаммы (пять клонов для каждой обработки фагом) выделяли и заражали другими фагами в смеси. Было замечено, что устойчивые к фагам штаммы, продуцируемые одним фагом, лизировались одним или двумя другими фагами-кандидатами для разработки коктейля (дополнительная таблица S3).

Рисунок 1. Лизисная активность фагов-кандидатов, использованных для разработки коктейля, на рост бактерий репрезентативных штаммов свиней, домашней птицы и лабораторных штаммов, исследованных в этом исследовании. Анализ вирулентности проводили в объеме 200 мкл в планшет-ридере SPECTROstar Omega, содержащем фаг/бактерии при множественности заражения 10. (A) показывают индивидуальное уничтожение фагов на SL1344 и (B) воздействие трехфагового коктейля на культурах кур SL1344 (черная линия), свиней MGG44-S01 (красная линия) и лабораторных эталонных штаммах T4 (синяя линия) ). Зеленые стрелки представляют точки, когда были добавлены фаги. Данные были проанализированы с помощью GraphPad Prism 8.

Установив влияние индивидуума и трехфагового коктейля на культуры размножающегося хозяина, SL1344, мы затем протестировали активность коктейля на свином изоляте MSG44-S01, который полностью чувствителен к трем фагам, и лабораторный штамм T4, который обычно используется в большинстве наших работ Salmonella .Фаговый коктейль полностью устранил два дополнительных бактериальных штамма за пределом обнаружения примерно через 700 минут после воздействия фагового коктейля. Это наблюдение оставалось неизменным до конца экспериментального времени, и повторного роста не наблюдалось (рис. 1В).

Стабильность

фагов Salmonella в G. mellonella и установление инфекционных доз изученных изолятов свиней, кур и лабораторных эталонных изолятов

Установив эффективность коктейля in vitro на репрезентативных цыплятах, свиньях и лабораторных тестовых штаммах, мы затем проверили лизисную активность in vivo с использованием G.личинки меллонеллы . Стабильность фагов в модели была установлена ​​путем установления их стабильности и возможности восстановления в кишечнике и фекалиях личинок (Nale et al., 2016a). Наши данные показали, что не было значительной потери титра фага в кишечнике личинок в течение 72-часового экспериментального периода. Точно так же фаги выделялись с фекалиями, хотя через 24 часа после воздействия наблюдалось снижение примерно на 4 log10 БОЕ/личинка, но этот уровень оставался постоянным в течение последующих 48 и 72 временных точек (дополнительная фигура S1A).Поскольку бактериальные культуры были суспендированы в PBS перед колонизацией личинки, мы подтвердили, что фаги также были стабильны в этом буфере, а также не наблюдалось значительной потери титра после ресуспендирования фагов в буфере в течение часа (дополнительная фигура S1B). В дополнение к определению стабильности фага в личинках и PBS во время оптимизации модели in vivo , мы дополнительно определили отдельные штаммы LD 50 в течение 24 часов, чтобы определить количество бактерий, необходимое для колонизации и смерти через ∼50 часов. % личиночной популяции в этот период времени.Это важно для того, чтобы можно было протестировать различные терапевтические схемы в течение 72 часов (Nale et al., 2016a). Было замечено, что значения LD 50 были вариабельными для трех протестированных штаммов, при этом наименьшее значение составляло 10 2 КОЕ/личинка для свиного штамма MSG44-S01, который является свиным изолятом. Однако для T4 и SL1344 требовалось 10 3 и 10 5 /личинка, соответственно, для проявления относительного эффекта LD 50 , как в MSG44-S01.

Влияние обработки фагом на

G.mellonella Зараженные различными Salmonella Изоляты

После полной разработки фагового коктейля in vitro и оптимизации модели инфекции G. mellonella Salmonella эффективность фагового коктейля была затем протестирована на личинках, колонизированных куриным SL1344, свиным MSG44-S01 и лабораторным представителем T4 Salmonella штаммов. Колонизацию устанавливали с использованием однократной дозы оптимизированной бактериальной культуры с последующим применением различных терапевтических фаговых режимов, чтобы определить, какое лечение уменьшит колонизацию Salmonella и в наибольшей степени повысит выживаемость личинок.

Эффективность обработки фагом
G. mellonella , инфицированных куриным изолятом, SL1344

Для куриного штамма SL1344 группа личинок, обработанная профилактически, выживала в течение всего времени эксперимента, что значимо по сравнению с контрольной группой бактерий ( p <0,0001). Хотя группа личинок, обработанных совместной культурой фага и бактерий, выживала до 36 ч, 10% инфицированных и обработанных личинок погибло к 48 ч, а остальные личинки дожили до конца эксперимента.Режим коинфекции не так эффективен, как профилактика ( p < 0,001). Лечебная группа с наименьшей выживаемостью была представлена ​​​​лечебной группой, где ~ 95% выжили в течение первых 24 часов, и это существенно не отличается от контрольных бактериальных групп. Непрерывное снижение наблюдалось в течение временных точек, с выживаемостью 86, 60 и 10% через 36, 48 и 72 часа соответственно. Группа бактериального контроля, обработанная культурами SL1344 и без фага, также показала постепенное снижение выживаемости с 86% через 24 часа до гибели всех личинок через 72 часа (рис. 2А).

Рисунок 2. Влияние фаготерапии на G. mellonella , колонизированных куриным изолятом SL1344. Личинок колонизировали 10 5 КОЕ в 10 мкл через пероральный желудочный зонд. Схемы фаготерапии проводились с использованием 10 6 БОЕ/личинка. (A) показывают выживаемость, (B) колонизация Salmonella и (C) восстановление фага в различные моменты времени для каждого лечения — контрольные бактерии (черный), коинфекция (зеленый), лечебный ( Красный), профилактический (синий) и контрольный фаг (фиолетовый) и профилактический (синий) линии/столбцы.Четыре личинки были использованы для лечения и временной точки. Эксперимент был повторен трижды и проанализирован с использованием критерия нормальности Шапиро-Уилка для R. Каждый режим обработки фагом был протестирован в отношении контроля SL1344 с использованием критерия Манна-Уитни на GraphPad Prism 8. ns = нет значимости, * значимость при p <0,05.

Что касается колонизации SL1344 внутри насекомых, мы наблюдали полную эрадикацию бактерий в течение 24 и 72 часов после обработки при профилактической обработке и совместном культивировании фаговых бактерий соответственно.Колонизация в лечебном режиме постепенно снижалась с ~10 4 КОЕ/личинка до неопределяемого уровня на 24-й час, однако повторный рост бактерий наблюдался через 36 часов, когда наблюдалось от 10 4 КОЕ/личинка до 10 7 КОЕ/личинка в 48 и 72 ч раз (рис. 2B). По сравнению с бактериальной контрольной группой профилактический режим был более эффективным в снижении колонизации этого штамма ( p <0,05), но существенной разницы не наблюдалось при совместном культивировании и лечебных режимах.

Что касается подсчета фагов, контрольная и профилактическая группы фагов демонстрировали стабильный уровень до 48 часов, после чего наблюдалось снижение количества фагов на 2 log БОЕ/личинка в контрольной группе фагов и на 3 log БОЕ/личинка в профилактической группе через 72 часа. время. Группа совместного культивирования бактериальных фагов показала устойчивое увеличение фага до ~10 5 БОЕ/личинка через 72 часа. В лечебном режиме 10 5 БОЕ/личинка фагов были восстановлены через 2 часа, но позже количество фагов снизилось до 10 3 БОЕ/личинка с 36-го часа до конца экспериментального времени 72 ч (рис. 2C). .

Влияние обработки фагом на
G. mellonella , инфицированных изолированными свиньями, MSG44-S01

Для штамма свиней MSG44-S01 личинки в группах контроля фагов, профилактических препаратов и совместного культивирования выжили на протяжении всего эксперимента, и оба режима являются значимыми по сравнению с контрольными группами бактерий ( p < 0,05). При лечебном режиме и бактериальном контроле в обеих группах наблюдали только 13% летальных исходов на 48-м часу, что не является значимым по сравнению с группами бактериального контроля.Хотя этот уровень оставался стабильным до 72-часового момента времени для лечебного режима, в это время в группе бактериального контроля личинок наблюдалось только 20% выживания личинок (рис. 3А).

Рисунок 3. Влияние фаготерапии на G. mellonella , колонизированных свиным изолятом MSG44-S01. Личинок колонизировали 10 2 КОЕ в 10 мкл через пероральный желудочный зонд. Схемы фаготерапии проводились с использованием 10 3 БОЕ/личинка. (A) показывают выживаемость, (B) колонизация Salmonella и (C) восстановление фага в различные моменты времени для каждого лечения — контрольные бактерии (черный), коинфекция (зеленый), лечебный ( Красный), профилактический (синий) и контрольный фаг (фиолетовый) и профилактический (синий) линии/столбцы.Четыре личинки были использованы для лечения и временной точки. Эксперимент был повторен трижды и проанализирован с использованием критерия нормальности Шапиро-Уилка для R. Каждая схема обработки фагом была протестирована в отношении контроля MSG44-S01 с использованием критерия Манна-Уитни на GraphPad Prism 8. ns = не имеет значения, ** значимость при p < 0,01 .

При использовании свиного бактериального штамма колонизация в контрольной бактериальной группе увеличилась с 10 2 КОЕ/личинка в начале анализа in vivo до 10 5 КОЕ/личинка в конце экспериментальной 72-часовой временной точки. .Сравнивая колонизацию личинок в рамках терапевтических режимов, было замечено, что профилактическая обработка насекомого фаговым коктейлем за 2 часа до контакта с бактериями приводила к полному предотвращению колонизации по оценке через 24 часа. Точно так же введение смеси фагов и бактерий приводило к эрадикации бактерий через 36 часов, когда бактерии не обнаруживались в личинках. В соответствии с данными о выживаемости, режимы как профилактики, так и совместного культивирования значительно уничтожали бактерии из личинок по сравнению с бактериальным контролем ( p < 0.01). В отличие от других видов лечения лечебный режим был не очень эффективен для эрадикации этого штамма из личинок, поскольку у некоторых личинок в этой группе наблюдались различные уровни колонизации в диапазоне от неопределяемого уровня до 10 5 КОЕ/личинки (рис. 3Б). Эта обработка не была значимой по сравнению с контрольной группой бактерий для этого штамма.

Уровень фага оставался относительно постоянным, как это наблюдалось для штамма SL1344, хотя 2 log БОЕ/личинка терялись на 72-й час в контрольной группе фага, и эта картина аналогична в профилактической группе для этого штамма.Выделение фага в группе с коинфекцией фагом/бактерией увеличилось до 10 4 БОЕ/личинка на 36-м часу, но уменьшилось с 48-го по 72-й час времени с выделением 10 3 БОЕ/личинка. В лечебном режиме с этим штаммом было извлечено меньше фагов, а титр снизился с 10 3 БОЕ/личинка до 10 2 БОЕ/личинка, но увеличился до 10 3 БОЕ/личинка на 36-м часу, но позже упал до 10 2 БОЕ/личинки, однако в других личинках фаги не были обнаружены в этом режиме (рис. 3С).

Влияние обработки фагом на
G. mellonella , инфицированных лабораторным штаммом, T4

Колонизация личинок нашим эталонным лабораторным штаммом T4 и обработка оптимизированным фаговым коктейлем показали 100% выживаемость среди групп личинок, обработанных фагом и профилактикой, что является значительным по сравнению с бактериальной контрольной группой ( p <0,0001; рисунок 4A). Эффективность этого режима в отношении этого штамма согласуется с наблюдениями за этим режимом лечения как для куриных, так и для свиных изолятов, показанных на рисунках 2А и 3А соответственно.При коинфекции 83% личинок выжили через 36 ч, но выживаемость лабораторного эталонного штамма через 48 ч снизилась до 72%, и этот уровень оставался постоянным до конца эксперимента (72 ч). Это важно по сравнению с бактериальным контролем ( p < 0,01), но не так эффективно, как режим профилактики, показанный выше. Лечебный режим показал самую низкую выживаемость с 85% выживаемостью через 24 часа, но она снизилась до 73% через 36 и 48 часов и, наконец, до 36% через 72 часа.Хотя лечебный режим является наименее эффективным для этого штамма, он все же значим по сравнению с бактериальной контрольной группой ( p < 0,05). Бактериальный контроль показал постепенное снижение выживаемости с 87% выживаемости через 24 часа до полной гибели личинок через 72 часа (рис. 4А).

Рисунок 4. Влияние фаготерапии на G. mellonella , колонизированных лабораторным изолятом T4. Личинок колонизировали 10 3 КОЕ в 10 мкл через пероральный желудочный зонд.Схемы фаготерапии проводили с использованием 10 4 БОЕ/личинка. (A) показывают выживаемость, (B) колонизация Salmonella и (C) восстановление фага в различные моменты времени для каждого лечения — контрольные бактерии (черный), коинфекция (зеленый), лечебный ( Красный), профилактический (синий) и контрольный фаг (фиолетовый) и профилактический (синий) линии/столбцы. Четыре личинки были использованы для лечения и временной точки. Эксперимент повторяли трижды и анализировали с помощью критерия нормальности Шапиро-Уилка по Р.Каждая схема обработки фагом была протестирована в сравнении с контролем T4 с использованием критерия Манна-Уитни на GraphPad Prism 8. ns = нет значимости, ** значимость при p <0,01.

Данные по колонизации показали, что штамм T4 также колонизировал личинок с количеством примерно от 10 3 КОЕ/личинка в начале эксперимента до 10 7 КОЕ/личинка в конце 72-часового периода времени. Как и в случае двух других бактериальных штаммов, через 2 часа бактерии были полностью уничтожены и не обнаруживались в личинках при профилактическом режиме.Схемы коинфекции и лечения показали сходные уровни колонизации с начальным количеством бактерий от 10 3–4 КОЕ/личинка до различных уровней в последующие моменты времени от неопределяемого уровня у некоторых насекомых до 10 6 КОЕ/личинка у некоторых в конце эксперимента. Все отдельные схемы фаговой терапии значительно элиминировали штамм Т4 по сравнению с контролем ( p <0,01; рис. 4В).

Результаты подсчета фагов показали более высокие числа БОЕ у личинок в группе лечебного лечения по сравнению с личинками в двух других схемах лечения фагами.Во всех группах обработки фагами количество фагов в личинках колебалось от 10 4–5 БОЕ/мл начального уровня фага до 10 6 БОЕ/мл у некоторых насекомых в конце экспериментального времени (рис. 4С).

Обсуждение

Инфекция Salmonella , возникающая в результате употребления в пищу зараженных пищевых продуктов, остается серьезной проблемой для здоровья человека, при этом больший процент случаев приводит к кишечному гастроэнтериту от легкой до тяжелой степени и к летальному исходу в других случаях (Sockett and Roberts, 1991; Majowicz et al., 2010). В результате вводится ряд торговых ограничений в случаях контаминации преобладающими серотипами S. Enteritidis и S. Typhimurium, что приводит к значительной потере доходов фермерами и производителями из-за отказа от некачественной зараженной продукции животноводства. (Majowicz et al., 2010; Kirk et al., 2015; Группа экспертов EFSA по биологическим опасностям и др., 2019). Хотя антибиотики полезны для борьбы с инфекцией как у людей, так и у животных, многие бактериальные штаммы становятся устойчивыми к рутинно используемым антибиотикам, что приводит к неэффективности лечения и вспышкам заболеваний (O’Neil, 2014; Fong et al., 2020). Поскольку идентификация и разработка новых антибиотиков происходит медленно и сложно, связанные с этим экономические и социальные потери подчеркивают настоятельную необходимость разработки альтернативных более эффективных терапевтических средств для лечения этой инфекции (O’Neil, 2014; Romero-Calle et al., 2019). Здесь представлены данные в поддержку жизнеспособного альтернативного способа борьбы с инфекциями у людей. Это исследование посвящено разработке высокоэффективного фагового коктейля Salmonella in vitro и демонстрации его эффективности в G.модель инфекции mellonella Salmonella с использованием различных режимов. Представленные здесь данные помогут в применении оптимизированного фагового коктейля для эффективного предотвращения или уменьшения бактериальной колонизации животных, тем самым разорвав цикл инфекции и выпустив на рынок более безопасные продукты животного происхождения, как показано ранее (Wall et al., 2010; Nabil et al., 2010). др., 2018).

Выбор подхода фаготерапии для контроля Колонизация Salmonella у животных, предложенная в этом исследовании, имеет большие неотъемлемые преимущества по сравнению с обычным использованием антибиотиков.Микробы легко размножаются там, где присутствуют благоприятные pH, температура, влажность и питательные вещества. Однако, поскольку в условиях окружающей среды или при более высоких температурах эффективность антибиотиков со временем снижается, необходимо многократное применение для поддержания эффективной дозы для контроля растущей популяции бактерий (Mackowiak et al., 1982; Paterson et al., 2016). Напротив, фаги являются биологическими объектами, и было показано, что они более стабильны при различных pH, биотических средах и окружающих условиях, чем антибиотики (Ahmadi et al., 2017; Соммер и др., 2019). Помимо стабильности, фаги реплицируются и производят все больше инфекционных частиц в присутствии целевого бактериального патогена, тем самым обеспечивая непрерывную дозировку (автодозирование) противоинфекционных препаратов в местах заражения (Jończyk et al., 2011; Loc-Carrillo and Abedon). , 2011). Кроме того, фаги могут избирательно удалять бактерии-мишени, но исключать другие микробные комменсалы в нише, оставляя их невредимыми, и это может особенно помочь здоровью кишечника животных, тем самым производя продукты животного происхождения более высокого качества (Moye et al., 2018; Дивья Ганешан и Хоссейнидуст, 2019 г.). Поскольку фаги обычно считаются безопасными, они являются отличными кандидатами для контроля колонизации Salmonella и развития биопленки в различных готовых к употреблению пищевых продуктах, молоке, свиньях и цыплятах для уменьшения колонизации Salmonella (Wall et al., 2010; Huang et al. и др., 2018; Набиль и др., 2018; Ислам и др., 2019).

Имея отношение к борьбе с инфекцией Salmonella у животных, большинство предыдущих исследований были сосредоточены на выделении фагов из окружающей среды, тестировании активности отдельных фагов и разработке различных комбинаций фаговых коктейлей с целью снижения численности бактерий in vitro и in vivo (Pereira et al., 2016; Ислам и др., 2019; Phothaworn и др., 2020). Однако проблема заключалась в трудностях выделения терапевтических фагов с приемлемыми геномными свойствами, охватом диапазона хозяев и преобразования наблюдаемой активности in vitro в применений in vivo у целевых животных (Nilsson, 2014; Hyman, 2019). Известно, что все исследованные здесь фаги являются облигатно литическими и не кодируют нежелательные гены, ожидаемые в терапевтическом фаговом продукте (thanki et al., 2019; Phothaworn et al., 2020). В дополнение к содержимому генома было показано, что фаги обладают активностью широкого круга хозяев в отношении различных родственных птице и свиньям серотипов Salmonella , поэтому они являются отличными кандидатами для терапевтических целей у животных (thanki et al., 2019; Phothaworn et al. ., 2020). Чтобы еще больше убедиться, что фаги могут воздействовать на нужные исследуемые здесь штаммы, их дополнительно заразили распространенными штаммами Salmonella серотипа , которые в настоящее время вызывают инфекцию у свиней и домашней птицы в Соединенном Королевстве, а также у людей во всем мире (Majowicz et al., 2010; Группа экспертов EFSA по биологическим опасностям и др., 2019 г.). Несмотря на разную эффективность лизиса штаммов, исследованных в этом исследовании, вместе фаги были способны лизировать по крайней мере один из бактериальных штаммов, включая монофазный штамм S. Typhimurium, связанный с микроэволюцией множественной лекарственной устойчивости и эпидемиологическим успехом ( Hugas and Beloeil, 2014; Petrovska et al., 2016; Branchu et al., 2019; Campos et al., 2019; Petsong et al., 2019; Tassinari et al., 2019). Эти наблюдения согласуются с другими предыдущими исследованиями, в которых сообщалось о фагах, нацеленных на штаммы MDR Salmonella (Atterbury et al., 2007; Хутон и др., 2011; Юнг и др., 2017).

Разработанный здесь коктейль из трех фагов, состоящий из двух миовирусов (SPFM17 и ST-W77) и сифовируса (SE-W109), указывает на то, что, имея различную морфологию, они могут нацеливаться на различные штаммы бактерий-хозяев, что приводит к коктейлю широкого спектра действия. В дополнение к этому, наши данные показали, что отдельные фаги в смеси имеют дополняющий вклад в целевое покрытие и вместе лизируют 100% протестированных изолятов свиней, 99,95% изолятов кур и вместе взятых ∼99.97% от общего числа исследованных штаммов серотипа. Это говорит о том, что фаги могут кодировать разные белки хвостовых отростков, что позволяет им нацеливаться на разные рецепторы разных бактерий-хозяев (Drulis-Kawa et al., 2012). Эта особенность может давать преимущества для их терапевтического использования в качестве коктейля, но требуется дальнейшая работа, чтобы определить это в геномах нашей смеси фагов. Оптимизация нашего коктейля с использованием различных морфологий фагов согласовывалась с другими выводами, однако в некоторых случаях для создания эффективного коктейля использовались единичные или неизвестные морфологии (Hooton et al., 2011; Коста и др., 2019 г.; Петсонг и др., 2019 г.; Стоун и др., 2019). Наблюдаемый охват коктейлем ряда хозяев, охватывающий различные изоляты свиней и птиц, был показан в других отчетах, и это еще раз подтверждает предполагаемое многоцелевое применение коктейля для лечения этих животных (Petsong et al., 2019). Таким образом, обладая как терапевтическими, так и экономическими преимуществами для использования в свиноводстве и птицеводстве.

Разработанный нами коктейль фагов имеет требуемый охват диапазона хозяев и четко продемонстрировал эффективность в отношении значительного уничтожения исследованных бактериальных культур по сравнению с обработкой отдельными фагами in vitro с использованием MOI 10 (Hooton et al., 2011). Для свиного и лабораторного эталонных штаммов фаговый коктейль полностью устранял бактериальные культуры ниже предела обнаружения, хотя наблюдалось снижение активности куриного изолята. Хотя в предыдущей работе на Salmonella сообщалось об усилении элиминации бактерий с использованием смеси, было показано, что другие смеси фагов не превосходят отдельные обработки фагами из-за постоянного развития резистентности после обработки смесью (Hooton et al., 2011; Costa et al. др., 2019). Наблюдаемый эффективный клиренс с помощью разработанного здесь оптимизированного коктейля был достигнут за счет эффекта комплементарности, при котором один штамм, устойчивый к фагам, лизируется другим фагом дикого типа в смеси. Эта активность согласуется с предыдущим отчетом о C. difficile , где резистентные/лизогенные штаммы, происходящие от одной фаговой инфекции, эффективно лизировались другим фагом в коктейле (Nale et al., 2016b). Хотя для Salmonella были разработаны различные фаговые коктейли, это первое сообщение о таком взаимодействии с этим видом.

Следующим шагом в нашем проекте было преобразование знаний, полученных об активности фага in vitro , в потенциальное применение in vivo и определение того, какой терапевтический режим лучше всего подходит для элиминации Salmonella в модели G. mellonella . Таким образом, для разработки модели инфекции Salmonella было важно начать с оптимизации LD 50 для каждого из наших тестовых бактериальных штаммов, чтобы обеспечить достаточную бактериальную нагрузку, чтобы вызвать относительно одинаковый эффект для тестируемых штаммов.Наше наблюдение показало, что более высокая бактериальная нагрузка 10 5 КОЕ/личинка куриного штамма SL1344 необходима для оказания сопоставимого эффекта LD 50 по сравнению с более низкими дозами 10 3 КОЕ/личинка и 10 2 КОЕ/личинка. личинка для свиней и лабораторный эталонный штамм. Наше наблюдение за куриным изолятом SL1344 согласуется с предыдущей работой по заражению Salmonella на G. mellonella , которая показала, что любая доза выше 10 5 КОЕ/личинка вызывает гибель всех личинок в течение 24 часов (Viegas et al., 2013). За исключением того, что в наших исследованиях мы наблюдали около 50% гибели личинок в течение этого периода времени, и это может быть связано с различиями в типе G. mellonella или методе введения. В нашем исследовании личинки были колонизированы через желудочный зонд, в то время как в предыдущей работе колонизация была достигнута путем инъекции ложноножек (Viegas et al., 2013).

При сравнении схем лечения стало ясно, что профилактика более эффективна для контроля колонизации всех протестированных штаммов Salmonella по сравнению с лечебной или коинфекцией фагом и бактериями.Это наблюдение согласуется с лечением фагом Salmonella в лабораторных условиях и исследованиями фаговой терапии, проведенными на личинках с использованием других патогенов, таких как C. difficile и Pseudomonas aeruginosa (Beeton et al., 2015; Ahmadi et al., 2016). ; Нале и др., 2016а). Это наблюдение с Salmonella можно объяснить тем фактом, что предварительная обработка личинок фагами в течение 2 часов давала достаточно времени для адаптации фага к среде кишечника личинки, как показано в анализе стабильности, и, следовательно, была способна для эффективного уничтожения бактерий при введении (Nale et al., 2016а). Другие схемы (лечебная и коинфекция) не давали такого же эффекта, как профилактика, и это может быть связано со способностью Salmonella проникать внутрь клеток, что может снижать эффективность фагов (Diacovich et al., 2017).

Заключение и будущая работа

Гастроэнтерит, вызванный Salmonella , представляет собой серьезную проблему для здоровья. Заражение происходит при употреблении зараженных продуктов животного происхождения. Антибиотики полезны, но бактерии становятся устойчивыми ко многим передовым антибиотикам, поэтому срочно необходим жизнеспособный альтернативный контроль, чтобы уменьшить потери для здоровья и экономики.Здесь мы сообщили о подходе к разработке эффективной терапии с использованием фагов для остановки инфекции у животных до того, как продукты будут обработаны для потребления. Для этого мы сначала оптимизировали фаговый коктейль широкого спектра хозяев, который эффективно очистил Salmonella in vitro и показал, что режим профилактического лечения является наиболее эффективным подходом к контролю инфекции G . Модель личинки mellonella . Представленные здесь данные предоставляют надежные данные до животноводства, подтверждающие использование этого коктейля для эффективного лечения инфекции у кур и свиней.В настоящее время продолжается работа по превращению фагов в рН- и термостабильные порошки, которые включаются в корма и используются для борьбы с инфекцией Salmonella у целевых животных.

Заявление о доступности данных

Оригинальные материалы, представленные в исследовании, включены в статью/дополнительный материал, дальнейшие запросы можно направлять соответствующему автору/авторам.

Вклад авторов

GV и JN провели анализы in vitro .JN и VL провели работу in vivo . AT и PP выделили фаги. МАО, МФА и АГ выделили изоляты курицы и свиньи. JN, GV, VL и AT составили рукопись. JN и GV проанализировали данные. JN, MC, EG, SK, DM, GV, MAO, MFA, AG и PT задумали и разработали эксперименты. Все авторы отредактировали и согласились нести ответственность за все аспекты рукописи и утвердили окончательную версию для публикации.

Финансирование

Эта работа финансировалась Исследовательским советом по биотехнологии и биологическим наукам (BBSRC), номер гранта RM38G0140, присужденный MC, и Национальным агентством по развитию науки и технологий (NSTDA), номер гранта P-18-50454, присужденный SK.

Конфликт интересов

Авторы заявляют, что исследование проводилось при отсутствии каких-либо коммерческих или финансовых отношений, которые могли бы быть истолкованы как потенциальный конфликт интересов.

Благодарности

Выражаем благодарность Агентству по охране здоровья животных и растений (APHA) Вейбридж, Великобритания, и доктору Фристоуну за предоставленный изолят курицы и свиньи, использованный в этом исследовании.

Дополнительный материал

Дополнительный материал к этой статье можно найти в Интернете по адресу: https://www.frontiersin.org/articles/10.3389/fmicb.2020.609955/full#supplementary-material

Ссылки

Ахмади, Х., Рэдфорд, Д., Кропински, А. М., Лим, Л. Т., и Баламуруган, С. (2017). Термическая стабильность и способность к восстановлению листериозных фагов Р100 и А511. Фронт. микробиол. 8:2375. doi: 10.3389/fmicb.2017.02375

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Ахмади М., Карими Торшизи М. А., Рахими С. и Деннехи Дж. Дж.(2016). Профилактическое введение бактериофага более эффективно, чем постинфекционное введение, в снижении выделения Salmonella enterica serovar enteritidis у перепелов. Фронт. микробиол. 7:1253. doi: 10.3389/fmicb.2016.01253

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Акил, Л., и Ахмад, Х.А. (2019). Модель количественной оценки риска сальмонеллеза человека в результате употребления в пищу цыплят-бройлеров. Болезни 7:19.doi: 10.3390/diseases7010019

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Анджум, М.Ф., Даггетт, Н.А., АбуОун, М., Рэндалл, Л., Нуньес-Гарсия, Дж., Эллис, Р.Дж., и соавт. (2016). Устойчивость к колистину в изолятах Salmonella и Escherichia coli со свинофермы в Великобритании. J. Антимикроб. Чемотер. 71, 2306–2313. doi: 10.1093/jac/dkw149

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Аттербери, Р.J., Van Bergen, M.A.P., Ortiz, F., Lovell, M.A., Harris, J.A., De Boer, A., et al. (2007). Бактериофаговая терапия для снижения колонизации сальмонеллой цыплят-бройлеров. Заяв. Окружающая среда. микробиол. 73, 4543–4549. doi: 10.1128/AEM.00049-07

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Balasubramanian, R., Im, J., Lee, J.S., Jeon, H.J., Mogeni, O.D., Kim, J.H., et al. (2019). Глобальное бремя и эпидемиология инвазивных нетифозных инфекций Salmonella . Гул. Вакк. Иммунотерапия. 15, 1421–1426. дои: 10.1080/21645515.2018.1504717

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Битон, М.Л., Алвес, Д.Р., Энрайт, М.К., и Дженкинс, А.Т.А. (2015). Оценка фаготерапии против Pseudomonas aeruginosa с использованием модели инфекции Galleria mellonella . Интерн. Дж. Антимикроб. Агенты 46, 196–200. doi: 10.1016/j.ijantimicag.2015.04.005

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Бонарди, С.(2017). Salmonella в цепочке производства свинины и ее влияние на здоровье человека в Европейском Союзе. Эпидемиол. Заразить. 145, 1513–1526. doi: 10.1017/s095026881700036x

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Бранчу, П., Чарити, О. Дж., Баун, М., Тиллиез, Г., Долман, Т. Дж., Петровска, Л., и др. (2019). SGI-4 в монофазном Salmonella typhimurium ST34 — это новый ИВС, повышающий устойчивость к меди. Фронт.микробиол. 10:1118. doi: 10.3389/fmicb.2019.01118

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Кампос, Дж., Мурао, Дж., Пейше, Л., и Антунес, П. (2019). Небрюшнотифозный Salmonella в производственной цепочке свиноводства: всесторонний анализ его воздействия на здоровье человека. Патогены 8:19. doi: 10.3390/pathogens8010019

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Коста, П., Перейра, К., Гомес, А.Т. П. К. и Алмейда А. (2019). Эффективность отдельных суспензий фагов и смеси фагов при инактивации Escherichia coli и Salmonella typhimurium : предварительное исследование in vitro. Микроорганизмы 7:94. doi: 10.3390/микроорганизмы7040094

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Czaplewski, L., Bax, R., Clokie, M., Dawson, M., Fairhead, H., Fischetti, V.A., et al. (2016). Альтернативы антибиотикам: обзор портфеля проектов. Ланцет Заражение. Дис. 16, 239–251. doi: 10.1016/s1473-3099(15)00466-1

Полнотекстовая перекрестная ссылка | Академия Google

Дьякович Л., Лоренци Л., Томассетти М., Мересс С. и Грамахо Х. (2017). Инфекционный внутриклеточный образ жизни Salmonella enterica зависит от адаптации к условиям питания внутри вакуоли, содержащей Salmonella . Вирулентность 8, 975–992. дои: 10.1080/21505594.2016.1270493

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Друлис-Кава, З., Майковска-Скробек, Г., Мацеевска, Б., Делаттре, А., и Лавин, Р. (2012). Обучение у бактериофагов — преимущества и ограничения применения фагов и белков, кодируемых фагами. Курс. Белковый пепт. науч. 13, 699–722. дои: 10.2174/1382804871193

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

ЕФСА (2018 г.). Сводный отчет Европейского союза об устойчивости к противомикробным препаратам зоонозных и индикаторных бактерий человека, животных и пищевых продуктов в 2016 г. EFSA J. 16:e05182. doi: 10.2903/j.efsa.2018.5182

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Комиссия EFSA по биологическим опасностям, Кутсуманис, К., Альенде, А., Альварес-Ордоньес, А., Болтон, Д., Бовер-Сид, С., и др. (2019). Контроль сальмонеллы в стадах домашней птицы и ее влияние на здоровье населения. EFSA J. 17:e05596. doi: 10.2903/j.efsa.2019.5596

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Эгуале, Т., Gebreyes, W.A., Asrat, D., Alemayehu, H., Gunn, J.S., Engidawork, E., et al. (2015). Небрюшнотифозные серотипы Salmonella , устойчивость к противомикробным препаратам и коинфекция паразитами среди пациентов с диареей и другими желудочно-кишечными жалобами в Аддис-Абебе, Эфиопия. BMC Заражение. Дис. 15:497. doi: 10.1186/s12879-015-1235-y

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Феррари, Р.Г., Росарио, Д.К.А., Кунья-Нето, А., Мано, С.B., Figueiredo, E.E.S., Conte-Junior, C.A., et al. (2019). Мировая эпидемиология сероваров сальмонеллы в продуктах животного происхождения: метаанализ. Заяв. Окружающая среда. микробиол. 85:e0591-19. doi: 10.1128/AEM.00591-19

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Фоли С.Л., Линн А.М. и Наяк Р. (2008). Вызовы Salmonella : распространенность среди свиней и домашней птицы и потенциальная патогенность таких изолятов. Дж. Аним.науч. 86, Е149–Е162. doi: 10.2527/jas.2007-0464

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Фонг, К., Му, К., Рео, Дж. Г., Левеск, Р. К., Киттс, Д. Д., Делакис, П., и соавт. (2020). Нечувствительные к бактериофагам мутанты устойчивых к противомикробным препаратам Salmonella enterica отличаются устойчивостью к тетрациклину и вирулентностью в клетках кишечника Caco-2. Интерн. Дж. Мол. науч. 21:1883.

Академия Google

Хутон, С., Аттербери, Р., и Коннертон, И. (2011). Применение коктейля бактериофагов для уменьшения загрязнения кожи свиней Salmonella typhimurium U288. Интерн. Дж. Пищевая микробиология. 151, 157–163. doi: 10.1016/j.ijfoodmicro.2011.08.015

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Хуанг, Х., Вирк, С.М., Ши, Дж., Чжоу, Ю., Уилльяс, С.П., Морси, М.К., и соавт. (2018). Выделение, характеристика и применение бактериофага LPSE1 против Salmonella enterica в готовых к употреблению (RTE) пищевых продуктах. Фронт. микробиол. 9:1046. doi: 10.3389/fmicb.2018.01046

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Хугас, М., и Белоил, П.А. (2014). Контроль Salmonella по пищевой цепочке в Европейском Союзе – прогресс за последние десять лет. Евронаблюдение 19:20804. дои: 10.2807/1560-7917.ES2014.19.19.20804

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Хунгаро, Х.М., Мендонса, Р.CS, Gouvêa, DM, Vanetti, MCD, and Pinto, CLO (2013). Использование бактериофагов для снижения Salmonella в куриной коже по сравнению с химическими агентами. Пищевой Рез. Стажер 52, 75–81. doi: 10.1016/j.foodres.2013.02.032

Полнотекстовая перекрестная ссылка | Академия Google

Ислам М.С., Чжоу Ю., Лян Л., Ниме И., Лю К., Ян Т. и др. (2019). Применение фагового коктейля для контроля Salmonella в пищевых продуктах и ​​уменьшения биопленок. Вирусы 11:841. дои: 10.3390/v110

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Йоньчик, Э., Клак, М., Мишбродски, Р., и Гурски, А. (2011). Влияние внешних факторов на бактериофаги — обзор. Фолиа микробиол. 56, 191–200. doi: 10.1007/s12223-011-0039-38

Полнотекстовая перекрестная ссылка | Академия Google

Юнг Л.С., Дин Т. и Ан Дж. (2017). Оценка литических бактериофагов для борьбы с Salmonella typhimurium с множественной лекарственной устойчивостью . Энн. клин. микробиол. Антимикроб. 16:66. doi: 10.1186/s12941-017-0237-6

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Кирк, М.Д., Пирес, С.М., Блэк, Р.Е., Кайпо, М., Крамп, Дж.А., Девлисшаувер, Б., и соавт. (2015). Оценки Всемирной организации здравоохранения глобального и регионального бремени 22 бактериальных, протозойных и вирусных болезней пищевого происхождения, 2010 г.: обобщение данных. PLoS Мед. 12:e1001921. doi: 10.1371/journal.pmed.1001921

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Кропински А.М., Маццокко А., Уодделл Т.Е., Лингор Э. и Джонсон Р.П. (2009). Подсчет бактериофагов методом двойного анализа налета на агаре. Методы Мол. биол. 501, 69–76. дои: 10.1007/978-1-60327-164-6_7

Полнотекстовая перекрестная ссылка | Академия Google

Li, Z., Ma, W., Li, W., Ding, Y., Zhang, Y., Yang, Q., et al. (2020). Фаг широкого спектра действия контролирует полирезистентную сальмонеллу в жидких яйцах. Пищевой Рез. Стажер 132:109011. дои: 10.1016/j.foodres.2020.109011

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Лок-Каррильо, К., и Абедон, С.Т. (2011). Плюсы и минусы фаготерапии. Бактериофаг 1, 111–114.

Академия Google

Маковяк, П.А., Марлинг-Кейсон, М., и Коэн, Р.Л. (1982). Влияние температуры на чувствительность бактерий к противомикробным препаратам. Дж. Заразить. Дис. 145, 550–553.

Академия Google

Майович, С.Э., Мусто Дж., Скаллан Э., Ангуло Ф.Дж., Кирк М., О’Брайен С.Дж. и соавт. (2010). Глобальное бремя нетифозного Salmonella гастроэнтерита. клин. Заразить. Дис. 50, 882–889. дои: 10.1086/650733

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Мартинес, М. Н., Уоттс, Дж. Л., и Гилберт, Дж. М. (2019). Вопросы, связанные с разработкой новых препаратов для лечения бактериальных инфекций у животных. Вет.Дж. 248, 79–85. doi: 10.1016/j.tvjl.2019.04.009

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Мартинес-Авилес, М., Гарридо-Эстепа, М., Альварес, Дж., и де ла Торре, А. (2019). Системы эпиднадзора за Salmonella у свиней и людей в Испании: обзор. Вет. науч. 6:20. doi: 10.3390/vetsci6010020

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Набиль, Н.М., Тавакол, М.М., и Хассан, Х.М. (2018).Оценка влияния бактериофагов при лечении Salmonella у цыплят-бройлеров. Заразить. Экол. Эпидемиол. 8:1539056. дои: 10.1080/20008686.2018.1539056

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Нэйл, Дж. Ю., Чутиа, М., Карр, П., Хикенботэм, П., и Клоки, М. Р. Дж. (2016a). «Раннее начало»: модели биопленки и восковой моли ( Galleria mellonella ) позволяют по-новому взглянуть на терапевтический потенциал бактериофагов Clostridium difficile . Фронт. микробиол. 7:1383. doi: 10.3389/fmicb.2016.01383

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Нэйл, Дж. Ю., Спенсер, Дж., Харгривз, К. Р., Бакли, А. М., Тржепински, П., Дус, Г. Р., и соавт. (2016б). Комбинации бактериофагов значительно снижают рост Clostridium difficile in vitro и пролиферацию in vivo. Антимикроб. Агенты Чемотер. 60, 968–981. doi: 10.1128/aac.01774-15

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Нейл, Дж.Ю., Чутия М., Ченг Дж. К. Дж. и Клоки М. Р. Дж. (2020). Уточнение модели Galleria mellonella с использованием генов маркеров стресса для оценки инфицирования Clostridioides difficile и выздоровления во время фаготерапии. Микроорганизмы 8:1306. doi: 10.3390/микроорганизмы80

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Нобрега Ф.Л., Коста А.Р., Класкенс Л.Д. и Азередо Дж. (2015). Возвращение к фаговой терапии: новые приложения для старых ресурсов. Тенденции микробиол. 23, 185–191. doi: 10.1016/j.tim.2015.01.006

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

О’Нил, Дж. (2014). Устойчивость к противомикробным препаратам: преодоление кризиса для здоровья и богатства народов. Лондон: Обзор устойчивости к противомикробным препаратам.

Академия Google

Патерсон, И. К., Хойл, А., Очоа, Г., Бейкер-Остин, К., и Тейлор, Н. Г. Х. (2016). Оптимизация использования антибиотиков для лечения бактериальных инфекций. науч. Респ. 6:37853. дои: 10.1038/srep37853

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Перейра, К., Морейринья, К., Левика, М., Алмейда, П., Клементе, К., и Кунья, В, и соавт. (2016). Бактериофаги, способные инактивировать Salmonella typhimurium : использование отдельных фаговых суспензий и фаговых коктейлей. Вирус Рез. 220, 179–192. doi: 10.1016/j.virusres.2016.04.020

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Петровская, Л., Mather, A.E., Abuoun, M., Branchu, P., Harris, S.R., Connor, T.R., et al. (2016). Микроэволюция монофазной Salmonella typhimurium во время эпидемии, Великобритания, 2005-2010 гг. Аварийный. Заразить. Дис. Дж. 22:617. дои: 10.3201/eid2204.150531

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Петсонг К., Бенджакул С., Чатуронгакул С., Свитт А.И.М. и Вонгкамьян К. (2019). Профили лизиса фагов Salmonella на изолятов Salmonella из различных источников и эффективность фагового коктейля против S.enteritidis и S.typhimurium . Микроорганизмы 7:100. doi: 10.3390/микроорганизмы7040100

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Phothaworn, P., Supokaivarich, R., Lim, J., Klumpp, J., Imam, M., Kutter, E., et al. (2020). Разработка смеси фагов Salmonella широкого спектра действия, содержащей viunalike и jerseylike вирусы, выделенные из Таиланда. Пищевой микробиол. 2020:103586. doi: 10.1016/j.fm.2020.103586

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Рамарао, Н., Нильсен-Леру, К., и Лереклю, Д. (2012). Насекомое Galleria mellonella как мощная модель инфекции для изучения бактериального патогенеза. Дж. Виз. Эксперт. 2012:4392. дои: 10.3791/4392

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Ромеро-Калле, Д., Гимарайнш Беневидес, Р., Гоэс-Нето, А., и Биллингтон, К. (2019). Бактериофаги как альтернатива антибиотикам в клинической практике. Антибиотики 8:138. doi: 10.3390/антибиотики8030138

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Скляр, И.А.Н., и Йоргер, Р. (2001). Попытки использовать бактериофаги для борьбы с Salmonella enterica Serovar enteritidis у кур. J. Food Safe. 21, 15–29. doi: 10.1111/j.1745-4565.2001.tb00305.x

Полнотекстовая перекрестная ссылка | Академия Google

Смит, Р. П., Андрес, В., Чейни, Т. Э., Мартелли, Ф., Гослинг Р., Мариер Э. и соавт. (2018). Как свинофермы поддерживают низкую распространенность Salmonella : исследование случай-контроль. Эпидемиол. Заразить. 146, 1909–1915 гг. дои: 10.1017/S0950268818002248

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Сокет П.Н. и Робертс Дж.А. (1991). Социально-экономические последствия сальмонеллеза. Отчет о национальном обследовании в Англии и Уэльсе лабораторно подтвержденных инфекций Salmonella . Эпидемиол.Заразить. 107, 335–347. дои: 10.1017/s0950268800048974

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Sommer, J., Trautner, C., Witte, A.K., Fister, S., Schoder, D., Rossmanith, P., et al. (2019). Не закрывайте дверь конюшни после того, как фаг убежал — важность инактивации бактериофагов в пищевой среде. Вирусы 11:468.

Академия Google

Тассинари, Э., Даффи, Г., Баун, М., Берджесс, К.М., Маккейб, Э.М., Lawlor, P.G., et al. (2019). Микроэволюция устойчивости к противомикробным препаратам и формирование биопленок Salmonella typhimurium в процессе персистенции на свинофермах. науч. Респ. 9:8832. doi: 10.1038/s41598-019-45216-w

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Танки, А. М., Браун, Н., Миллард, А. Д., и Клоки, М. Р. Дж. (2019). Геномная характеристика фагов jumbo Salmonella , которые эффективно воздействуют на серотипы Salmonella , ассоциированные со свиньями Соединенного Королевства. Фронт. микробиол. 10:1491. doi: 10.3389/fmicb.2019.01491

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Томас, Р. Дж., Хамблин, К. А., Армстронг, С. Дж., Мюллер, К. М., Бокори-Браун, М., Голдман, С., и др. (2013). Galleria mellonella в качестве модельной системы для тестирования фармакокинетики и эффективности антибиотиков против Burkholderia pseudomallei . Интерн. Дж. Антимикроб. Агенты 41, 330–336. doi: 10.1016/j.ijantimicag.2012.12.009

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Виегас, С., Мил-Хоменс, Д., Фиальо, А., и Аррайано, К. (2013). Вирулентность Salmonella enterica Serovar typhimurium в модели насекомого Galleria mellonella нарушена мутациями в РНКазе E и РНКазе III. Заяв. Окружающая среда. микробиол. 79, 6124–6133. doi: 10.1128/АЕМ.02044-2013

Полнотекстовая перекрестная ссылка | Академия Google

Уолл, С. К., Чжан, Дж., Ростаньо, М. Х., и Эбнер, П. Д. (2010). Фаговая терапия для снижения предварительной обработки инфекций Salmonella у свиней товарного веса. Заяв. Окружающая среда. микробиол. 76, 48–53. doi: 10.1128/aem.00785-09

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Жбиковска К., Михальчук М. и Долка Б. (2020). Применение бактериофагов в птицеводстве. Животные 10:872.

Академия Google

Чжан, Дж., Ли, З., Цао, З., Wang, L., Li, X., Li, S., et al. (2015). Бактериофаги как противомикробные агенты против основных патогенов свиней: обзор. Дж. Аним. науч. Биотехнолог. 6:39. doi: 10.1186/s40104-015-0039-7

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Бактериофаговая терапия для уменьшения колонизации сальмонеллой цыплят-бройлеров

R. J. Atterbury

Департамент клинической ветеринарии, Бристольский университет, Лэнгфорд, Бристоль, Великобритания, 1 Группа зоотехники, Вагенинген, UR, Infectious Diseases, P.O. Box 65, 8200 AB Lelystad, The Netherlands, 2 Институт здоровья животных, Compton Laboratory, Compton, Newbury, Berkshire, United Kingdom 3

M. A. P. Van Bergen

Факультет клинической ветеринарии, Бристольский университет , Langford, Bristol, United Kingdom, 1 Animal Sciences Group, Wageningen UR, Infectious Diseases, P.O. Box 65, 8200 AB Lelystad, Нидерланды, 2 Институт здоровья животных, Комптонская лаборатория, Комптон, Ньюбери, Беркшир, Соединенное Королевство 3

F.Ortiz

Департамент клинической ветеринарии Бристольского университета, Лэнгфорд, Бристоль, Великобритания, 1 Группа зоотехники, Wageningen UR, Infectious Diseases, P.O. Box 65, 8200 AB Lelystad, The Netherlands, 2 Институт здоровья животных, Compton Laboratory, Compton, Newbury, Berkshire, United Kingdom 3

M. A. Lovell

Факультет клинической ветеринарии, Бристольский университет, Лэнгфорд, Bristol, United Kingdom, 1 Animal Sciences Group, Wageningen UR, Infectious Diseases, P.O. Box 65, 8200 AB Lelystad, The Netherlands, 2 Институт здоровья животных, Compton Laboratory, Compton, Newbury, Berkshire, United Kingdom 3

J. A. Harris

Факультет клинической ветеринарии, Бристольский университет, Langford, Bristol, United Kingdom, 1 Animal Sciences Group, Wageningen UR, Infectious Diseases, P.O. Box 65, 8200 AB Lelystad, Нидерланды, 2 Институт здоровья животных, Compton Laboratory, Compton, Newbury, Berkshire, United Kingdom 3

A.De Boer

Факультет клинической ветеринарии Бристольского университета, Лэнгфорд, Бристоль, Великобритания, 1 Группа зоотехники, Wageningen UR, Infectious Diseases, P.O. Box 65, 8200 AB Lelystad, The Netherlands, 2 Институт здоровья животных, Compton Laboratory, Compton, Newbury, Berkshire, United Kingdom 3

J. A. Wagenaar

Факультет клинической ветеринарии, Бристольский университет, Лэнгфорд, Bristol, United Kingdom, 1 Animal Sciences Group, Wageningen UR, Infectious Diseases, P.O. Box 65, 8200 AB Lelystad, The Netherlands, 2 Институт здоровья животных, Compton Laboratory, Compton, Newbury, Berkshire, United Kingdom 3

V. M. Allen

Факультет клинической ветеринарии, Бристольский университет, Langford, Bristol, United Kingdom, 1 Animal Sciences Group, Wageningen UR, Infectious Diseases, P.O. Box 65, 8200 AB Lelystad, Нидерланды, 2 Институт здоровья животных, Compton Laboratory, Compton, Newbury, Berkshire, United Kingdom 3

P.A. Barrow

Факультет клинической ветеринарии Бристольского университета, Лэнгфорд, Бристоль, Великобритания, 1 Группа зоотехники, Wageningen UR, Infectious Diseases, P.O. Box 65, 8200 AB Lelystad, The Netherlands, 2 Институт здоровья животных, Compton Laboratory, Compton, Newbury, Berkshire, United Kingdom 3

Оценка воздействия бактериофагов при лечении сальмонелл у цыплят-бройлеров

Эколь Эпидемиол.2018; 8(1): 1539056.

Нехал М. Набиль

Справочная лаборатория ветеринарного контроля качества птицеводства, Научно-исследовательский институт здоровья животных, Гиза, Египет,

Марам М. Тавакол

Справочная лаборатория ветеринарного контроля качества птицеводства, Научно-исследовательский институт здоровья животных, Гиза, Египет,

Хеба М. Хассан

Справочная лаборатория ветеринарного контроля качества птицеводства, Научно-исследовательский институт здоровья животных, Гиза, Египет,

Справочная лаборатория ветеринарного контроля качества птицеводства, Научно-исследовательский институт здоровья животных, Гиза, Египет,

КОНТАКТЫ Нехал М.Nabil [email protected]_lahen, Справочная лаборатория ветеринарного контроля качества птицеводства, Научно-исследовательский институт здоровья животных, Гиза, Египет

Поступила в редакцию 28 июня 2018 г.; Принято 18 октября 2018 г.

Copyright © 2018 Авторы. Опубликовано Informa UK Limited, торгуемой как Taylor & Francis Group. Это статья с открытым доступом, распространяемая в соответствии с условиями лицензии Creative Commons Attribution (http://creativecommons.org/licenses/by/4.0/), которая разрешает неограниченное использование. , распространение и воспроизведение на любом носителе при условии надлежащего цитирования оригинальной работы.Эта статья была процитирована другими статьями в PMC.

РЕФЕРАТ

Сальмонеллез является одной из основных бактериальных инфекций, поражающих товарную птицу, наносящих ущерб птицеводству и представляющих опасность для общественного здравоохранения.

Образцы внутренних органов (печень, слепая кишка и селезенка) от ста больных цыплят-бройлеров были взяты и подвергнуты выделению, идентификации и серотипированию Salmonella . S.typhimurium и S.enteritidis были отобраны из изолированных Salmonella для приготовления бактериофагов из сточных вод, взятых на бройлерных фермах.Проведено экспериментальное заражение однодневных цыплят, свободных от специфических патогенов (SPF), с последующей обработкой приготовленными бактериофагами, выделенными как из Salmonella . Образцы слепой кишки от инфицированных цыплят периодически подвергали выделению бактериофага и количественному анализу Salmonella . Эффективность обработки бактериофагом при колонизации Salmonella в слепой кишке инфицированных цыплят повышалась после пяти последовательных доз. На 3-й день после инфицирования (dpi) содержимое слепой кишки показало незначительное снижение количества сальмонелл с еще большим снижением на 5 dpi.С 7 dpi до конца эксперимента при 15 dpi все цыплята были очищены как от , так и от Salmonella .

Результаты этого исследования показывают, что лечение бактериофагами эффективно снижает колонизацию S. typhimurium и S. enteritidis у цыплят-бройлеров в течение короткого периода времени и может использоваться в качестве альтернативы антибиотикам.

КЛЮЧЕВЫЕ СЛОВА: Бактериофаги, поголовье птицы, колонизация сальмонеллами

Введение

Сальмонеллез является одной из основных инфекций, поражающих товарную птицу, наносящих ущерб птицеводству и представляющих опасность для общественного здравоохранения [1].Сальмонеллы, возбудители сальмонеллеза, представляют собой грамотрицательные, палочковидные, факультативно-анаэробные бактерии, вызывающие гастроэнтерит [2]. Брюшной тиф и пуллорум птиц являются широко распространенными септицемическими заболеваниями, вызываемыми S. gallinarum и S. pullorum , соответственно, и поражают главным образом цыплят и индеек. Эти бактерии передаются в основном трансовариально. Источниками инфекции также могут быть фекалии инфицированных птиц, зараженные корма, вода и подстилка. Клинические признаки у цыплят и индюшат включают анорексию, обезвоживание, слабость, диарею и высокую смертность.Снижение яйценоскости, оплодотворяемости и выводимости являются наиболее важными клиническими признаками у половозрелых птиц. Макроскопические и микроскопические поражения включают гепатит, тифлит, омфалит, пневмонию, офтальмит, сальпингит, синовит и перитонит [3].

Желудочно-кишечный тракт птицы считается основным резервуаром различных патогенных бактерий, которые могут вызывать перекрестную контаминацию мяса птицы и яичных продуктов [4]. Например, сальмонелла может проникать в эпителиальные клетки кишечника и выживать внутриклеточно в макрофагах [5], и эти внутриклеточные сальмонеллы не легко контролируются антибиотиками.Борьба с бактериофагами привлекла большое внимание как потенциальный подход к лечению бактериальных инфекций [6] из-за появления устойчивых к антибиотикам бактерий [7].

Бактериофаги представляют собой бактериальные вирусы [8] и, как предполагалось в предыдущих исследованиях, возможные альтернативы антибиотикам для лечения бактериальных заболеваний [9]. Бактериофаги не оказывают неблагоприятного воздействия на иммунную систему человека или животных и не влияют на нормальную бактериальную флору [10]. Фаги очень специфичны для хозяина, обычно нацелены на определенную группу видов бактерий [11].Бактериофаги размножаются внутри инфицированной клетки-хозяина в так называемом цикле литической инфекции и высвобождаются из клеток-хозяев путем бактериолиза. Бактериофаги заражают бактерии, вводя свою ДНК через бактериальную оболочку в цитоплазму клетки [12]. Инъецированная ДНК фага реплицируется с использованием метаболического механизма инфицированной клетки-хозяина, а гены, кодирующие белковую оболочку фага, систематически экспрессируются [13].

Настоящее исследование направлено на выделение и идентификацию Salmonella из внутренних органов больных бройлеров и оценку эффективности препаратов неочищенного бактериофага при лечении колонизации Salmonella у птиц.

Материалы и методы

Сбор и идентификация образцов

В конце 2017 и начале 2018 года было собрано в общей сложности 100 больных цыплят-бройлеров (разного возраста) из 75 ферм провинции Дакахлия (Египет). Образцы внутренних органов (печень, селезенка и слепая кишка) от каждой птицы были собраны в асептических условиях, помечены и доставлены непосредственно в холодильнике в Справочную лабораторию ветеринарного контроля качества птицеводства (RLQP) (лаборатория Гамаса) для выделения сальмонеллы.

Печень, слепую кишку и селезенку от каждого цыпленка-бройлера объединяли вместе в один образец. Сальмонеллы выделяли и идентифицировали в соответствии со стандартом ISO 6579 (2017) [14] следующим образом: образцы взвешивали и суспендировали в забуференной пептонной воде (разведение 1:10) и инкубировали при 37ºC в течение 18 часов. Бульон для предварительного обогащения после инкубации перемешивали и 0,1 мл бульона переносили в пробирку, содержащую 10 мл среды Раппапорта-Вассиладиса с соей (бульон РВС). Еще 1 мл бульона для предварительного обогащения переносили в пробирку, содержащую 10 мл новобиоцинового бульона тетратионата Мюллера-Кауфмана (бульон MKTTn).Инокулированный бульон RVS инкубировали при 41,5°C в течение 24 часов, а инокулированный бульон MKTTn при 37°C в течение 24 часов. После инкубации полную петлю материала из бульона RVS и MKTTn переносили и наносили штрихами отдельно на поверхность ксилозо-лизин-дезоксихолатного агара (XLD-агар), Hektoen Enteric (HE-агар), агара МакКонки и SS-агара соответственно. Планшеты инкубировали при 37°C в течение 24 часов, затем проверяли рост типичных колоний Salmonella.

Изоляты, биохимически идентифицированные как сальмонеллы (метиловый красный, утилизация цитрата, тройное железо железа и каталазные тесты положительные и отрицательные на В-П, уреазный и индольный тесты), подвергали серологической идентификации по схеме Кауфмана-Уайта [15] для определения соматический (О) и жгутиковый (Н) антигены [16].

Выделение и очистка бактериофагов

S.typhimurium и S.enteritidis , выделенные в этом исследовании от больных цыплят-бройлеров, были отобраны и использованы для приготовления бактериофагов. Согласно [10,13]; пять проб сточных вод были собраны на бройлерных фермах и центрифугированы при низкой скорости (8496 g) в течение 10 минут для удаления твердых частиц, а затем отфильтрованы с помощью шприцевых фильтров с размером пор 0,22 мкм. Для обогащения, выделения и очистки бактериофагов; С.typhimurium и S. enteritidis выращивали в течение ночи при 37°C в питательном бульоне для получения чистых бактериальных культур. На следующий день 0,1 мл ночных культур инокулировали в 10 мл питательного бульона и инкубировали при 37°C в течение 3 часов при перемешивании до достижения экспоненциальной фазы. Супернатант образца фильтра сточных вод (4,5 мл) смешивали с 0,5 мл бактериальных культур экспоненциальной фазы и 0,5 мл концентрированного питательного бульона и инкубировали при 37°C в течение 24 часов. После инкубации образцы центрифугировали при 8496 g в течение 10 минут, супернатанты фильтровали через фильтр 0.Шприц с фильтром 22 мкм и использовали в качестве образцов обогащенного фага (EP).

Обнаружение бактериофагов: точечный метод и анализ бляшек

Подготовленные бактериофаги были протестированы методом выборочного тестирования, чтобы убедиться в наличии литических фагов в приготовленных обогащенных фаговых фильтратах. Один мл культивированных S.typhimurium и S.enteritidis распределяли по отдельности на чашках с питательным агаром, избыток жидкости удаляли и чашки оставляли при комнатной температуре для сушки. 10 мкл приготовленного обогащенного фагового фильтрата наносили на агар и давали высохнуть.Чашки с агаром инкубировали при 37°C в течение ночи для обнаружения литических пятен (зон просветления) на чашках с агаром в соответствии с Rahaman et al. [17].

Анализ зубного налета проводили в соответствии с Akhtar et al. [13] с некоторыми изменениями; Десятикратное серийное разведение выполняли с использованием 0,1 мл суспензии фага (приготовленной выше). Одну колонию ночной культуры S. typhimurium и S. enteritidis инокулировали отдельно в 5 мл питательного бульона и инкубировали при 37°C в течение 3 часов.Полужидкий агар (0,5%) разделяли на аликвоты (3 мл) в пробирки, помещенные при 45°C на водяную баню, в полутвердые пробирки с агаром добавляли по 0,1 мл фага и 0,5 мл S. typhimurium и S. enteritidis по отдельности, затем смешивают и выливают на чашки с питательным агаром. Планшетам давали остыть и инкубировали в течение ночи при 37°С. Бляшки подсчитывали и количество фагов определяли как бляшкообразующую единицу (на мл?) (БОЕ).

Анализ лечения бактериофагами in vivo у экспериментально инфицированных цыплят

Этическое одобрение: Эксперимент на животных проводился в соответствии с официально утвержденным протоколом [AHRI (29) 23/11/2017] Института здоровья и исследований животных (AHRI), Гиза, Египет.Эксперименты по изоляции проводились в отдельных клетках в помещении для животных со вторым уровнем биобезопасности (BSL-2).

Схема эксперимента: Сто двадцать цыплят SPF (однодневного возраста) поместили в изоляторы с воздушным фильтром в Референс-лаборатории ветеринарного контроля качества птицеводства (RLQP). Из таблицы 1 подопытные цыплята (120 цыплят) были разделены на четыре группы по 30 цыплят в каждой. Каждую группу птиц размещали индивидуально, давали корм и воду вволю.Цыплята содержались при соответствующей возрасту температуре до конца эксперимента.

Таблица 1.

Экспериментальный план лечения бактериофагами (SPF) цыплят, зараженных S . тифимуриум и S . энтеритидис.

Дозы цыплят Бактериофаг Salmonella График лечения График лечения бактериофаги (дни) возраст Salmonella Infection Время эвтаназии (дни)
группа
(1) A
30 30 30 30 30 5, 7, 9, 11, 14, 17
Группа
(2) B
30 0.1 мл 1.18 × 10 11 PFU / цыплята 0,1 мл
10 5 CFU / цыплята
(S.T.)
1, 2, 3, 6, 8, 10, 13, 15 2 дня 5 , 7, 9, 11, 14, 17
Group
(3) C
30 0,1 мл 1,03 × 10 12 PFU / kick 0,1 мл 0,1 мл
10 5 CFU / цыпочка
(ЮВ)
1, 2, 3, 6, 8, 10, 13, 15 2-й день 5, 7, 9, 11, 14, 17
Группа 4 (А)
15
0.1мл
10 5 CFU / цыпочка
(S.T.)
2 дня 5, 7, 9, 11, 14, 17
(b)
15
0.1ml
10 5 CFU / kick
(S.E.)
2 дня 2 день 5, 7, 9, 11, 14, 17

Бактериофаги С. Типимуриум , которые были подготовлены в этом исследовании несколько раз вводили перорально; у всех цыплят группы 2 на 1, 2, 3, 6, 8, 10, 13 и 15 сутки с 0.1 мл раствора, содержащего 1,18 × 10 11 БОЕ фагов/цыпленка в 0,1 мл. Впоследствии всем цыплятам в этой группе на второй день перорально вводили однократную дозу 10 5 КОЕ S. typhimurium в общем объеме 0,1 мл. Группа 3 придерживалась аналогичного режима, за исключением того, что перорально вводимые бактериофаги (1,03 × 10 12 БОЕ/цыпленок) были амплифицированы и выделены из культур S. enteritidis , а цыплята подвергались пероральному заражению на второй день однократной дозой 10 5 КОЕ С.энтеритидис .

Группа 4 была положительным контролем для обоих Salmonella . Пятнадцать цыплят перорально инокулировали на второй день однократной дозой 0,1 мл культуры S. typhimurium в концентрации 10 5 КОЕ/цыпленок. Остальные пятнадцать цыплят содержали в другом отдельном изоляторе и перорально инокулировали однократной дозой 0,1 мл культуры S. enteritidis в концентрации 10 5 КОЕ/цыпленок. Группа 1 была оставлена ​​в качестве отрицательного контроля и не инокулирована бактериофагами или Salmonella .

Пять цыплят из групп 1, 2, 3 и 4 соответственно были усыплены на 5, 7, 9, 11, 14 и 17 сутки. Эксперимент прекращен на 17 сутки.

Выделение сальмонелл и бактериофагов из цыплят в ходе эксперимента

Печень, селезенка и слепая кишка вскрытых цыплят подвергались выделению и идентификации Salmonella в соответствии с ISO 6579 (2017) [17]; репрезентативные колонии S.typhimurium и S.enteritidis были подтверждены реакциями агглютинации на предметных стеклах с поли(О), поли(Н) и серотип-специфичными антисыворотками.Бактериофаги были выделены из содержимого слепой кишки 2-й и 3-й групп; суспензию содержимого слепой кишки (1 грамм содержимого слепой кишки: 9 мл физиологического раствора, pH 7,4) центрифугировали при (10 000 об/мин) в течение 10 минут для удаления любого мусора. Затем супернатант фильтровали с помощью шприца с фильтром 0,22 мкм для удаления любых оставшихся бактерий. Наконец, 10 мкл фильтрата использовали для выборочного тестирования для обнаружения присутствия бактериофагов в соответствии с Rahaman et al. [17].

Количественное определение Salmonella в содержимом слепой кишки цыплят

Суммарную ДНК экстрагировали из содержимого слепой кишки всех цыплят в группах 2 и 3 и одного цыпленка из групп 1 и 4 в каждый момент времени с использованием набора QIAamp DNA Mini (Qiagen, Германия, GmbH) с изменениями рекомендаций производителя (остальные цыплята 1-й и 4-й групп исследовали путем посева на XLD-агар [18]).Вкратце, 200 мкл суспензии содержимого слепой кишки инкубировали с 10 мкл протеиназы К и 200 мкл лизирующего буфера при 56°C в течение 10 мин. После инкубации к лизату добавляли 200 мкл 100% этанола. Затем образец промывали и центрифугировали в соответствии с рекомендациями производителя. ДНК элюировали 100 мкл элюирующего буфера, входящего в комплект. Используемые олигонуклеотидные праймеры и зонды были предоставлены компанией Metabion (Германия) и перечислены в таблице 2. Амплификацию ДНК проводили в конечном объеме 25 мкл, содержащем 3 мкл матрицы ДНК, 12.5 мкл 2 × QuantiTect Probe RT-PCR Master Mix, 8,875 мкл воды для ПЦР, 0,25 мкл каждого праймера (конц. 50 пмоль) и 0,125 мкл каждого зонда (конц. 30 пмоль). Первичную денатурацию проводили при 94°С в течение 15 мин, затем следовали 40 циклов денатурации при 94°С в течение 15 с, отжиг при 49°С в течение 30 с и удлинение при 72°С в течение 10 с. Концентрацию бактерий в образцах определяли с помощью КОЕ/г. Известный стандарт (известных КОЕ/г) серийно разбавляли в 10 раз, затем отдельно выделяли ДНК из последних 5 разведений и тестировали с помощью ОТ-ПЦР в тех же условиях, что и неизвестные образцы.Стандарт был включен во все прогоны ПЦР. Реакцию проводили на машине для ПЦР в реальном времени Stratagene MX3005P (которая может показывать стандартное количество с точностью до 3 знаков после запятой).

Таблица 2.

Олигонуклеотидные праймеры и зонды, использованные в этом исследовании.

7 5′-3 ‘ CGTTCGGGCAATTCGTTA

+

Результаты девяносто одна тысяча четыреста сорок восемь

Заболеваемость Salmonella изоляции

Восемь Salmonella клоны были изолированы от 100 больных цыплят-бройлеров в Дакахлия с частотой 8%.При серотипировании выделенной Salmonella выявлены (2) S.typhimurium , (2) S.kentucky , (1) S.enteritidis , (1) S.molade , (1) S inganda и (1) S. apyeme .

Выделение, обнаружение и подсчет бактериофагов

Бактериофаги S. typhimurium и S. enteritidis были приготовлены из проб сточных вод с бройлерных ферм. Спот-тестирование подтвердило наличие специфических литических бактериофагов посредством появления клиренсных зон (литических пятен) в чашках, покрытых соответствующими видами Salmonella .Бактериофаги также были подсчитаны с использованием анализа бляшек для обоих видов Salmonella для подготовки образцов фагов, необходимых для эксперимента (рис. 1), и результаты показали, что концентрация бактериофагов, заражающих S. typhimurium , составляла 118 × 10 10 БОЕ/ мл и 103 × 10 11 БОЕ/мл для S. enteritidis .

Анализ налета для подсчета бактериофагов.

Клинические признаки и выделение бактериофагов

Все цыплята в группе 1 (отрицательный контроль) не имели ни клинических признаков, ни результатов вскрытия.У цыплят в группе 4 части А и части В (положительные контроли для инфекций S.typhimurium и S.enteritidis соответственно) наблюдались депрессия, потеря аппетита, неспособность стоять, диарея и заклеивание вентиляционных отверстий. Наблюдали гиперемию внутренних органов, кровоизлияния в печень, нерассосанный желточный мешок у некоторых цыплят и увеличение двух слепых отростков с диареей (рис. 2). Смертность появилась через 3 дня для Salmonella , а уровень смертности в конце эксперимента составил 30% для S.enteritidis и 20% для S.typhimurium .

(а) геморрагические пятна в печени с вздутием кишечника при поносе (б) полнокровие внутренних органов со склеиванием вен (в) расширение и вздутие двух цеков с поносом.

В инфицированных группах 2 и 3, которых лечили бактериофагами в разные моменты времени (1, 2, 3, 6, 8, 10, 13 и 15 дни), наблюдались депрессия и диарея через 2 дня после заражения. Эти признаки постепенно исчезли, а патологоанатомические находки на 3 dpi включали увеличение двух слепых кишек с диареей, застой в печени и несколько цыплят с кровоизлияниями в сердце.На 7 дпи до конца эксперимента активность цыплят повышалась, а диарея прекращалась.

Бактериофаги были выделены из содержимого слепой кишки умерщвленных цыплят 2-й и 3-й групп; выборочные тесты подтвердили присутствие специфических бактериофагов Salmonella , создав четкие просветы на чашках с двумя разными видами Salmonella соответственно.

Выделение, идентификация и количественное обнаружение Salmonella

Все цыплята в группе 1 (неинфицированный отрицательный контроль) дали отрицательный результат на колонизацию Salmonella , что было определено путем посева на агар XLD.Все цыплята группы 4-А и 7 цыплят группы 2 до конца эксперимента были положительны по S.typhimurium и вид подтверждали с помощью серотипспецифических антисывороток.

Аналогично, все цыплята в группе 4-B и 7 цыплят в группе 3 были положительными на S. enteritidis , и снова вид был подтвержден с помощью серотип-специфических антисывороток. Все цыплята в группе 4 (инфекционный контроль) дали положительный результат на Salmonella путем посева на агар XLD.

Количественная ПЦР в реальном времени (RT-PCR) использовалась в качестве быстрого и точного метода для определения нагрузок Salmonella в слепой кишке вскрытых цыплят в группах 2 и 3, а также для изучения значимости и эффективности обработки бактериофагами Salmonella колонизация.Таблицы 3 и 4 показывают, что лечение бактериофагами начинает снижать колонизацию S. typhimurium (группа 2) и S. enteritidis (группа 3) в слепой кишке после четырех последовательных доз. В возрасте 3 дня на дюйм содержимое слепой кишки всех умерщвленных цыплят показало небольшое снижение колонизации Salmonella по сравнению с группами положительного контроля. При 5 dpi колонизация как сальмонеллами, так и снижена по сравнению с 3 dpi. С начала 7 дпи до конца эксперимента через 15 дпи (после пяти последовательных доз обработки бактериофагом) у всех цыплят не наблюдалось колонизации обоих Salmonella в слепой кишке, что позволяет предположить, что обработка бактериофагом эффективна при лечении Сальмонелла ..

Таблица 3.

Количественное определение S . typhimurium в слепой кишке подопытных цыплят.

Gene
Gene Primer / Sequence
Ссылка
ENV A GCGTTCACCTTTTGGATATAA DAUM et alt. (19)
5′-FAM-TGGCGGTGGGTTTTGTTGTCTTCT-TAMRA-3 ‘
+ + + + + + +
Код образца № группы Возраст цыплят Результаты Ct. Конц. (КОЕ / г)
Т1 2 5 дней Положительный 24,35 1,413 × 10 2
Т2 2 5 дней Положительный 23.38 2,778 × 10 2
Т3 2 5 дней Положительные 25,78 5,213 × 10 2
Т4 2 5 дней Положительный 22.95 3,749 × 10 2
T5 2 5 дней Положительные 23.10 3,376 × 10 2
T6 (отрицательный контроль) 1 5 дней отрицательный NO CT
9
(положительный контроль) 4 A 5 дней Положительный 22.36 5.656 × 10 2
Т9 2 7 дней Положительные 23,62 2,350 × 10 2
Т10 2 7 дней Отрицательный Нет CT
T11 2 7 дней Отрицательный Нет CT
T12 2 7 дней Положительный 22 .85 4.019 × 10 2
T13 2 7 дней Отрицательный Нет CT
T14 (отрицательный контроль) 1 7 дней нет CT
0 9 дней 9110 21 .70 8.960 × 10 2
T17 2 9 дней Отрицательный Нет CT
T18 2 9 дней Отрицательный Нет CT
T19 2 9 дней Негативные Нет CT
T20 2 9 дней Отрицательные Нет CT
T21 2 9 дней отрицательный нет CT
T22 (отрицательный контроль) 1 9 дней Негативные Нет CT
T24 (положительный контроль) 4A 9 дней Положительный 20.45 2.142 × 10 3
T25 2 11 дней Отрицательный Нет CT
T26 2 11 дней Отрицательный Нет CT
T27 2 11 дней Негативные Нет CT
T28 2 11 дней Отрицательные Нет CT
T29 2 11 дней отрицательный нет CT
T30 (отрицательный контроль) 1 11 дней отрицательный Нет CT
T32 (положительный контроль) 4A 11 дней Положительный 20.63 1.889 × 10 3
T33 2 14 дней Отрицательный Нет CT
T34 2 14 дней Отрицательный Нет CT
T35 2 14 дней Негативные Нет CT
T36 2 14 дней Негативные Нет CT
T37 2 14 дней отрицательный нет CT
T38 (отрицательный контроль) 1 14 дней отрицательный Нет CT
T40 (положительный контроль) 4A 14 дней Положительный 19.84 3.277 × 10 3
T41 2 17 дней Отрицательный Нет CT
T42 2 17 дней Отрицательный Нет CT
T43 2 17 дней Негативные Нет CT
T44 2 17 дней Негативные Нет CT
T45 2 17 дней отрицательный нет CT
T46 (отрицательный контроль) 1 17 дней отрицательный Нет CT
T48 (положительный контроль) 4A 17 дней Положительный 19.20 5,119 × 10 3

enteritidis в слепой кишке цыплят в эксперименте.

Код образца № группы Возраст цыплят Результаты Ct. Конц. (КОЕ/г)
 E1 3 5 дней Положительный 22.49 7.415 × 10 3
E2 3 5 дней Положительные 23,81 2,999 × 10 3
E3 3 5 дней Положительный 24,20 2,296 × 10 3
Е4 3 5 дней Положительный 24,57 1,781 × 10 3
E5 3 5 дней Положительный 22.01 1.030 × 10 4
E6 (отрицательный контроль) 1 5 дней отрицательный No CT
Е8 (положительный контроль) 4B 5 дней положительный 22,86 5,753 × 10 3
Е9 3 7 дней Положительный 21.45 1.513 × 10 4
E10 3 7 дней Отрицательный Нет CT
E11 3 7 дней Положительные 20,86 2.267 × 10 4
E12 3 7 дней Отрицательный Нет CT
E13 3 7 дней Отрицательный Нет CT
E14 (отрицательный контроль) 1 7 дней отрицательный NO CT
E16 (положительный контроль) 4B 7 дней Положительный 22.05 1.003 × 10 4
E17 3 9 дней Отрицательный Нет CT
E18 3 9 дней Отрицательный Нет CT
E19 3 9 дней Негативные Нет CT
E20 3 9 дней Негативные Нет CT
E21 3 9 дней отрицательный нет CT
E22 (отрицательный контроль) 1 9 дней Негативные Нет CT
E24 (положительный контроль) 4B 9 дней Положительный 21.32 1.654 × 10 4
E25 3 11 дней Отрицательный Нет CT
E26 3 11 дней Отрицательный Нет CT
E27 3 11 дней Негативные Нет CT
E28 3 11 дней Негативные Нет CT
Е29 3 11 дней отрицательный нет CT
E30 (отрицательный контроль) 1 11 дней отрицательный Нет CT
E32 (положительный контроль) 4B 11 дней Положительный 20.74 2.461 × 10 4
E33 3 14 дней Отрицательный Нет CT
E34 3 14 дней Отрицательный Нет CT
E35 3 14 дней Негативные Нет CT
E36 3 14 дней Негативные Нет CT
E37 3 14 дней отрицательный нет CT
E38 (отрицательный контроль) 1 14 дней отрицательный Нет CT
E40 (положительный контроль) 4B 14 дней Положительный 20.15 3.689 × 10 4
E41 3 17 дней Отрицательный Нет CT
E42 3 17 дней Отрицательный Нет CT
E43 3 17 дней Негативные Нет CT
E44 3 17 дней Негативные Нет CT
E45 3 17 дней отрицательный нет CT
E46 (отрицательный контроль) 1 17 дней отрицательный Нет CT
E48 (положительный контроль) 4B 17 дней Положительный 18.21 1,395 × 10 5

Обсуждение

[20], которые выделили Salmonella от больных бройлеров в провинции Калубия в Египте с заболеваемостью (7,03%). Серотипирование в этом исследовании выявило присутствие S. typhimurium, S. kentucky и S. enteritidis , видов, которые также присутствовали в текущем исследовании.Кроме того, некоторые авторы, такие как Jafari et al. [21] и Boonmara et al. [22] ранее сообщали об аналогичных уровнях заболеваемости сальмонеллой, которые составляли (5,8%) и (6,65%) соответственно. В предыдущем исследовании, проведенном Mohamed et al. [23], в провинции Кафр-Эльшейк в Египте сальмонелла была выделена из цыплят-бройлеров с частотой (2,5%), и этот процент был ниже, чем в текущем исследовании. Был зарегистрирован более высокий процент выделения сальмонелл, и они были выделены с заболеваемостью (12%).

Бактериофаги в данном исследовании были выделены и приготовлены из сточных вод птицефабрик.Ранее сообщалось о присутствии специфических бактериофагов Salmonella в экскрементах промышленных бройлерных птиц [24]. Тем временем Андреатти Филью и др. [18], выделили бактериофаги из мазков из окружающей среды в коммерческих бройлерных птичниках. В этом исследовании использовались точечные тесты для подтверждения присутствия специфических бактериофагов в препаратах, другие исследования, такие как Rahaman et al. [17] использовали аналогичные стратегии для проверки наличия специфических бактериофагов.Кроме того, наличие бактериофагов во время эксперимента было подтверждено выделением фагов из содержимого слепой кишки цыплят, получавших бактериофаги, аналогичным методом, использованным в предыдущих исследованиях [25,26].

В этом исследовании цыплятам вводили бактериофаги до перорального заражения Salmonella с последующим 4 последовательными курсами лечения фагами после бактериального заражения. Хотя Salmonella все еще были способны колонизировать цыплят, бактериальная нагрузка уменьшилась после четырех последовательных обработок фагом.После 5-й дозы бактерии не обнаруживались, что свидетельствует о том, что цыплята, обработанные фагами, были излечены от Salmonella . Этот эффект, скорее всего, обусловлен литическим действием введенных бактериофагов в отношении Salmonella . Более того, бактериофаги ранее использовались для борьбы с внутриклеточными патогенами [27]. Некоторые бактериофаги могут эффективно снижать колонизацию S. enteritidis у домашней птицы в течение короткого периода времени [18]. В нашем исследовании мы смогли очистить Salmonella от инфицированных цыплят после последовательных обработок фагами, примененных в течение короткого периода времени после заражения.В предыдущем исследовании сообщалось о результатах, аналогичных результатам настоящего исследования, где бактериофаги были указаны как фактор, приводящий к снижению содержания Salmonella КОЕ/г слепой кишки и уменьшению колонизации Salmonella у цыплят-бройлеров после 5 дней лечения [26]. Также сообщалось, что бактериофаги снижают жизнеспособность S. typhimurium в слепой кишке кур на срок до 12 часов после инокуляции [25].

Таким образом, обработка бактериофагами оказывает значительное влияние на снижение колонизации как S.enteritidis и S. typhimurium в слепой кишке цыплят-бройлеров, как ранее было предложено Atterbury et al. [28].

В заключение следует отметить, что возрастающая устойчивость штаммов Salmonella к наиболее часто используемым антибиотикам на бройлерных фермах считается серьезной проблемой, ведущей к высоким экономическим потерям в птицеводстве. Лечение антибиотиками не только убивает патогенные бактерии, но и влияет на нормальную микрофлору, потенциально приводя к вторичным инфекциям.Следовательно, новые методы лечения бактериофагами, как показано в этом исследовании, имеют большие перспективы для лечения бактериальных инфекций в птицеводстве. Фаговая терапия имеет меньше побочных эффектов по сравнению с традиционным лечением антибиотиками из-за специфичности фагов. Наши результаты свидетельствуют о том, что обработка бактериофагом эффективно снижает колонизацию S. typhimurium и S. enteritidis в слепой кишке цыплят-бройлеров в течение короткого периода после перорального введения приготовленного бактериофага.Лечение пятью последовательными дозами было высокоэффективным и устраняло инфекцию Salmonella у новорожденных цыплят, поэтому можно рекомендовать пероральное введение бактериофагов пятью последовательными дозами для снижения нагрузки Salmonella на птицефабриках. Рекомендуются дальнейшие исследования в более широком масштабе для изучения реализации программ введения бактериофагов на птицефабриках в качестве рутинного лечения, фаготипирования и специфичности приготовленного(ых) фага(ов) S.typimurium будет тестироваться на S. enteritidis и наоборот.

Биографии

• 

Нехал Набиль  В 2006 году окончил Университет Мансуры со степенью доктора наук в области бактериологии, микологии и иммунологии в 2015 году; и менеджер по качеству справочной лаборатории ветеринарного контроля качества продукции птицеводства, Научно-исследовательский институт здоровья животных, Гамаса, Дакахлия, Египет.

Марам Тавакол  в 2004 году окончил Университет Мансуры, получив степень доктора наук в области бактериологии, иммунологии и микологии в 2014 году.Она является руководителем отдела биотехнологии в референс-лаборатории по ветеринарному контролю качества птицеводческого научно-исследовательского института здоровья животных, Гамаса, Дакахлия, Египет

Хеба Хассан защитила докторскую диссертацию по бактериологии, микологии и иммунологии в 2014 году. Параллельно с работой в качестве микробиолога она является заместителем отдела анализа остатков и руководителем отдела биобезопасности в референс-лаборатории ветеринарного контроля качества птицы. ,Научно-исследовательский институт здоровья животных, Гиза, Египет.

Заявление о раскрытии информации

Авторы не сообщали о потенциальном конфликте интересов.

Каталожные номера

[1] Berchieri A Jr., Murphy CK, Marston K, et al. Наблюдения за устойчивостью и вертикальной передачей сероваров Salmonella enterica pullorum и gallinarum у цыплят: влияние бактериального фона и генетического фона хозяина. Авиан Патол. 2001. июнь; 30 (3): 221–8. PubMed PMID: 104; англ. [PubMed] [Академия Google][3] Шивапрасад ХЛ. Брюшной тиф и пуллороз птиц.Rev Sci Tech. 2000. 19 августа (2): 405–424. PubMed PMID: 101; англ. [PubMed] [Академия Google][4] Викрам А., Джаяпракаша Г.К., Джесудхасан П.Р. и др. Обакунон подавляет островки патогенности Salmonella 1 и 2 зависимым от envZ способом. Appl Environ Microbiol. 2012. Октябрь; 78 (19): 7012–7022. PubMed PMID: 22843534; Центральный PMCID PubMed: PMCPMC3457478. англ. [Бесплатная статья PMC] [PubMed] [Google Scholar][5] Кнодлер Л.А., Селли Дж., Финли Б.Б. Патогенный обман: обман процессов клетки-хозяина.Nat Rev Mol Cell Biol. 2001. Август; 2 (8): 578–588. PubMed PMID: 11483991; англ. [PubMed] [Академия Google][6] Голкар З., Багасра О., Пейс Д.Г. Терапия бактериофагами: потенциальное решение кризиса устойчивости к антибиотикам. J Infect Dev Cries. 2014. февраль 13;8(2):129–136. PubMed PMID: 24518621; англ. [PubMed] [Академия Google][7] Агада ГОА, Абдуллахи И.О., Амину М. и др. Профиль распространенности и устойчивости к антибиотикам изолятов сальмонеллы от коммерческой птицы и работников птицефабрик в Джосе, штат Плато, Нигерия.Br Microbiol Res J. 2014;4(4):462–479. [Академия Google][8] Хендрикс РВ. Геномика бактериофагов. Curr Opin Microbiol. 2003. Октябрь; 6 (5): 506–511. PubMed PMID: 14572544; англ. [PubMed] [Академия Google][9] Коннертон PL, Коннертон ИФ. Микробная обработка для снижения количества патогенов в мясе птицы В: Mead GC, под ред. Контроль пищевой безопасности в птицеводстве. Издательство Вудхед; 2005. с. 414–432. Доступно по адресу: https://www.elsevier.com/books/food-safety-control-in-the-poultry-industry/mead/978-1-85573-954-3.[Академия Google][10] Икбал А., Хасни С., Рахман С. и др. Приготовление и оценка лизата бактериофага, специфичного для Salmonella typhimurium. Int J Curr Microbiol Appl Sci. 2016;5(1):828–835. [Академия Google][11] Сулаквелидзе А., Алавидзе З., Моррис Дж. Г. мл.. Бактериофаговая терапия. Противомикробные агенты Chemother. 2001. Март; 45 (3): 649–659. PubMed PMID: 11181338; Центральный PMCID PubMed: PMCPMC. англ. [Бесплатная статья PMC] [PubMed] [Google Scholar][12] Синглтон П. Бактерии в биологии, биотехнологии и медицине.Джон Уайли и сыновья, ООО; 1999. с. 4. Доступно по адресу: https://www.wiley.com/en-us/Bacteria+in+Biology%2C+Biotechnology+and+Medicine%2C+6th+Edition-p-97804700

. [Академия Google][13] Ахтар М., Виазис С., Диес-Гонсалес Ф. Выделение, идентификация и характеристика литических бактериофагов с широким кругом хозяев из сточных вод против сероваров Salmonella enterica. Пищевой контроль. 2014. апрель 01;38: 67–74. [Академия Google][14] 6579-1 я Микробиология пищевой цепи – горизонтальный метод обнаружения, подсчета и серотипирования Salmonella – часть 1: обнаружение Salmonella spp.1-е изд. 2017. Доступно по адресу: https://www.iso.org/standard/56712.html . [PubMed] [Академия Google][15] Кауфманн Ф. Серологическая диагностика видов сальмонелл В: Kauffmann, F. Kauffmann-White-Schema. 1972. С. 126. Доступно по адресу: https://www.cabdirect.org/cabdirect/abstract/19732702666. [Академия Google][16] Гримон ПАД, Франсуа-Ксавье В. Антигенные формулы сероваров сальмонелл. 9-е изд. Париж: Сотрудничающий центр ВОЗ по справочной информации и исследованиям сальмонеллы; 2007. [Google Академия][17] Рахаман М.Т., Рахман М., Рахман М.Б. и др.Выделение и характеристика бактериофага, специфичного для сальмонеллы птицы. Бангладеш J Vet Med. 2014;12(2):107–114. [Академия Google][18] Андреатти Филью Р.Л., Хиггинс Дж.П., Хиггинс С.Е. и др. Способность бактериофагов, выделенных из разных источников, уменьшать количество Salmonella enterica serovar enteritidis in vitro и in vivo. Poult Sci. 2007. Сентябрь; 86 (9): 1904–1909. PubMed PMID: 17704377; англ. [PubMed] [Академия Google][19] Daum LT, Barnes WJ, McAvin JC, Neidert MS, Cooper LA Huff WB, Lohman kl. ПЦР-обнаружение сальмонелл в режиме реального времени в подозрительных продуктах питания во время вспышки гастроэнтерита в округе Керр, штат Техас.Дж. Клин Микробиол. 2002;40(8):3050-3052. [Бесплатная статья PMC] [PubMed] [Google Scholar][20] Абд Эль-Гани В., Эль-Шафии С., Хатем М. Исследование видов сальмонелл, выделенных из куриных стад в Египте. Азиатский J Anim Vet Adv. 2012;7(6):489–501. [Академия Google][21] Джафари Р., Горбанпур М., Джайдери А. Исследование статуса инфекции сальмонеллы у домашних кур в Иране. Int J Poult Sci. 2007;6(3):227–229. [Академия Google][22] Бунмар С., Бангтракулнонт А., Порнранангвонг С. и др. Salmonella у цыплят-бройлеров в Таиланде с особым акцентом на загрязнение розничного мяса Salmonella enteritidis.J Vet Med Sci. 1998. Ноябрь; 60 (11): 1233–1236. PubMed PMID: 9853305; англ. [PubMed] [Академия Google][23] Мохамед Л.Н., Самаха Х.А., Драз А.А. и соавт. Сальмонеллы среди птиц и человека. Alex J Vet Sci. 1999;5(1):147–154. [Академия Google][24] Бао Х, Чжан Х, Ван Р. Выделение и характеристика бактериофагов Salmonella enterica serovar pullorum. Poult Sci. 2011. Октябрь; 90 (10): 2370–2377. PubMed PMID: 21
2; англ. [PubMed] [Академия Google][25] Беркьери А. мл., Ловелл М. А., Бэрроу П. А.Активность литических к Salmonella typhimurium бактериофагов в пищеварительном тракте кур. Рез микробиол. 1991. Июнь; 142 (5): 541–549. PubMed PMID: 1947426; англ. [PubMed] [Академия Google][26] Фиорентин Л., Виейра Н.Д., Бариони В. мл.. Пероральное лечение бактериофагами снижает концентрацию Salmonella enteritidis PT4 в содержимом слепой кишки бройлеров. Авиан Патол. 2005. Июнь; 34 (3): 258–263. PubMed PMID: 161; англ. [PubMed] [Академия Google][27] Ан Дж., Ли Х-Й, Бисвас Д. Оценка медиаторов воспаления, индуцированных бактериофагами, в куриных макрофагах HD11, инфицированных Salmonella .Дж. Поулт Научный. 2015;52(3):238–243. [Академия Google][28] Аттербери Р.Дж., Ван Берген М.А.П., Ортис Ф. и др. Бактериофаговая терапия для снижения колонизации сальмонеллой цыплят-бройлеров. Appl Environ Microbiol. 2007. Мая 25 [Поступила 9 января; Принято 16 мая]; 73(14):4543–4549. PubMed PMID: PMC14. [Бесплатная статья PMC] [PubMed] [Google Scholar]

Бактериофаговая терапия для борьбы с бактериальными инфекциями у домашней птицы | Virology Journal

Бактериофаги — группа широко распространенных в природе вирусов, жизненный цикл которых строго связан с бактериальной клеткой.Они известны как бактериальные паразиты, потому что им не хватает клеточной структуры и ферментных систем, необходимых для поглощения пищи, синтеза белка или создания новых частиц, а также потому, что неполные организмы могут размножаться только в живой клетке.

Бактериофаги были открыты Twort (1915) как неопознанные молекулы, подавляющие рост бактерий, но в 1917 году D’Herelle был первым, кто выделил и охарактеризовал фаги, а также разработал первую фаговую терапию против брюшного тифа, вызванного Salmonella Gallinarum. у кур [1].Положительные результаты применения бактериофагов в борьбе с бактериальными инфекциями способствовали развитию исследований по потенциальному использованию вирусов, уничтожающих бактерии, в лечении заболеваний как человека, так и животных [2, 3].

Таксономия бактериофагов и жизненные циклы

Критерий таксономии бактериофагов, применяемый ICTV (Международный комитет по таксономии вирусов, EC 48, Будапешт, Венгрия, август 2016 г.), основан главным образом на типе генома и морфологии вириона.Отчет ICTV, основанный на геномных и протеомных методах, был использован BAVS для классификации фагов на 873 вида, 204 рода и 14 подсемейств в выпуске таксономии 2015 года [4,5,6]. Основная классификация вирусов представлена ​​в таблице 1. Следует подчеркнуть, что подавляющее большинство (около 96%) известных фагов относится к Myoviridae , Podoviridae и Siphoviridae [7, 8].

Таблица 1 Базовая классификация вирусов на основе таксономии вирусов: выпуск EC 48 2016 г., Будапешт, Венгрия, август 2016 г.

Их принципиальной характеристикой является наличие одного типа нуклеиновой кислоты как носителя генетической информации и капсида, построенного из структурных белков.По структуре ДНК фаги можно разделить на три группы: содержащие ДНК в виде двойной спирали, одноцепочечные ДНК и фаги, содержащие РНК. Большинство известных бактериофагов имеют геном, состоящий из двухцепочечной ДНК. По симметрии капсида различают два типа бактериофагов: изометрические (полиэдрические) и спиральные (спиральные).

По оценкам, бактериофаги являются наиболее распространенными формами жизни на Земле. К 2017 г. в базы данных INSDC было депонировано более 25 000 нуклеотидных последовательностей бактериофагов [5, 9].Распространенность бактериофагов является существенным фактором, облегчающим их приобретение и характеристику их пригодности для борьбы с бактериальными инфекциями. Фаги выделяют из всех природных сред, включая сточные воды, отходы жизнедеятельности человека и животных, естественные водоемы, почву, лесной напочвенный покров, продукты питания и другие микроорганизмы [10,11,12].

Репликация бактериофагов во многом аналогична репликации эукариотических вирусов. Оба включают адсорбцию, проникновение, репликацию нуклеиновых кислот, образование вирионов и их высвобождение из клетки-хозяина.Бактериофаги специфически связаны с определенным бактериальным штаммом и проявляют сильную бактерицидную активность в отношении грамположительных и грамотрицательных бактерий. Некоторые фаги проявляют специфическое сродство к отдельным видам бактерий, в то время как другие обладают широким спектром активности. Их специфичность и спектр активности определяется наличием рецепторов, расположенных на поверхности бактериальных клеток, среди которых можно выделить фрагменты ЛПС, фимбрии и другие поверхностные белки [8, 13, 14, 15].

Мы различаем два типа активности в отношении бактериальной клетки: литическая активность, характерная для вирулентных фагов, и лизогенная активность, включающая интеграцию генетического материала бактериофага с бактериальной хромосомой и репликацию в составе бактериальной ДНК, в результате в появлении профага [15].

Литический цикл бактериофагов состоит из адсорбции, которая включает адгезию к бактериальной клетке, и связывание фаговых белков с ранее известными рецепторами на поверхности бактериальной клетки, такими как тейхоевая и липотейхоевая кислоты для грамположительных или ЛПС для грамотрицательных бактерии [14].Фаза проникновения включает разрыв клеточной стенки ферментами бактериофага и проникновение генетического материала в клетку-хозяина. Далее следует фаза затмения, включающая репликацию нуклеиновой кислоты и белков, составляющих структурную часть капсида, при этом репликация бактериальной ДНК ингибируется. Далее следует образование и созревание бактериофага, лизис бактериальной клетки и высвобождение дочерних фагов, способных инфицировать другие клетки [8] (рис.1). Примерами бактериофагов, проходящих литический цикл, являются фаги Т1 и Т4 [16].

Рис. 1

Различные виды бактериофаговой инфекции [8]

Цикл лизогенеза включает прямую интеграцию генетического материала с бактериальной хромосомой, интеграцию с геномом хозяина и образование профага. Репликация бактериофага блокируется, и его геном переходит в латентное состояние. Это состояние может быть прервано спонтанно или в результате активации солнечным светом, УФ-излучением, алкилирующими агентами или некоторыми антибиотиками, такими как митомицин С [8, 11] (рис.1). Примеры бактериофагов с лизогенным циклом включают λ Escherichia coli ; Mu, с активностью против E. coli , Salmonella , Citrobacter и Erwinia ; MM1 S.pneumoniae ; и φ 11 S. aureus [12, 16].

В зависимости от условий окружающей среды и типа бактериальной клетки существует несколько различных путей инфицирования бактериофагами, включая хроническую инфекцию, псевдолизогению и абортивную инфекцию (рис.1). Не все эти циклы заканчиваются гибелью бактериальной клетки и репликацией фаговых частиц. Во многих случаях дочерние вирионы образуются без индукции лизиса бактериальных клеток, поэтому вирусные частицы не высвобождаются за пределы клетки [8, 17, 18].

Бактериофаги для борьбы с патогенами

Наиболее распространенные бактерии, вызывающие пищевые инфекции у людей, включают бактерии родов Salmonella и Campylobacter и E.коли . Согласно отчету EFSA за 2015 г. об устойчивости к антибактериальным препаратам отдельных зоонозных бактерий ( Salmonella и Campylobacter ), индикаторных бактерий ( E. coli и Enterococcus spp.) и других бактерий, выделенных из домашней птицы и из пищевых продуктов. , значительный процент изолятов, представляющих угрозу для человека и животных, устойчивы к имеющимся антибиотикам, отчасти в результате их широкого применения для лечения заболеваний людей и животных.Использование бактериофагов для элиминации патогенов представляется весьма перспективным, тем более что они присутствуют в каждой экосистеме и в количестве 10 31 , что более чем в 10 раз превышает количество охарактеризованных бактерий [11, 19, 20].

Эффективность и безопасность фаготерапии по сравнению с антибиотиками частично обусловлена ​​специфичностью бактериофагов к конкретным бактериям, проявляющейся в способности инфицировать только один вид, серотип или штамм. Этот механизм действия не вызывает разрушения комменсальной кишечной флоры.В процессе лечения происходит саморазмножение бактериофагов, что исключает необходимость их повторного применения. Другим преимуществом фагов является то, что они не могут связываться и размножаться в эукариотических клетках, что вызывает снижение их титра, коррелирующее с заметным уменьшением количества патогенных бактерий, вызывающих данную инфекцию в организме. Не менее важным преимуществом является то, что фаги нетоксичны, поскольку большинство из них состоят в основном из белков и нуклеиновых кислот [21].

Несмотря на многочисленные преимущества, применение фаготерапии существенно ограничено, отчасти потому, что отдельные бактериофаги не могут использоваться для борьбы с инфекциями широкого спектра действия. Во многих случаях необходима комплексная идентификация и характеристика этиологического агента. Более того, не все бактериальные вирусы соответствуют критериям для использования в лечении, особенно лизогенные фаги, которые кодируют гены бактериальных токсинов и тем самым превращают безвредные бактерии в патогенные. Они также могут быть вовлечены в перенос генов лекарственной устойчивости между бактериями.Другим неблагоприятным явлением фаготерапии является то, что фаги могут элиминироваться ретикулоэндотелиальной системой, сокращая время их полужизни в организме и ограничивая эффективность лечения [18, 19, 22].

Более широкое использование лечения бактериофагами определяется их способностью лизировать инфицированные бактерии и мутировать резистентные бактерии, а также высокой специфичностью фагов к определенным бактериям. Огромное количество инфекций у людей вызывается больничными штаммами бактерий с множественной лекарственной устойчивостью и бактериями, которые приобрели устойчивость в естественной среде.Фаготерапия нашла применение при лечении бактериальных инфекций в дерматологии, стоматологии, отоларингологии, офтальмологии, гинекологии, педиатрии, гастроэнтерологии, урологии и пульмонологии [23]. Использование бактериофагов для лечения инфекций у человека имеет высокий уровень успеха (около 85%), особенно в случае смешанных инфекций, вызванных в основном Staphylococcus aureus , Klebsiella , Escherichia coli , Proteus , Pseudomonas , Enterobacter и устойчивые к ванкомицину Enterococci [24, 25].

Применение фагов в биоконтроле и терапевтическом дизайне

Фаговая терапия также является эффективным средством устранения бактериальных инфекций у различных видов животных. Бактериофаги также доказали свою эффективность в лечении болезней домашней птицы. Одной из задач фаготерапии животных является оценка пригодности бактериальных вирусов для борьбы с патогенами, оказывающими важное влияние на продуктивность и здоровье животных. Фаги, используемые в лечении, оказались эффективными в профилактике инфекций и лечении колибактериоза у домашней птицы [26].Положительные результаты с высокой степенью успеха в элиминации возбудителей были также получены в борьбе с инфекциями, вызванными различными серотипами Salmonella у диких птиц, такими как Enteritidis и Typhimurium [27,28,29,30,31,32], а также как кампилобактериоз у домашней птицы, особенно инфекции, вызванные Campylobacter jejuni и C. coli [33]. Эффективность фаготерапии подтверждена также при заражении цыплят-бройлеров анаэробными Clostridium perfringens при течении некротического энтерита [34].

Сальмонеллез

Терапевтическая эффективность фагов определяется их высоким литическим титром, формой и типом применения, периодом применения. Длительное использование фагов у домашней птицы оказалось умеренно эффективным в снижении числа патогенов Salmonella , колонизирующих пищеварительный тракт [27]. Однако, как показано Fiorentin et al. [28], однократное пероральное применение коктейля фагов (CNPSA1, CNPSA3 и CNPSA4) в дозе 10 11 БОЕ снижало встречаемость штаммов Salmonella Enteritidis на 3.5 лог единиц. Авторы подтвердили, что применение однократной дозы суспензии бактериофага с высоким титром высокоэффективно в снижении популяции патогенных бактерий в пищеварительном тракте, в отличие от длительного применения более низкого титра.

Положительный эффект фаготерапии отмечен также при борьбе с горизонтальными инфекциями, вызванными штаммами S. Gallinarum в стадах кур-несушек. Лечение бактериофагами в качестве кормовой добавки цыплят, контактировавших с инфицированными особями, приводило к летальности всего 5% по сравнению с 30% в группе, не получавшей фаготерапию [32].

Эффективность фаготерапии может также зависеть от индивидуальных антибактериальных свойств данного бактериофага и от адаптивных механизмов бактерий. Исследование Andreatti Filho et al. [30] показали, что использование выбранных бактериофагов в коктейле для перорального введения для предотвращения колонизации штаммами S. Enteritidis у домашней птицы было эффективным только в течение короткого времени (около 48 ч) без долгосрочного защитного эффекта, который был отчасти из-за приобретения бактериями устойчивости к бактериофагу.Все виды лечения привели к значительному 6-логарифмическому снижению количества штаммов Salmonella Enteritidis, выделенных из слепой кишки через 24 часа, по сравнению с необработанным контролем, но через 48 часов после лечения значительных различий не наблюдалось.

Представляется перспективным получение широкого спектра литической активности в отношении трех сероваров Salmonella – Enteritidis, Typhimurium и Hadar – у 36-дневных цыплят-бройлеров, у которых отмечено значительное снижение концентрации бактерий после экспериментального заражения этими сероварами на 2–4 логарифмических единицы [29].Авторы предполагают, что коррекция условий лечения может позволить использовать только один или два бактериофага, а не множество. В другом исследовании Ahmadi et al. [35] продемонстрировали 100% эффективность элиминации S . Штаммы Enteritidis из миндалин 33-дневных перепелов, свободных от Salmonella , через 6 ч после перорального применения 100 мл суспензии бактериофага от 10 9 до 10 10 БОЕ мл -1 . Следует отметить, что все птицы получали суспензию бактериофага в течение 3 сут, а лечебный эффект был заметен уже через 6 ч после экспериментального заражения.Авторы также подтвердили, что это лечение имеет профилактический эффект у перепелов, получавших 100 мкл 10 6 БОЕ мл -1 бактериофагов через желудочный зонд в течение 3 дней, один раз в 24 часа, перед пероральным заражением 100 мкл 1,2 × 10 9 КОЕ мл −1 S . Энтеритидис. Значительное предотвращение колонизации с помощью S . Штаммы Enteritidis наблюдались в течение 7 дней со скоростью 20% по сравнению с контролем (100% колонизация).

Другие исследования предполагают, что бактериофаги могут использоваться в комплексном лечении с другими препаратами, о чем свидетельствует значительный (около 80%) синергетический антибактериальный эффект коммерческого перорального пробиотического препарата, применяемого вместе с бактериофаговым «коктейлем» из фагов S2a, S9, и S11 (5,4 × 10 6 БОЕ/0,5 мл/птицу) в возрасте 4, 5 и 6 дней и в возрасте 8, 9 и 10 дней для борьбы с инфекциями S. Typhimurium у бройлеров. Авторы показали, что у цыплят, получавших пробиотик и бактериофаги, было в 10 раз меньше бактерий в подвздошной кишке, слепой кишке, печени и селезенке, чем у цыплят, не подвергавшихся лечению.[31].

В другом исследовании одновременное применение трех фагов (MOI 103) в дозе 10 8 БОЕ/мл/доза в возрасте 6 дней (две суточные дозы) с помощью аэрозольного распыления и пробиотиков, вводимых в возрасте 1 дня с помощью грубого распыления, с последующей пероральной инокуляцией 2,95 × 10 5 КОЕ/мл у семидневных цыплят, снижение заболеваемости Salmonella и кишечной колонизации Salmonella, что привело к полному устранению гибели цыплят-бройлеров, вызванной инфекцией Salmonella Enteritidis [ 36].Аналогичные результаты были получены при ингибировании горизонтальной инфекции Salmonella после применения суспензии бактериофага в количестве 10 5 и 10 БОЕ/г в качестве кормовой добавки для цыплят, зараженных 5 × 10 7  КОЕ бактерий. Различные группы птиц лечили различными титрами бактериофага, содержащегося в кормовой добавке, в течение 21 дня после заражения Salmonella Enteritidis. Эти профилактические мероприятия значительно тормозили размножение возбудителей в пищеварительном тракте цыплят; однако этот эффект наблюдался в основном у цыплят, получавших бактериофаги в концентрациях 10 9 БОЕ/мл, которых сравнивали только с группами положительного контроля [37].Авторы также предполагают наличие горизонтальной передачи штаммов Salmonella Enteritidis, что подтверждается существенным снижением поголовья цыплят, получавших бактериофаги в концентрациях 10 7 и 10 9 БОЕ/г через 1 неделю после обработки в по сравнению с необработанными цыплятами. Однако не было значительного снижения количества Salmonella через две и 3 недели лечения по сравнению с группой положительного контроля.И во многих случаях эффективность фаготерапии следует максимизировать за счет использования высоких титров бактериофагов, чтобы уменьшить колонизацию Salmonella посредством пассивной передачи.

Колибактериоз

Фаготерапия также зарекомендовала себя как эффективное терапевтическое средство для борьбы с патогенными штаммами Escherichia coli , особенно для предотвращения развития колибактериоза, который сначала развивается в дыхательных путях и воздухоносных мешках, а затем принимает форму сепсис, вызывающий значительную смертность домашней птицы.

Фаговые суспензии, наносимые непосредственно на дыхательные пути 3-дневных птиц в диапазоне титров от 10 6 до 10 3 БОЕ для лечения инфекций, вызванных E. coli , существенно снижали уровень смертности до 5% и 25 %, соответственно. Аналогичные результаты были получены после инокуляции суспензии бактериофагов в питьевой воде птиц в возрасте 1 недели (10 3 или 10 4 БОЕ бактериофагов на мл) с последующим заражением воздушного мешка 10 3 КОЕ Э.фаги coli . Смертность снизилась до 25% и 5% соответственно. У цыплят, получавших 10 8 БОЕ смеси E. coli бактериофагов, смертности не наблюдалось [38]. Также было показано, что бактериофаги очень эффективны при лечении сепсиса и менингита у только что вылупившихся и 3-недельных цыплят, инфицированных внутримышечно и внутричерепно штаммом E. coli . Летальность у нелеченных цыплят составила 100%, тогда как внутримышечное введение фага Р в титрах 10 4 и 10 6 БОЕ полностью ликвидировало гибель цыплят в группе леченых птиц.Еще одним положительным эффектом лечения стало отсутствие видимых клинических симптомов. У цыплят, внутричерепно зараженных E. coli , применение более высокой дозы фага в титре 10 8 БОЕ полностью защищало птиц от развития инфекции. Внутримышечное введение (в разные мышцы) фага R в титре 10 6 БОЕ привело к отсутствию заболеваемости и смертности у всех цыплят. Введение более низких доз от 10 4 БОЕ фага после заражения E.coli также обеспечивает значительную защиту, указывая на то, что фаг размножился in vivo. Однако применение фагов в более низких дозах, т.е. 10 2 БОЕ не обеспечивали статистически значимой защиты от инфекции E. coli .

Авторы также продемонстрировали, что бактериофаги, вводимые птицам внутримышечно, обладали способностью проникать через гематоэнцефалический барьер, и подтвердили, что помимо терапевтического эффекта бактериофаги обладают профилактическим эффектом.У 3-недельных птиц эффективная защита от заболеваемости и смертности после внутричерепной инокуляции E. coli была получена только после введения 10 8 БОЕ фага. Только у молодых птиц была получена статистически значимая защита после введения 10 6 БОЕ фага. Применение суспензии за 1-2 дня до экспериментального заражения E. coli цыплят снижало смертность на 70%, а также интенсивность течения инфекции [26].Применение бактериофагов в титрах 10 4 –10 2 БОЕ в виде аэрозоля у цыплят с признаками колибактериоза значительно снизило смертность цыплят и предотвратило инфицирование других птиц. Аэрозольное введение бактериофага SPR02 в титре 10 8 БОЕ/мл в сочетании с заражением 10 4  КОЕ/мл E. coli полностью защищало птиц от инфекции. Когда эти фаги в количестве 10 4 БОЕ/мл смешивали с 10 4 КОЕ/мл E.coli , смертность была значительно снижена до 35% .

Авторы предполагают также, что аналогичные эффекты предотвращения раннего развития колибактериоза у цыплят получают при применении суспензии бактериофага in ovo [39]. Авторы также продемонстрировали, что эффект такого лечения бактериофагами сравним с лечением энрофлоксацином, и предположили, что комбинация лечения энрофлоксацином и бактериофагами может быть эффективной и полезной в борьбе с колибактериозом.

Помимо бактериолитической активности, эффективность бактериофагов также определяется местом и путем введения препарата. Согласно Хаффу и др. [40] бактериофаги следует наносить непосредственно на очаг инфекции, что было подтверждено при лечении инфекций E. coli в воздушных мешках кур. Применение бактериофагов per os с питьевой водой оказалось неэффективным в лечении инфекции и уменьшении клинических симптомов. При введении суспензии непосредственно в воздушный мешок получен эффективный защитный эффект, проявляющийся отсутствием клинических симптомов.Это лечение значительно снижало смертность с 50 до 20% при применении сразу после заражения, но имело небольшую эффективность при введении через 24 или 48 часов после заражения. Внутримышечное введение бактериофагов значительно снижало смертность с 53 до 17%, с 46 до 10% и с 44 до 20% при немедленном введении, через 24 часа или 48 часов после заражения соответственно.

Аналогичный эффект устранения симптомов заболевания при респираторных инфекциях E. coli у домашней птицы был получен у цыплят-бройлеров в возрасте от 10 дней до 2 недель после повторного применения двухфаговой (SPRO2 и DAF6) суспензии в форме аэрозоля после заражения Э.coli путем инъекции 10 4 КОЕ в грудной воздушный мешок. Авторы наблюдали наилучшую общую защиту после обработки аэрозолем с фаговыми титрами 2,6 × 10 8 и 2,35 × 10 9 БОЕ/мл для SPR02 и DAF6 соответственно. Исследование выявило значительное снижение смертности от 20% до 27% по сравнению с цыплятами, не получавшими лечения бактериофагами, но смертность оставалась высокой [40]. При септической форме колибактериоза внутримышечное применение оказалось более эффективным, чем аэрозольное, особенно в начальной фазе сепсиса.В другом исследовании цыплят-бройлеров Huff et al. [41] продемонстрировали профилактический эффект применения суспензии бактериофагов в виде однократной внутримышечной инъекции двух разных бактериофагов (10 9 БОЕ/мл) в сочетании с энрофлоксацином, вводимых с питьевой водой сразу после заражения E. coli . . Смертность значительно снизилась до 15% по сравнению с необработанными птицами, зараженными E. coli (68%). Авторы также продемонстрировали значительный синергетический защитный эффект у цыплят, получавших как бактериофаг, так и энрофлоксацин.Поскольку колибактериоз у домашней птицы развивается в дыхательной системе, некоторые исследования предполагают, что бактериофаги следует применять в аэрозольной форме в качестве профилактической меры за 1–3 дня до предполагаемого заражения, например, при инфекционных заболеваниях. транспорт или перенос в новую среду [42]. Заболеваемость 7-дневных цыплят, получавших фаговый аэрозоль, в первые дни после экспериментального заражения снизилась до менее 10%, а смертность цыплят, не получавших аэрозоль, составила 60%. Исследование Oliveira et al.[43] подтвердили, что высокая заболеваемость и смертность домашней птицы, вызванная колибактериозом, могут быть значительно снижены за счет аэрозольного распыления систем содержания коктейлями бактериофагов и перорального введения бактериофагов. В этом исследовании птицам вводили 1 мл фаговой суспензии с высоким титром 1,0 × 10 9 БОЕ/мл и более низким титром 5,0 × 10 7 БОЕ/мл фагов phi F78E, F258E и F61E. ‘ рот с помощью шприца и путем распыления непосредственно в клюв через распылительную насадку, настроенную на высвобождение 1 мл за каждую разбросанную мелкую каплю.Сразу после введения фага цыплят заражали суспензией патогенной E. coli . Результаты также продемонстрировали защитный эффект бактериофагов против новой колонизации штаммами E.coli в дни после заражения. Исследование подтвердило терапевтическую эффективность одного из фагов, phi F78E, вводимого перорально и с помощью спрея в концентрации 1 × 10 9 БОЕ/мл, что в среднем привело к снижению смертности на 25% и заболеваемости на 41,7%. у кур.

Прямое или аэрозольное введение бактериофагов птице и оценка их терапевтического эффекта были предметом изучения во многих исследовательских центрах. Исследование Эль-Гохари и соавт. [44] продемонстрировали, что обработка подстилки бактериофагом путем распыления 200 мл препарата бактериофага в титре 8 × 10 8 БОЕ/мл на поверхность 3,9 м 2 загонов значительно снижала смертность цыплят-бройлеров-самцов (около 2–3 недели) с колибактериозом, вызванным воздействием E.coli в помете, даже когда птицы подвергались холодовому стрессу, и, кроме того, уменьшали выделение возбудителя среди стада.

Кампилобактериоз

Возможное применение фаготерапии против бактерий Campylobacter может предложить альтернативные средства уничтожения бактерий в пищеварительном тракте птиц. Это относится, в частности, к инфекциям, вызванным Campylobacter jejuni и C. coli , которые составляют 80% бактерий, колонизирующих пищеварительный тракт домашней птицы.Одной из первых попыток использовать бактериальные вирусы против бактерий Campylobacter было исследование Wagenaar et al. [33], в которых колонизация C. jejuni ингибировалась у 10-дневных цыплят и взрослых птиц сначала на 2, а затем на 1 логарифмическую единицу в слепых кишках бройлеров. Цыплята-бройлеры Ross получали фаги перорально через желудочный зонд с 7 по 16 день в различных титрах, варьирующихся от 4 × 10 9 до 2 × 10 10 БОЕ, и подвергались пероральному заражению 1 × 10 5 КОЕ C.jejuni на 10-й день.

Авторы подтвердили, что обработка фагом перед бактериальной стимуляцией не предотвращает, но может отсрочить бактериальную колонизацию. Однако у цыплят, получавших фаги после колонизации C. jejuni , наблюдалось немедленное 3-логарифмическое снижение числа КОЕ. Следует подчеркнуть, что в данном исследовании бактерии не были полностью уничтожены, что является основной проблемой при использовании фаготерапии для элиминации штаммов Campylobacter у птицы [33].

В другом исследовании, проведенном в Ноттингемском университете в Великобритании на 25-дневных цыплятах после введения через зонд бактериофагов СР34 или СР8, выделенных из окружающей среды, против штаммов C. jejuni HPC5 и GIIC8, полученных от птиц и человека в кишечнике инфицированных птиц было получено существенное, но кратковременное снижение количества бактерий, составляющее от 0,5 до 5 логарифмических единиц. Значительное снижение общей численности 90 005 бактерий Campylobacter 90 006 в верхних и нижних отделах пищеварительного тракта и слепой кишке было получено при применении бактериофагов в концентрации 10 7–9 БОЕ [45].Исследование, оценивающее влияние бактериофагов на количество Campylobacter jejuni в слепой кишке цыплят-бройлеров, также подтвердило значительное ( P  < 0,001) снижение общего количества бактерий до значения 10 5,1  КОЕ/ г, по сравнению с цыплятами, которых не лечили бактериофагами (средняя плотность бактерий 10 7 КОЕ/г) [46]. Аналогичное снижение количества бактерий Campylobacter jejuni и Campylobacter coli у инфицированных птиц было получено после применения суспензии бактериофага CP220 в титрах 10 7 и 10 9 БОЕ/мл в течение 5 дней.Снижение бактерий C. jejuni наблюдалось уже через 48 ч после введения фага, в то время как в случае C. coli значительное снижение количества инфицированных птиц было получено после введения суспензии бактериофага с плотностью из 10 9 БОЕ. Следует подчеркнуть, что процент птиц, устойчивых ко второй инфекции Campylobacter , был очень низким и составлял около 2% [47].

Применение суспензии бактериофагов, специфичных для Campylobacter jejuni и C.coli в воде или корме цыплят-бройлеров вызвало значительное снижение почти на 2 log 10 КОЕ/г колонизации обоими видами бактерий. При этом, в отличие от более ранних исследований, бактерицидный эффект фагов сохранялся более 7 дней, что позволяло применять суспензию на каждой стадии производственного цикла [48]. Профилактическое лечение отсрочило, но не предотвратило колонизацию. Уровни C. jejuni первоначально были на 2 логарифмических единицы ниже, чем в контроле, а затем стабилизировались на 1 логарифмическую единицу ниже, чем в контроле.

С другой стороны, использование бактериофагов для предотвращения колонизации Campylobacter spp. бактерий у только что вылупившихся цыплят-бройлеров удалось лишь частично. Введение через зонд суспензии фага с концентрацией от 0,4 до 2 х 10 10 БОЕ/мл фага 71 у 10-дневных цыплят-бройлеров изначально снижало общее количество бактерий, но колонизация патогенами возобновлялась в течение 24 ч. 33]. Процитированные исследования также показали, что устойчивость Campylobacter spp.к отдельным фагам составляла около 4%. По этой причине авторы предлагают создать комбинацию нескольких бактериофагов, специфичных для Campylobacter , которые, как показали исследования in vitro, повышают эффективность фаготерапии [49].

Клостридиоз и листериоз

Фаготерапия показала свою эффективность при заражении цыплят-бройлеров анаэробными Clostridium perfringens , вызывающими некротический энтерит [34]. Бактериальные токсины, продуцируемые этой бактерией, обусловливают генерализацию болезненного процесса, вызывают снижение потребления корма, тормозят рост.Пероральное введение цыплятам разного возраста суспензии коктейля (INT-401) 5 различных фагов C. perfringens (CPAS-7, CPAS-12, CPAS-15, CPAS-16 и CPLV-42) в титры 10 5 БОЕ/мл, с пищей или водой, или с помощью перорального зонда и распыления, приводили к значительному снижению ( P ≤ 0,05) смертности в течение 0–42 дней эксперимента по сравнению с группа необработанных птиц. Эти меры также улучшили прибавку в весе у цыплят. Следует также подчеркнуть, что лечение оказалось более эффективным в снижении смертности, чем инактивированная формалином вакцина, содержащая C.perfringens альфа-токсин. Однако цитируемое исследование подтвердило высокую эффективность бактериофагов в борьбе с некротическим энтеритом у домашней птицы.

Помимо цельных фагов, фаговые ферменты (эндолизины и муреолитические ферменты), включая муреингидролазу, заслуживают особого внимания в качестве дополнительного элемента в борьбе с инфекциями, вызванными C. perfringens . Эти ферменты, связываясь непосредственно с пептидогликанами клеточных стенок грамположительных бактерий, вызывают быстрый лизис этих бактерий, в том числе инфицированных бактериофагами клеток, что ускоряет их разрушение.Одновременное применение препаратов бактериофагов и эндолизинов против грамположительных бактерий типа Clostridium spp. и Listeria monocytogenes , по-видимому, оказывает очень благоприятное воздействие. Это было подтверждено в случае использования бактериофага (ϕ3626) против C. perfringens , у которого спектр лизогенной активности находился на уровне 22%, а литический эффект – 8%. При совместном применении бактериофагов с муреингидролазой литический эффект наблюдался в отношении всех ( n  = 51) тестируемых штаммов C.perfringens [50, 51]. Ввиду того, что бактериофаги элиминируют 90 005 бактерий C. perfringens 90 006 в основном путем лизогенеза, добавление эндолизинов к фаговым препаратам представляется необходимым для продолжения успешного лечения.

Бактерицидная эффективность фагов также была подтверждена при борьбе с инфекциями, вызванными Listeria monocytogenes , которые, как и Campylobacter spp. или Salmonella входит в число зоонозных патогенов, вызывающих пищевое отравление у людей, с высоким уровнем смертности 30%.Нанесение бактериофагов на поверхность готовых к употреблению продуктов из птицы снизило количество бактерий на 2,5 логарифмических единицы в продукте, хранящемся при 30 °C, всего через 5 ч. Более позднее тестирование на Listeria monocytogenes в образцах пищевых продуктов, хранящихся в холодильнике, также дало положительные результаты, поскольку возбудитель не обнаруживался в течение 21 дня или использование смеси бактериофагов на тушах птицы могло полностью устранить L. monocytogenes [52]. , 53]. Из-за риска возникновения инфекций домашней птицы, вызванных L.monocytogenes , а также в связи с их растущей лекарственной устойчивостью и усилиями по ограничению использования антибиотиков международные и американские организации здравоохранения пытаются заменить антибиотики другими препаратами. Это привело к одобрению FDA 18 августа 2006 г. 102-LMP™, суспензии бактериофагов, специфичных для L. monocytogenes , в качестве антибактериального средства против L. monocytogenes . По оценкам, этот продукт успешно уничтожает более 170 штаммов Listeria spp.[54].

Основные препятствия для применения фаготерапии в птицеводстве

Полная сводка по использованию бактериофагов в экспериментальной деятельности на птице представлена ​​в таблице 2. широкое применение бактериофагов для элиминации возбудителей. Одним из основных препятствий для уничтожения бактерий у домашней птицы является то, что для адсорбции отдельных клеток-хозяев необходимо значительное количество фагов [50].Некоторые авторы [38] показали, что применение фагов в более низких дозах, т.е. 10 2 БОЕ не обеспечивали статистически значимой защиты от инфекции E. coli . Более того, профилактическое лечение фаговой терапией не предотвратило колонизацию [48].

Таблица 2. Сводка исследований по фаготерапии при бактериальных инфекциях у домашней птицы

В ряде случаев защитный эффект был получен только у молодых птиц после введения высоких (10 6 БОЕ) доз фага [26].Во многих случаях эффективность фаговой терапии следует максимизировать за счет использования высоких титров бактериофагов для уменьшения колонизации Salmonella путем пассивного затопления. Дополнительным препятствием в использовании фаготерапии является то, что колонизация слепых отростков кур S. enterica серотипов Enteritidis и Typhimurium подавляется только в течение 24–48 часов после обработки фагом. По этой причине представляется необходимым определить оптимальные сроки и доставку бактериофагов в реальных условиях птицеводческой отрасли [37].Важной проблемой фаготерапии является то, что подходят только сильно литические фаги. Проблемой безопасности является потенциальное высвобождение токсичных белков лизирующими бактериями. Известно, что в некоторых случаях лизирующие бактерии внутри пациента выделяют эндотоксины, вызывающие лихорадку, а иногда и токсический шок [55].

Кроме того, использование определенного фага или смесей фагов с в значительной степени неохарактеризованными геномами представляется опасным. Только полная характеристика и скрининг фагов могут исключить те из них, которые кодируют токсичные белки или белки, обеспечивающие умеренное (интегративное) поведение фагов.Важным недостатком с точки зрения безопасности являются иммунные ответы, индуцируемые фагом. Все фаги содержат чужеродные белки, которые могут индуцировать иммунный ответ, потенциально снижая эффективность терапии, или даже вызывать смерть вследствие анафилактического шока [56, 57].

Для повышения безопасности бактериофагов при элиминации возбудителей можно рекомендовать следующее: использование только сильных литических бактериофагов, а не лизогенных фагов, переход на нелизирующие тайлоцины, если становятся проблемой выделяющиеся из бактерий токсичные белки; использование быстрого секвенирования ДНК для характеристики фагов, используемых в терапии; и предварительный скрининг пациентов на гипериммунные реакции на определенный образец фага перед инъекцией, особенно в целых стадах.

Использование бактериофагов для профилактики наиболее распространенных инфекций пищевого происхождения — сальмонеллеза

Сальмонеллез, вызываемый бактерией Salmonella, является наиболее распространенным примером инфекций пищевого происхождения, которые остаются глобальной проблемой общественного здравоохранения: ежегодно регистрируется более 600 миллионов случаев инфицирования и 400 000 смертей. Использование антибиотиков во время вспышек влечет за собой риск резистентности. Ученые из Института Пастера продемонстрировали, что бактериофаги можно использовать в качестве профилактического лечения.

Национальный справочный центр по Escherichia coli , Shigella и Salmonella (CNR, на французском языке) в Институте Пастера ежегодно изолирует примерно 10 000 случаев Salmonella во Франции. Пожилые люди, дети и пациенты с ослабленным иммунитетом наиболее подвержены риску развития тяжелых форм гастроэнтерита, потенциально приводящих к летальному исходу. Антибиотики по-прежнему часто назначают этим пациентам.

Использование антибиотиков во время вспышек может привести к резистентности

Вспышки сальмонеллеза, вызванные распространением зараженных пищевых продуктов (яиц, молока, мяса), могут быстро привести к высоким показателям заражения (224 000 случаев в США в 1994 г. и 25 000 случаев во Франции в 1985 г.).В таких ситуациях одним из возможных вариантов является массовое назначение антибиотиков, хотя это влечет за собой риск селекции устойчивых к антибиотикам штаммов.

Бактериофаги: потенциальное лечение для профилактики инфекций

В настоящее время не существует профилактического лечения (назначаемого для предотвращения инфекции), способного активно бороться с распространением Salmonella . Традиционные рекомендации, как правило, сосредоточены на гигиене и правильном приготовлении пищи. Бактериофаги (вирусы, поражающие бактерии) могут облегчить симптомы сальмонеллеза при введении до начала инфекции.Этот процесс недавно был продемонстрирован в экспериментах, проведенных Лабораторией бактериофагов, бактерий, хозяев под руководством Лорана Дебарбье в Институте Пастера. Более того, из-за своей высокой специфичности бактериофаги нацелены только на определенные бактерии. Следовательно, они не оказывают неблагоприятного воздействия на микробиоту кишечника, что было выявлено в ходе исследования.

Исследование, прокладывающее путь к новым применениям бактериофагов

Это исследование обеспечивает основу для разработки профилактического лечения без серьезных побочных эффектов.Однако это не предел возможностей, предлагаемых бактериофагами: «Наша работа также показала, что бактериофаги, которые все чаще рассматриваются в качестве крайней меры для пациентов, инфицированных множественными антибиотикорезистентными бактериями, также могут быть полезны для профилактики широкомасштабные инфекции» , комментирует Лоран Дебарбье.

 

Другим потенциальным применением может быть введение бактериофагов персоналу, работающему в контакте с животными, потенциально переносящими Salmonella , или лицам, путешествующим в регионах, где заболеваемость сальмонеллезом остается высокой.Для разработки таких приложений в будущем потребуются контролируемые полевые исследования.


Профилактическое введение коктейля из бактериофага безопасно и эффективно для снижения Salmonella enterica Serovar Typhimurium Burden in Vivo , Microbiology Spectrum , 25 августа 2021 г.

Квентин Лами-Бенье a,b , Лоренцо Чаффрингон a,c , Марта Лоуренсо a,d , Рэйфорд Б. Пейн e , Джимми Т. Трин e , Дженнифер A.Шварц и , Александр Сулаквелидзе и , Лоран Дебарбье и

a Кафедра микробиологии Института Пастера, Париж, Франция

b Парижский университет, Париж, Франция

c Университет Сорбонны, INSERM, Centre de Recherche St Antoine, UMRS_938, Париж, Франция

d Университет Сорбонны, Коллеж Докторантура, Париж, Франция

и Intralytix, Inc., Колумбия, Мэриленд, США.

 

 

Оценка предуборочной бактериофаговой терапии для борьбы с сальмонеллой в периферических лимфатических узлах крупного рогатого скота бычьи периферические лимфатические узлы (ЛУ). Первая цель заключалась в том, чтобы определить, можно ли выделить экзогенный фаг из ЛУ после введения.Если выделение было успешным, вторая цель заключалась в том, чтобы определить, может ли фаг в LN эффективно уменьшать

Salmonella. Salmonella Montevideo инокулировали внутрикожно в несколько мест и несколько раз с последующей подкожной доставкой фагового коктейля в виде двух инъекций вокруг каждого из правого и левого предлопаточных и подвздошных ЛУ. По завершении каждого исследования животных подвергали эвтаназии и исследовали подколенные, предлопаточные и подвздошные ЛУ. Инокулированный фаг был успешно выделен из ЛУ; Просвечивающая электронная микроскопия выявила фаги в ЛУ обработанного крупного рогатого скота, и эти фаги были идентичны фагам в коктейле.Уровни фага были выше ( P <0,01) в предлопаточных и подвздошных ЛУ у обработанных фагом животных, чем у контрольного крупного рогатого скота. В последующих исследованиях протоколы были изменены для увеличения уровней Salmonella и фагов в ЛУ. По сравнению с первым исследованием общие уровни Salmonella были повышены в ЛУ, а обработка фагом снизилась ( P <0,01) Salmonella в некоторых ЛУ. Уровни фага были численно, но незначительно увеличены ( P = 0.12) у леченого крупного рогатого скота. Окончательное исследование было изменено, предполагая, что 48-часовой посмертный период до удаления ВН будет способствовать взаимодействию фага с сальмонеллой ; тем не менее, не было обнаружено различий ( P > 0,10) в уровнях Salmonella между видами лечения. Salmonella- специфические фаги, вводимые живому крупному рогатому скоту, могут транслоцироваться в ЛУ; однако эти фаги не оказали влияния на Salmonella в этих ЛУ в этих экспериментальных условиях.

Инкапсулирование коктейля бактериофагов в хитозан для лечения бактериальной диареи

Материалы

Для микробиологических испытаний шоколадный агар и кровяной агар были приобретены у Merck, Германия. Технику Кирби-Бауэра выполняли с использованием дисков с антибиотиками и всех дисков, включая колистин (10 мкг), ампициллин (10 мкг), нитрофурантоин (300 мкг), тетрациклин (30 мкг), меропенем (10 мкг), цефотаксим (30 мкг), гентамицин (10 мкг), цефиксим (30 мкг) и ципрофлоксацин (10 мкг) были приобретены в Падтантебе, Иран.Для выделения и характеристики бактериофага использовали растворы Луриа-Бертани (Quelab, США), агарозу (ACROS, Бельгия), ацетат аммония (ACROS, Бельгия) и уранилацетат (ACROS, Бельгия). Для приготовления инкапсуляции коктейля бактериофагов в хитозан триполифосфат натрия (STPP), гелеобразование, уксусную кислоту и хитозан были получены от Merck, Германия. Salmonella enterica ATCC № 13076, Shigella flexneri ATCC № 12022 и E. coli ATCC №35218 были приобретены в Институте Пастера, Иран.

Подготовка штаммов бактерий

Salmonella enterica ATCC № 13076, Shigella flexneri ATCC № 12022 и E. coli ATCC № 35217 культивировали на шоколаде и агаре и крови в кубе в течение 24 ч. Чувствительность вышеуказанных бактерий к антибиотикам определяли с помощью теста Кирби-Бауэра с дисками с антибиотиками, а именно ампициллином (10 мкг), нитрофурантоином (300 мкг), тетрациклином (30 мкг), меропенемом (10 мкг), цефотаксимом (30 мкг). , гентамицин (10 мкг), цефиксим (30 мкг) и ципрофлоксацин (10 мкг).В соответствии с рекомендациями Института клинических и лабораторных стандартов (CLSI) минимальную концентрацию ингибитора колистина (МИК) определяли при макроразведении. На основании руководства CLSI МИК для колистина составляли: восприимчивость ≤ 2 и резистентность > 2 мг/л) 18 .

Выделение бактериофага

Образец сточных вод (200 мл) был взят из сточных вод в педиатрической больнице Бу Али Сина третьего уровня в Сари, провинция Мазандаран, Иран. Образец доставляли в лабораторию и хранили при 4 °C.К пробе сточных вод добавляли равный объем бульона 2X LB (Quelab, США). Штаммы Salmonella enterica АТСС № 13076, Shigella flexneri АТСС № 12022 и штаммов E. coli АТСС № 35218 культивировали по отдельности в течение ночи, затем образцы инкубировали в течение 24 ч при 37 °C в шейкере-инкубаторе . 8,9 . Через 24 часа три образца центрифугировали при 11 000 ×  g в течение 15 минут. Супернатанты (бактериофаги) фильтровали через шприцевой фильтр 0,22 мкм в стерильных условиях и при комнатной температуре (24 °C).Отфильтрованные образцы смешивали (фаговый коктейль) и затем хранили при 4 °C до тех пор, пока они не понадобятся для дальнейшего анализа 8,9 .

Анализ двухслойного агара (DLA) и обогащение фагового коктейля

Буфер хлорида натрия-сульфата магния (100 ммоль/л NaCl, 8 ммоль/л MgSO 4 , 2% желатина и 50 ммоль/л Трис-HCl [рН 7,5]) стерилизовали в автоклаве. Затем по 900 мкл этого стерилизованного раствора добавляли в 10 стерильных пробирок (пробирки с номерами 1–10). Фаговый коктейль (100 мкл), хранившийся при 4°C, добавляли в пробирку № 1.1 и вортексированный. После встряхивания 100 мкл из пробирки №. 1 вынули и добавили в пробирку № 1. 2. Эта процедура систематически повторялась до тех пор, пока пробирка № 8. Трубка №. 9 и номер трубки. 10 были отобраны и помечены как положительный и отрицательный контроль соответственно. Из каждого разведенного фагового коктейля 200 мкл переносили в 200 мкл E. coli (1,5 × 10 8 КОЕ/мл). Смеси добавляли к верхнему агару (0,8% агара), затем добавляли верхний агар к нижнему агару (1% агара), затем инкубировали в течение ночи при 37 °C.Зубообразующую единицу (БОЕ) рассчитывали на миллилитр путем определения числа бляшек × 10 × , обратного коэффициенту разбавления 8,9 .

Образовавшиеся бляшки инокулировали в 100 мл Luria-Bertani (Quelab, США), содержащей E.coli (1,5 × 10 8 КОЕ/мл) в течение 24 ч при 37°С в шейкерном инкубаторе. Затем образец центрифугировали при 11 000 ×  g в течение 15 мин. Супернатант фильтровали с использованием шприцевого фильтра 0,22 мкм в стерильных условиях и при комнатной температуре (24 °C).Описанный выше эксперимент был повторен трижды 8,9 . Вышеупомянутый эксперимент был проведен для Salmonella enterica и Shigella flexneri отдельно.

Трансмиссионная электронная микроскопия (ПЭМ)

Для подготовки фага к ПЭМ фаговый коктейль центрифугировали при 25 000 ×  g в течение 60 мин. Полученный фаговый коктейль промывали 0,1 М нейтральным ацетатом аммония. Затем смесь фагов наносили на медную сетку с углеродным покрытием и окрашивали 2% уранилацетатом (pH 4–4.5). Фаговый коктейль затем наблюдали на Zeiss EM 900 TEM при 100 кВ 8,9 .

Определение диапазона хозяев фагового коктейля

Для определения литической активности фагового коктейля был проведен точечный тест. Культивированные в течение ночи Salmonella enterica , Shigella flexneri и E. coli инокулировали в верхний агар и выливали в нижний агар. Определенный объем супернатанта фагового коктейля (50 мкл) выливали на затвердевший агар.Планшеты инкубировали в течение 24 часов при 37 °C. Проверяли формирование зоны ингибирования. Опыт повторяли трижды 8,9 .

Стабильность фаговых коктейлей in vitro

Стабильность фаговых коктейлей исследовали при различных условиях окружающей среды, таких как температура и рН. Фаговый коктейль инкубировали при 4, 22, 37 и 50 °C в течение 60 минут для определения термостабильности. Стабильность фагового коктейля определяли при рН 3, 5, 7, 9 и 11 в течение 60 мин.Литическая активность фагового коктейля определялась анализом с двойным слоем агара (DLA), который был описан ранее. Опыты повторяли трижды 19 .

Стратегия удаления эндотоксина из супернатанта фагового коктейля

Супернатант фага переносили в стерильную и свободную от гноеродных веществ бутылку. К супернатанту фага добавляли 3% (об./об.) Triton X-100 и инкубировали в течение 30 мин при комнатной температуре (25 °C) при встряхивании при 200 об/мин. Для удаления Triton X-100 добавляли 12% активированный уголь с последующей инкубацией в течение 30 минут при комнатной температуре (25 °C) при встряхивании (200 об/мин).Затем раствор центрифугировали при 10 000 ×  g в течение 10 мин. Полученный супернатант пропускали через мембрану 0,45 мкм для удаления остаточного активированного угля. Затем очищенный фаговый раствор хранили в течение ночи при 4 °C, и на следующий день определяли титр фага 20 .

Limulus amebocyte lysate (LAL) test

Для оценки удаления эндотоксина из фагового супернатанта был проведен LAL тест на основе реакции свертывания согласно протокольному набору (ENDOSAFE, США) с эффективностью 0.06 EU/мл и 5 EU/мл предел эндотоксина. Escherichia coli 055: В5 использовали в качестве положительного контроля. Образцы инкубировали на водяной бане в течение 1 часа при 37 °C 20 . Опыты повторялись трижды.

Получение наночастиц хитозана (ХН-НЧ)

ХН-НЧ готовили с водным раствором триполифосфата натрия (STPP) с использованием метода ионного гелеобразования. В водном растворе уксусной кислоты (1%, вес/объем) растворяли 500 мг хитозана до концентрации 5 мг/мл.При магнитном перемешивании (150 об/мин) при комнатной температуре (25°С) водный раствор СТПП ​​по каплям наносили на 100 мл раствора хитозана. CS-NP образовывались спонтанно при введении раствора STPP во время перемешивания. Для получения загруженных фагом CS-NP (фаг-CS-NP) к раствору хитозана добавляли 0,1 мл раствора фага (63 × 10 10 БОЕ/мл). Различные переменные процесса (скорость перемешивания и pH) и факторы состава (весовое соотношение STPP и хитозана), влияющие на свойства наночастиц, были исследованы на предмет их влияния на размер частиц и эффективность захвата лекарственного средства 21 .

Эффективность захвата (EE%)

Для определения EE% НЧ CS-фага (НЧ CS-нагруженных фагом) подвергали центрифугированию при 19 980 ×  г в течение 30 мин (SIGMA; 3–30 КС: Германия ), с последующей фильтрацией супернатанта (размер пор 0,22 мкм). Количество фага в отфильтрованном растворе (незахваченного или свободного лекарственного средства) затем рассчитывали с использованием уравнения с помощью анализа DLA 21 .

$$EE\% = \frac{Общее\;количество\;наркотика — количество\;незахваченного\;наркотика}{{Общее\;количество\;наркотика}} \times 100 $$

(1)

Исследование высвобождения лекарственного средства in vitro

Эксперимент по высвобождению лекарственного средства in vitro для фага из простого раствора и загруженных фагом наночастиц (CS-NP) проводили в соответствии с протоколом, описанным Chen et al.(2009 г.) с некоторой переделкой 21 . Высвобождение in vitro раствора фага и оптимизированных CS-NP оценивали при pH 1,2 и pH 6,8, чтобы имитировать состояние pH желудочно-кишечного тракта. Эксперимент по высвобождению оценивали методом мембранного диализа при температуре 37 °C. Вкратце, раствор фага и нагруженные фагом CS-NP помещали в мешок для диализа (MWCO 12 кДа) и суспендировали в 900 мл с pH 1,2 на срок до 3 часов. Среду растворения поддерживали при температуре 37±0,5°C в химическом стакане при скорости перемешивания 100 об/мин.Образцы (1 мл) собирали в заранее определенные моменты времени 0,5, 1, 2 и 3 ч при pH 1,2 и сразу же заполняли свежей (1 мл) средой. Затем среду с рН 1,2 заменяли на среду с рН 6,8, и анализ продолжали еще в течение 3 часов. Образцы (1 мл) собирали в те же заранее определенные моменты времени и повторно заполняли соответствующей свежей (1 мл, pH 6,8) средой. Затем рассчитывали концентрацию фага с использованием анализа DLA 21 .

Характеристика CS-NP

Динамическое рассеяние света (DLS) через устройство Zetasizer Nano ZS (Malvern Instruments Worcestershire: UK) под углом 90° при 25 °C использовали для определения диаметра и индекса полидисперсности (PDI) и размер полученных наночастиц 22 .Лазерный доплеровский электрофорез использовали для измерения дзета-потенциала наночастиц.

Экспериментальная модель

Девяносто шесть самок крыс линии Вистар (возраст 8 недель, вес 180 ± 200 г) содержали в клетках в контролируемых условиях освещения, комнатной температуры и влажности в течение недели перед исследованием. Это исследование было одобрено этическим комитетом Мазандаранского университета медицинских наук, Сари, Иран (IR. MAZUMS.REC.1399.1333). Крыс взвешивали в день начала эксперимента.Перед началом эксперимента их лишали пищи на 24 ч. Желудочно-кишечная инфекция была вызвана использованием 0,5 мл суспензии Salmonella enterica , Shigella flexneri и E. coli (1,5 × 10 8 КОЕ/мл). Через 48 ч крыс разделили на четыре основные группы по 8 крыс в каждой (рис. 1). Здесь 0,5 мл фагового коктейля (10 10 БОЕ/мл) вводили перорально ежедневно. Такой же объем (0,5 мл) использовали в группе, принимавшей наночастицы хитозана.В группе положительного контроля крысам ежедневно вводили цефиксим через зонд в дозе 100/5 мг/кг, а в последней группе не применяли никакого лечения.

Рисунок 1

Крыс заражали 0,5 мл бактерий (1,5 × 10 8 КОЕ/мл). Они были разделены на 4 основные группы (N = 8).

Для оценки влияния состава на лечение желудочно-кишечной инфекции крыс взвешивали на 2-й, 4-й, 6-й и 8-й день. Образцы стула культивировали и подсчитывали на кровяном агаре, агаре МакКонки и селективной среде, такой как ксилозо-лизин-дезоксихолатный агар (XLD), агар Salmonella Shigella (SS) и энтеросолюбильный агар Hecktoen в одни и те же дни (2-й, 4-й, 6-й и 8-й день). .Положительные культуры определяли с помощью дифференциальных микробных тестов, таких как тест на каталазу, тест на оксидазу, тест TSI, тест на цитратный агар Симмонса и тест с метиловым красным / Voges-Proskauer (MR / VP) 23 . Исследование сообщается в соответствии с рекомендациями ARRIVE.

Добавить комментарий

Ваш адрес email не будет опубликован.

*