Сш1 лида: Sorry, this page can’t be found.

Содержание

Адвокаты города Лида — список лучших адвокатов по уголовным, гражданским, семейным делам. Бесплатная помощь, консультация. Рейтинг адвокатов.

Вы искали:

Нашлось 17 человек(а)

Страна проживания: Беларусь
Город: Лида
Место работы: ОАО «Лидастройматериалы»
Лида 2004
Ведущий юрисконсульт
Место работы: ИП по оказанию юридических услуг
Лида 2014
аттестованный юрист
Место работы: Лида 2019
Адвокат
Родом из города: Лида
Дата рождения: 6 апреля
Высшее образование:
Вуз: БГЭУ (бывш. БГИНХ) , 2007 , Выпускник (магистр)
Факультет: Высшая школа управления и бизнеса
Кафедра: Кафедра экономики и управления
Вуз: МГЭИ (бывш. ГЭНИ) , 2004 , Выпускник (специалист)
Факультет: Юридический
Кафедра: Правоведение
Среднее образование:
Школа: № 8 , 1992 Лида
1984 — 1992 (ж)
Телефон:
Текущая деятельность: Адвокатура

Адрес страницы: https://vk.com/id102034864

Страна проживания: Беларусь
Город: Лида
Место работы: ООО БПЛЭлектро
Лида 2017
Специалист по работе с клиентами
Место работы: ООО ГедеминТур
Лида 2013 — 2017
Юрист
Место работы: ОДО Первая юридическая компания
Лида 2012 — 2013
Юрист
Место работы: СШ 1
Лида 2005 — 2012
Родом из города: Лида
Дата рождения: 6 апреля 1986
Высшее образование:
Вуз: ГГУ им. Ф. Скорины , Выпускница (специалист)
Факультет: Юридический факультет
Кафедра: Кафедра уголовного права и процесса
Среднее образование:
Школа: Школа №1 Лида
Школа: Лидский колледж ГрГУ им. Янки Купалы Лида
Телефон:
Текущая деятельность: ГГУ им. Ф. Скорины

Адрес страницы: https://vk.com/id330260940

Страна проживания: Беларусь
Город: Лида
Место работы: евроварштат
Лида 2013
Юрист
Родом из города:
Дата рождения: 22 мая 1988
Высшее образование:
Вуз: БИП , 2013 , Заочное отделение , Студент (специалист)
Факультет: Международного права и юридической психологии
Кафедра: Философии, политологии и психологии
Среднее образование:

Школа: Дворищанская школа , 2006 — 2006
Телефон:
Текущая деятельность: евроварштат

Адрес страницы: https://vk.com/id142105330

Страна проживания: Беларусь
Город: Лида
Место работы: ОАО «Дитва»
2008
Юрист
Родом из города: Лида
Дата рождения: 8 октября 1990
Среднее образование:
Школа: Лидский колледж ГрГУ им. Янки Купалы Лида
2008 (п 3)
юрист
Телефон:
Текущая деятельность:
ОАО «Дитва»

Адрес страницы: https://vk.com/id61764563

Страна проживания: Беларусь
Город: Лида
Место работы:
юрист
Родом из города: Лида
Высшее образование:
Вуз: Академия МВД РБ , 2008 , Выпускница (специалист)
Факультет: Права
Среднее образование:
Школа: Школа №5 , 2002 Лида
1991 — 2002
Телефон:
Текущая деятельность: Академия МВД РБ

Адрес страницы: https://vk.com/id85664468

Страна проживания:
Беларусь
Город: Лида
Место работы:
юрист
Родом из города: Лида
Дата рождения: 25 января 1980
Высшее образование:
Вуз: ГрГУ им. Янки Купалы , 2005 , Заочное отделение , Выпускница (специалист)
Факультет: Юридический факультет
Кафедра: Уголовного права и криминалистики
Среднее образование:
Школа: Школа №6 Лида
1986 — 1996 (в)
Текущая деятельность: ГрГУ им. Янки Купалы

Адрес страницы: https://vk.com/id35291955

Страна проживания: Беларусь
Город: Лида
Место работы:

юрист
Родом из города: Лида
Дата рождения: 6 октября 1990
Высшее образование:
Вуз: ГрГУ им. Янки Купалы
Факультет: Юридический факультет
Среднее образование:
Школа: Школа №8 , 2009 Гродно
Текущая деятельность: ГрГУ им. Янки Купалы

Адрес страницы: https://vk.com/id40961395

Страна проживания: Беларусь
Город: Лида
Место работы:
юрист
Дата рождения: 15 августа 1983
Телефон:
Текущая деятельность: ИП по оказанию юридических услуг

Адрес страницы: https://vk.com/id207750602

Страна проживания:
Беларусь
Город: Лида
Место работы:
юрист
Дата рождения: 4 января 1981
Телефон: +375-154…
Текущая деятельность: Академия управления при Президенте РБ

Адрес страницы: https://vk.com/id10127142

Страна проживания: Беларусь
Город: Лида
Место работы:
юрист
Дата рождения: 12 ноября 1987
Skype: rockfellerrr
Текущая деятельность: Гель-лак, маникюр, педикюр, макияж, брови, шугар

Адрес страницы: https://vk.com/id21534266

Мартинович Екатерина Петровна
8 класс
Гимназия 10 г. Гродно Ермакова Анна Николаевна 40/40
Минчук Вадим Владимирович 8 класс СШ 19 г. Гродно Копоть Светлана Дмитриевна 36/40
Бударин Ростислав Дмитриевич 8 класс Гимназия №10 г.Минска Белкина Елена Петровна 32/40
Дорош Владислав Дмитриевич 8 класс Гимназия №1 г. Новогрудка Вайтович Наталия Михайловна 32/40
Колодко Александра Сергеевна 8 класс Гимназия №1 г.Новогрудок Вайтович Наталья Михайловна 32/40
Лычиц Ксения Семеновна 8 класс Гимназия№1 г.Новогрудок Вайтович Наталья Михайловна 32/40
Нестерова Полина Валерьевна 8 класс Дубненская СШ Биркос Елена владимировна 32/40
Олехнович Яна Евгеньевна 8 класс Гимназия 192г.Минска Сушкевич Зоя Александровна 32/40
Посунько Юлия Леонидовна 8 класс Дубненская СШ Биркос Елена Владимировна 32/40
Сторожук Владислав Васильевич 8 класс СШ №7 г. Волковыска Матяс Оксана Сигизмундовна 32/40
Филиппович Мария Руслановна 8 класс гимназия №2 г. Минск Кочерго Елена Николаевна 32/40
Шумель Владислав Иосифович 8 класс Гимназия №6 г.Гродно Яговдик Светлана Константиновна 32/40
Борисевич Анастасия Павловна 8 класс Гимназия №192 г.Минска Сушкевич Зоя Александровна 28/40
Видевич Дарья Ивановна 8 класс Гравжишковский УПК Лыскойть Ирина Болеславовна 28/40
Вилькель Ангелина Ивановна 8 класс ГУО «Больтишская базовая школа» Шостко Елена Зигмундовна 28/40
Гринцевич Михаил Олегович 8 класс Гимназия №1 г.Новогрудка Вайтович Наталья Михайлова 28/40
Дудевич Валерия Александровна 8 класс ГУО «Больтишская базовая школа» Шостко Елена Зигмундовна 28/40
Екимова Мария Денисовна 8 класс Гимназия 3 г.Гродно Разумов Евгений Владимирович 28/40
Загдай Полина Сергеевна 8 класс Гимназия №1 г.Дятлово Урбанович Анна Станиславовна 28/40
Карасевич Даниил Юрьевич 8 класс СШ №5 г. Сморгонь Катайкина Екатерина Фёдоровна 28/40
Кичёва Дарья Николаевна 8 класс Государственное учреждение образования «Бабиничская средняя школа Витебского района» Лукашевич Наталья Александровна 28/40
Константинов Николай Андреевич 8 класс СШ №44 г.Минск Константинова Вера Константиновна 28/40
Кучко Максим Дмитриевич 8 класс СШ №5 г. Сморгонь Катайкина Екатерина Фёдоровна 28/40
Марковский Дмитрий Андреевич 8 класс СШ №17 г.Бреста Брегер Светлана Александровна 28/40
Миндюль Виктория Викторовна 8 класс ГУО «Больтишская базовая школа» Шостко Елена Зигмундовна 28/40
Ничипор Егор Витальевич 8 класс США N3 г.Волковыска Жукова Татьяна Ивановна 28/40
Светлана Салманович Ивановна 8 класс ГУО «Вороновская СШ» Дойлидко Данута Зеноновна 28/40
Сергиевич Дарья Павловна 8 класс СШ №1 г.Берёзовка Илюкович Ирина Викторовна 28/40
Сорока Елизавета Юрьевна 8 класс Гимназия №1 г.Дятлово Урбанович Анна Станиславовна 28/40
Шевчук Илья Михайлович 8 класс Можейковский детский сад — средняя школа Ярмантович Валентина Станиславовна 28/40
Шилина Елена Александровна 8 класс Государственное учреждение образования «Бабиничская средняя школа Витебского района» Лукашевич Наталья Александровна 28/40
Щербо Владислав Геннадьевич 8 класс Можейковский детский сад — средняя школа Ярмантович Валентина Станиславовна 28/40
Яськевич Никита Иванович 8 класс СШ №5 г.Сморгонь Катайкина Екатерина Фёдоровна 28/40
Алфёрова Анастасия Александровна 8 класс сш№148 г.Минска Прибытко Ольга Васильевна 24/40
Арабчик Валера Геннадьевич 8 класс Гимназия №1 Г.Новогрудка Войтович Наталья Михайловна 24/40
Винярская Юлия Сергеевна 8 класс СШ №5 г.Сморгони Катайкина Екатерина Федоровна 24/40
Вишневский Владислав Романович 8 класс СШ№172 г.Минск Даниленко Светлана Анатольевна 24/40
Войтюшкевич Владислав Викторович 8 класс Можейковский детский сад — средняя школа Ярмантович Валентина Станиславовна 24/40
Дудко Маргарита Викторовна 8 класс СШ №5, г.Сморгонь Катайкина Екатерина Фёдоровна 24/40
Дужик Ульяна Сергеевна 8 класс Гимназия №1 г. Мосты Бодак Галина Иосифовна 24/40
Жданько Владислав Игоревич 8 класс СШ №144 г.Минск Зейфман Инесса Семёновна 24/40
Жемойтин Дарья Витальевна 8 класс Сш 5, г. Сморгонь, Гродненская область Катайкина Екатерина Фёдоровна 24/40
Журская Полина Александровна 8 класс СШ №3 г. Дятлово Гецевич Инесса Ивановна 24/40
Калиневич Дарья Юрьевна 8 класс СШ 126 г.Минск Другаль Татьяна Владимировна 24/40
Кирдун Ксения Андреевна 8 класс Дарагановский УПК Фоломеева Наталья Ивановна 24/40
Конопелько Арсений Дмитриевич 8 класс гимназия 50 г.Минска Китунович Элеонора Станиславовна 24/40
Лопато Дарья Павловна 8 класс Гимназия №1 г.Новгрудка Вайтович Наталья Михайловна 24/40
Малышко Александр Викторович 8 класс СШ №32 г.Гродно Пшерезинская Галина Чеславовна 24/40
Меленяко Кирилл Андреевич 8 класс СШ 144 Зейфман Иннеса Семёновна 24/40
Михед Ангелина Сергеевна 8 класс Государственное учреждение образования «Бабиничская средняя школа Витебского района» Лукашевич Наталья Александровна 24/40
Орсич Елизавета Сергеевна 8 класс СШ №9 г.Слоним Глубокая Ольга Дмитриевна 24/40
Плытник Антон Витальевич 8 класс СШ №5 Г.Мосты ЧЕРНЯВСКАЯ ВЕРОНИКА ВЛАДИМИРОВНА 24/40
Свитюк Виолетта Михайловна 8 класс Гимназия 5 город Брест Войтюк Наталья Викторовна 24/40
Харланова Яна Алексеевна 8 класс СШ №144 Зейфман Иннеса Семёновна 24/40
Янушкевич Артем Казимирович 8 класс СШ 3, г.Волковыск Данилович Елена Леонидовна 24/40
Yukhnevich Andrian Alexander 8 класс СШ №148 г.Минск Прибытко Ольга Васильевна 20/40
Бегаль Владислав Петрович 8 класс СШ №17 г.Брест Брегер Светлана Александровна 20/40
Борейша Яна Владимировна 8 класс Сш №2 г.Берёзовки Яхимович Татьяна Владимировна 20/40
Вегера Максим Романович 8 класс СШ №17 г.Бреста Брегер Светлана Александровна 20/40
Калиновская Ольга Андреевна 8 класс СШ №2 г.Волковыск Новик Жанна Георгиевна 20/40
Коровайская Карина Леонидовна 8 класс СШ №2 г.Березовка Яхимович Татьяна Владимировна 20/40
Ксёнжик Максим Иванович 8 класс Начевская СШ, Ляховичский район, Брестская обл. Жданюк Елена Александровна 20/40
курилюк анастасия сергеевна 8 класс сш №17 г.брест брегер светлана александровна 20/40
Махнач Игорь Владимирович 8 класс Гимназия 25 г.Минск Вареник Виталий Михайлович 20/40
Миронова Анастасия Михайловна 8 класс СШ №12 г.Орша Артиховская Светлана Николаевна 20/40
Могилевец Денис Эдуардович 8 класс Гимназия №1 им. акад. Е.Ф. Карского г. Гродно Курчевская Тереса Юльяновна 20/40
Назаров Александр Станиславович 8 класс СШ №19 г.Витебск Михальченко Ольга Александровна 20/40
Пармоник Валентина Владимировна 8 класс СШ №2 г.Волковыск Новик Жанна Георгиевна 20/40
Пресный Алексей Михайлович 8 класс ПЕТРЕВИЧСКАЯ Сш Пецевич Елена Владимировна 20/40
Сапон Илья Владимирович 8 класс Жупранская СШ Шукелович Светлана Ивановна 20/40
Титов Артём Алексеевич 8 класс Гимназия №1 г.Дятлово Урбанович Анна Станиславовна 20/40
Тихонова Софья Викторовна 8 класс СШ№2 г.Полоцк Велюга Наталья Сергеевна 20/40
Туцкая Татьяна Андреевна 8 класс Гимназия 5 г. Бреста Войтюк Наталья Викторовна 20/40
Федорук Елисей Александрович 8 класс Одржинская СШ Гукова Екатерина Сергеевна 20/40
Хабовец Давид Леонидович 8 класс СШ №17 г. Бреста Брегер Светлана Александровна 20/40
Шуляк Даниил Константинович 8 класс Гимназия №1 г.Дятлово Урбанович Анна Станиславовна 20/40
Щегляк Станислав Петрович 8 класс Гимназия №2 г.Минска Кочерго Елена Николаевна 20/40
Овакимян Рената Александровна 8 класс ГУО Средняя школа 2 г.Берёзовки Яхимович Татьяна Владимировна 16/40
Антонова Лидия Сергеевна 8 класс СШ №191 г.Минска Францкевич Вера Петровна 16/40
Байда Станислав Александрович 8 класс ГУО «СШ 186 г.Минска» Тарорико Мария Алексеевна 16/40
Бояровская Анастасия Юрьевна 8 класс Петревичская СШ Пецевич Елена Владимировна 16/40
Войшнис Глеб Викторович 8 класс сш №18 г.Гродно Козловская Нина Ивановна 16/40
Гладков Артём Дмитревич 8 класс СШ № 172 г.Минск Даниленко Светлана Анатольевна 16/40
Дзядович Полина Олеговна 8 класс СШ №172 г. Минска Даниленко Светлана Анатольевна 16/40
Журская Ангелина Александровна 8 класс сш №3 г Дятлово Гецевич Инесса Ивановна 16/40
Лукашевич Яна Витальевна 8 класс Вороновская СШ Дайлидко Данута Зеноновна 16/40
Лысенко Михаил Андреевич 8 класс Петревичская СШ Пецевич Елена Владимировна 16/40
Маленовская Маргарита Юрьевна 8 класс Беняконская средняя школа Кристынович Вадим Александрович 16/40
Матейко Анастасия Александровна 8 класс СШ №18 г.Гродно Козловская Нина Ивановна 16/40
Панасик Владислав Александрович 8 класс СШ №3 г. Зельва Жамойтина Ирина Антоновна 16/40
Подставленко Дмитрий Витальевич 8 класс СШ №23 г.Витебска Осипова Лариса Михайловна 16/40
Пчельник Елизавета Юрьевна 8 класс Гимназия №1 г.Дятлово Урбанович Анна Станиславовна 16/40
Рокало Юлия Александровна 8 класс Костенёвкая БШ Петрашко Анна Владимировна 16/40
Савицкий Максим Игоревич 8 класс ГУО «Гимназия №33 г.Минска» Савицкая Татьяна Владимировна 16/40
Синкевич Артем Александрович 8 класс Государственное учреждение образования «Бабиничская средняя школа Витебского района» Лукашевич Наталья Александровна 16/40
Стасюкевич Алексей Сергеевич 8 класс СШ №39 г.Гродно Аргеткина Людмила Васильевна 16/40
Федосенко Карина Викторовна 8 класс Озерницкая средняя школа Слонимского района Кузьмич Татьяна Фёдоровна 16/40
Чечет Ангелина Ивановна 8 класс Голынковская СШ, Зельвенский р-н,Гродненская обл. Ковш Валентина Михайловна 16/40
Швабович Роберт Збигневич 8 класс СШ №2 г.Ошмяны. Борисевич Инесса Генриховна 16/40
Шумель Карина Витальевна 8 класс Лунненская СШ Черник Елена Михайловна 16/40
Барабан Глеб Артемович 8 класс Гимназия 2, г. Минск Кочерго Елена Николаевна 12/40
Богдан Лилия Михайловна 8 класс Гимназия 6 Богатко Людмила Ивановна 12/40
Боярчук Миша Витальевич 8 класс гимн 5 г Брест Войтюк Н. В. 12/40
Вальчук Максим Вадимович 8 класс СШ 41г.Гродно Байко Николай Васильевич 12/40
Вецозолс Иван Андреевич 8 класс СШ №27 г.Витебск Аксенов Андрей Анатольевич 12/40
Винцелович Кирилл Николаевич 8 класс Крейванцы УПК Черток Валерий Иванович 12/40
Внук Ксения Владимировна 8 класс Петришковская СШ Мулица Людмила Михайловна 12/40
Гришкевич Павел Зеноеович 8 класс Залесская СШ Горбачева Наталья Юрьевна 12/40
Гурштынович Александр Войтехович 8 класс Крейванци УПК Черток Валерий Иванович 12/40
Дернейко Ангелина Владимировна 8 класс СШ №11 г.Гродно Казека Майя Ивановна 12/40
Доморад Богдан Сергеевич 8 класс СШ №44 г. Минска Константинова Вера Константиновна 12/40
Ковальчис Никита Чеславович 8 класс Беняконская средняя школа Кристынович Вадим Александрович 12/40
Кудревич Алена Юрьевна 8 класс СШ №38 г.Гродно Смолина Юлия Владимировна 12/40
Кулаковская Анна Александровна 8 класс СШ №16, г.Гродно Камлюк Елена Генриковна 12/40
Марковский Виталий Александрович 8 класс Каролинская СШ Войтко Ольга Францевна 12/40
Метельский Андрей Игоревич 8 класс Гимназия №50 г.Минск Китунович Элеонора Станиславовна 12/40
Петровский Дмитрий Денисович 8 класс СШ №19 г.Витебка Михальченко Ольга Александровна 12/40
Пешко Максим Владимирович 8 класс СШ№5г.Сморгонь Катайкина Екатерина Федоровна 12/40
Пивоварчик Полина Андреевна 8 класс СШ 2 г. Берёзовка Яхимович Татьяна Владимировна 12/40
Рак Семён Андреевич 8 класс ГУО «средняя школа №24 г.Витебска» Шилина Ольга Фёдоровна 12/40
Русецкая Марта Антониевна 8 класс СШ №41 г.Гродно Бойко Николай Василиевич 12/40
Савицкий Арсений Евгеньевич 8 класс Гимназия 1 г.Мосты Бодак Галина Иосифовна 12/40
Сельманович Сергей Александрович 8 класс Кривошинской СШ Быцко Андрей Станиславович 12/40
Сытая Дарья Дмитриевна 8 класс Гимназия 10 г.Гродно Ермакова Анна Николаевна 12/40
Хмель Владимир Павлович 8 класс СШ №61 г.Минск Михеева Екатерина Валерьевна 12/40
Ходыш Яна Александровна 8 класс Беняконская средняя школа Кристынович Вадим Александрович 12/40
Янкелайть Даниэль Владимирович 8 класс Вороновская средняя школа Щербо Ольга Генриховна 12/40
Артём Гахович Александрович 8 класс СШ №11 г.Гродно Казека Майя Ивановна 8/40
Ачинович Павел Евгеньевич 8 класс Гимназия №13 г.Минск Спиридонова Ольга Анатольевна 8/40
Барановский Тимофей Александрович 8 класс ГУО » Средняя школа №24 г. Витебска» Шилина Ольга Фёдоровна 8/40
Гневко Артем Дмитриевич 8 класс СШ 3, г.Волковыск Данилович Елена Леонидовна 8/40
Гусар Елизавета Александровна 8 класс Сш 148 г.Минска Прибытко Ольга Васильевна 8/40
Дорош Александр Сергеевич 8 класс СШ №2 г.Берёзовка Яхимович Татьяна Владимировна 8/40
Емельянова Ксения Маратовна 8 класс СШ 11 г. Гродно Казека Майя Ивановна 8/40
Жегало Юлия Олеговна 8 класс Гимназия №6 г. Гродно Яговдик Светлана Константиновна 8/40
Иванишевская Кристианна Викторовна 8 класс г.Гродно СШ № 41 Байко Николай Васильевич 8/40
Ковтунович Илья Олегович 8 класс Кривошинская сш Быцько Андрей Станиславич 8/40
Костюк Анастасия Витальевна 8 класс Берёзовская сш 3 Ялошевская Тереза Альфредовна 8/40
Кротченков Владимир Ярославович 8 класс СШ19 Г. МИНСК Морозова Марина Махайловна 8/40
Лобановская Ксения Леонидовна 8 класс Гимназия 10 г.Минск Белкина Елена Петровна 8/40
Матейко Юлия Дмитриевна 8 класс СШ 1 Шидловский Артём Анатольевич 8/40
Никитин Иван Леонидович 8 класс Залесский я-с— сш Горбачова Наталья Юрьевна 8/40
Новицки Александр Давид 8 класс Гимназия#7 г. Гродно Расилевич Светлана Антоновна 8/40
Роля Валерия Александровна 8 класс Озерницкая средняя школа Слонимского района Кузьмич Татьяна Фёдоровна 8/40
Слабко Дмитрий Александрович 8 класс СШ №3 Г.П Зельва Жамойтина Ирина Антоновна 8/40
Станулевич Руслан Геннадьевич 8 класс Гимназия 5 г.Гродно Пырко Наталья Владимировна 8/40
Стасюкевич Максим Олегович 8 класс СШ №11 г. Гродно Казека Майя Ивановна 8/40
Сырбул Дарья Васильевна 8 класс СШ11 г Гродно Козека Майя Ивановна 8/40
Чешейко Екатерина Сергеевна 8 класс СШ №3 г.п.Зельва Жамойтина Ирина Антоновна 8/40
Амири Рамин Насирович 8 класс СШ148 г.Минск Прибытко Ольга Васильевна 4/40
Белявская Дарья Андреевна 8 класс СШ Шидловский Артём Анатольевич 4/40
Бутько Пётр Сергеевич 8 класс СШ39 г.Гродно Аргеткина Людмила Васильевна 4/40
Войдак Ульяна Александровна 8 класс Берёзовская СШ № 3 Ялошевская Тереса Альфредовна 4/40
Волчёк Артём Сергеевич 8 класс Гимназия номер 25 г.Минска Вареник Виталий Михайлович 4/40
Дехтяренко Анна Александровна 8 класс сш №148г. Минск Прибытко Ольга Васильевна 4/40
Капустин Александр Сергеевич 8 класс СШ №1 г.Лида Шидловский Артём Анатольевич 4/40
Карабухина София Витальевна 8 класс Гимназия №25 г.Минска Вареник Виталий Михайлович 4/40
Карнопель Ангелина Ивановна 8 класс СШ N 1 г. Лида Шидловский Артем Анатольевич 4/40
Кацинель Елизавета Юрьевна 8 класс СШ 11 г.Гродно Казека Майя Ивановна 4/40
Кононович Анастасия Владимировна 8 класс Озерницкая средняя школа Слонимского района Кузьмич Татьяна Фёдоровна 4/40
Оверчук Даниил Андреевич 8 класс СШ д.Клейники Вакульская Таисиия Михайловна 4/40
Овечко Иван Андреевич 8 класс Правомостовская СШ Трухан Татьяна Ивановна 4/40
Осецкий Ярослав Викторович 8 класс СШ1 Шидловский Артём Анатольевич 4/40
Радюк Михаил Андреевич 8 класс СШ N1 г. Лида Шидловский Артём Анатольевич 4/40
Романюк Андрей Алексеевич 8 класс Одрижинская СШ Гукова Екатерина Сергеевна 4/40
Сенкевич Станислав Андреевич 8 класс СШ #1 Шидловский Артем Анатольевич 4/40
Сирица Валентин Николаевич 8 класс СШ №9 г.Слоним Глубокая Ольга Дмитриевна 4/40
Трунец Карина Александровна 8 класс СШ 1 г.Лида Шидловский Артём Анатольевич 4/40
Урбанович Егор Валерьевич 8 класс Березовская СШ №3 Ялошевская Тереса Альфредовна 4/40
Чудакова Виктория Викторовна 8 класс Гимназия 7 г.Витебск Занько Анна Андреевна 4/40
Якубец Вадим Вячеславович 8 класс Гимназия 1 г.Мосты Бодак Галина Иосифовна 4/40
Баканова Мария Олеговна 8 класс Большешиловичский ЯСБШ Володось Татьяна Николаевна 0/40
Виданов Ярослав Юрьевич 8 класс СШ №11 Казека Майя Ивановна 0/40
Левшунов Олег Владимирович 8 класс СШ №1 г.Лида Шидловский Артём Анатольевич 0/40
Радюк Александр Алексеевич 8 класс Большешиловичский ЯСБШ Володось Татьяна Николаевна 0/40
Савчик Татьяна Анатольевна 8 класс СШ №3 г.п.зельва жамойтина ирина Антоновна 0/40
Сазонова Вероника Сергеевна 8 класс Изабелинский детский сад — средняя школа Никита Алла Иосифовна 0/40
Черневская Мария Дмитриевна 8 класс Изабелинский детский сад-средняя школа Никита Алла Иосифовна 0/40
Ятченя Кирилл Александравич 8 класс Большешиловичский ЯСБШ Володось Татьяна Николаевна 0/40

«Учителя СШ №1 г. Лиды заложили во мне прочные основы знаний»

28 Июля 2021 21350

Редакция «Лідскай газеты» в год празднования 100-летнего юбилея Белорусского государственного университета продолжает рассказывать о наших земляках, которые не только окончили главное учебное заведения страны, но и связали с ним профессиональную деятельность, добились больших успехов в сфере науки.   

У декана факультета радиофизики и компьютерных технологий Белорусского государственного университета, кандидата физико-математических наук, доцента Сергея Владимировича Малого детство и юность прошли в нашем городе. Сергей Владимирович родился в Борисове Минской области. Однако в 1960 году его родители (отец Владимир Андреевич был военнослужащим) переехали в Лиду,  и в первый класс в 1963 году мальчик пошел учиться в лидскую среднюю школу №1. В 1973 году, окончив школу с золотой медалью, Сергей Владимирович поступил на отделение радиофизики (с 1976 года  преобразовано в факультет радиофизики и электроники) физического факультета Белорусского государственного университета. Будучи студентом, активно и успешно сочетал учебу и научную работу. В 1978 году он с отличием окончил факультет радиофизики и в том же году поступил в аспирантуру. 

С 1981 года, со времени окончания аспирантуры, и по настоящее время Сергей Малый работает на факультете радиофизики и компьютерных технологий  научным сотрудником, старшим преподавателем, доцентом, заместителем декана по учебной работе. С 2013 года является деканом факультета, что успешно сочетает с учебной и научной работой. 

Сергей Владимирович имеет научную степень кандидата физико-математических наук и ученое звание доцента. А сфера его научных интересов разнообразна и включает различные направления теоретической и прикладной электродинамики. Результаты научных исследований опубликованы в 150 научных работах. 

За разработку электродинамических систем в 1986 году Сергей Малый стал лауреатом премии Ленинского комсомола БССР. Награждался наградами БГУ и Министерства образования Республики Беларусь. В 2016 году Сергею Владимировичу была объявлена Благодарность Президента Республики Беларусь.

Редакция «Лідскай газеты» попросила декана факультета радиофизики и компьютерных технологий Белорусского государственного университета Сергея Малого ответить на интересующие нас вопросы.

– Что сегодня представляет собой факультет радиофизики и компьютерных технологий и какие наработки имеются? 

– В этом году мы отмечаем двойной юбилей: 100-летие БГУ и 45-летие факультета радиофизики и компьютерных технологий. Факультет сегодня – это известный и признанный научно-образовательный центр физико-технического профиля, который ведет подготовку по пяти специальностям на первой ступени образования («Радиофизика», «Физическая электроника», «Компьютерная безопасность», «Прикладная информатика», «Аэрокосмические радиоэлектронные и информационные системы и технологии») и по трем специальностям на второй ступени образования («Радиофизика», «Прикладная физика», «Информационная безопасность»). Помимо образовательной деятельности, на факультете ведутся научно-исследовательские и опытно-конструкторские работы по широкому спектру современных направлений, среди которых – разработка специализированных программных комплексов и информационных систем, биоинформатика, информационная безопасность, искусственный интеллект, телекоммуникационные системы, приборостроение, квантовая радиофизика, фотоника, наноэлектроника, электродинамика и т. д. Традиционно, начиная с 70-х годов прошлого века, на факультете ведутся исследования в области прикладных космических технологий. Сотрудники факультета принимали участие в реализации ряда космических программ по исследованию Луны, Марса, Венеры, кометы Галлея.  В октябре 2018 года был выведен на околоземную орбиту наноспутник «BSUSat-1», который и сегодня успешно функционирует и выполняет поставленные перед ним задачи. Спутник разработан сотрудниками, студентами и аспирантами факультета РФиКТ. На конец 2021 года запланирован запуск второго спутника, созданного на факультете.

– Сейчас начинается время поступления. Поступают ли на ваш факультет выпускники лидских школ? Как надо постигать знания в школе, чтобы стать студентом?  

– У нас на факультете готовят востребованных на рынке труда специалистов, ориентированных на высокотехнологические отрасли науки и техники, находящиеся на стыке информационных технологий, физики, математики, электроники. Выпускники факультета готовы решать новые, нестандартные проблемы. Основная часть выпускников факультета работает в IТ-сфере, в организациях, выпускающих наукоемкую продукцию, в банковской сфере, в научно-исследовательских институтах, в ведущих вузах Республики Беларусь, в ведущих мировых компаниях.

Для поступления и начала успешной учебы на факультете достаточно базовых знаний, которые дает средняя школа. На факультет поступают выпускники лидских школ ежегодно, и мы довольны результатами их учебы. Некоторые из них после окончания учебы продолжили успешную работу на факультете.

– Как вы сами когда-то выбирали профессию?

– С детства меня привлекали точные науки: математика, физика, химия, астрономия, биология. В старших классах активно принимал участие в городских и областных олимпиадах по физике. Большое значение имело углубленное изучение химии и физики на факультативных занятиях. Поэтому выбор специальности был предопределен, и для ее получения я поступил на отделение радиофизики и электроники БГУ.

– Какие учителя привили вам любовь к  наукам, дали прочные знания? Кого еще из учителей вспоминаете добрым словом? 

– Мне очень повезло со школой и учителями, которые заложили прочные основы знаний в области точных и гуманитарных наук. Среди них – Николай Владимирович Ивашин, Клавдия Антоновна Пласковицкая, Нина Алексеевна Фадина, Павел Кузьмич Ясинский, Белла Борисовна Гаркавая и многие другие.

Особую благодарность хочу выразить учителю физики Якову Бенциановичу Гаркавому и учителю химии Дмитрию Филипповичу Ивашко. Они сыграли основную роль в выборе моей будущей профессии.

– Бывали ли после окончания в родной школе? Поддерживаете ли связь с одноклассниками?

– После окончания СШ №1 г. Лиды наш класс разъехался по всей территории бывшего СССР. В первые годы собирались на вечера встречи выпускников. Затем встречи становились реже. Новый импульс дало появление социальных сетей, в которых удалось найти всех ныне здравствующих выпускников и благодаря которым удалось встретиться в конце августа 2019 года, через 46 лет после окончания школы. Собрались одноклассники, проживающие в Беларуси, Украине, России. Приятно было отметить, что наша школа по-прежнему является одной из лучших в городе, находится в отличном материально-техническом состоянии, свято хранит традиции и память о многих поколениях замечательных учителей и выпускников. Особую благодарность хочу выразить директору школы Сергею Анатольевичу Фонасову, который показал нам школу, музей и рассказал о ее нынешних успехах и достижениях.

– А как сложилась ваша личная жизнь?

– Я женат. Жена – врач. Имеем двоих детей – сына и дочь. Оба окончили факультет радиофизики и компьютерных технологий БГУ, работают в сфере различных направлений IТ-технологий. 

– Сергей Владимирович, большое спасибо за беседу. От имени земляков хочется пожелать вам дальнейших успехов в вашей деятельности на благо белорусской науки и сферы высшего образования республики.

Олимпиады | Гродненский филиал БИП

ОЛИМПИАДА — 2016

МОЛОДЕЖЬ НА «ТЕРРИТОРИИ ПРАВА»

5 февраля 2016 года в стенах Гродненского филиала Частного учреждения образования «БИП – Институт правоведения» состоялась III ежегодная открытая Олимпиада по правовым знаниям «Территория права» для учащихся средних и средних специальных учебных заведений, посвященная 25-летию принятия Декларации о независимости БССР. Олимпиада проводилась в индивидуальном и командном зачётах, включала заочный и очный туры. Заочный тур предусматривал написание эссе на предложенные темы. Проверить свои познания в области права в заочном туре смогли 70 учащихся, объединенных в 23 команды и представлявших гимназии, средние школы, учебно-педагогические комплексы, колледжи г. Гродно и Гродненской области. Однако лишь 17 командам, прошедшим в очный тур, удалось побороться за право называться лучшими.

Почетное право открыть Олимпиаду было предоставлено директору Гродненского филиала БИП, кандидату физико-математических наук, доценту Гнездовскому Юрию Юрьевичу.

– Участие в Олимпиаде позволит учащимся продемонстрировать навыки в области юриспруденции, а также сформировать активную гражданскую позицию, – отметил Юрий Юрьевич. – Мы развиваемся в динамичном обществе, требующем от нас знания правового поля, умения ориентироваться в правовой сфере и применять эти сведения в социуме. Из года в год расширяется география нашей Олимпиады, свои силы в ней пробуют не только выпускники, но и 10-классники, что свидетельствует о том, какую важную роль для современной молодежи играют юридические знания.

Очный тур Олимпиады проводился в два этапа. Вначале участникам предлагалось проверить свои знания по правоведению и государствоведению при прохождении конкурсных заданий «Тест», «Логический ряд», «Юридические афоризмы». Вызвал оживление конкурс «Фотозагадка», где команды должны были определить, кто из общественных и политических деятелей изображен на экране. Два часа пролетели незаметно,  восстановить свои силы перед финальным конкурсом команды смогли на организованной кофе-паузе.

По итогам первой части очного тура были объявлены 12 команд, прошедших в финальный тур «Дебаты». Каждая команда получила тему, которую должна была отстоять в дебатах с командой-соперником. В течение последующих двух часов команды демонстрировали ораторское мастерство, умение аргументированно обосновывать свою позицию, задавать острые вопросы.

– Для меня Олимпиада – это своеобразный этап, очередная ступенька к успеху, – объясняет свое участие в Олимпиаде «Территория права» учащаяся гимназии № 1 им. академика Е.Ф. Карского Янина Шершень. – Ведь, независимо от выбранной профессии, человек должен быть юридически подкован для того, чтобы в нужный момент отстоять свои права.

По результатам всех туров победителями и призерами Олимпиады определились следующие команды: 1-е место – СШ № 11 г. Лида, 2-е место – гимназия № 9 им. Ф.П. Кириченко г. Гродно, 3-е место – гимназия № 1 им. академика Е.Ф. Карского г. Гродно. Призы победителям в индивидуальном зачете также уехали в Лиду: 1-е место –Ковчик Виктория Николаевна (СШ № 11 г. Лида), 2-е место разделили Хавронюк Алексей Сергеевич и Жинко Евгений Васильевич (СШ № 11 г. Лида), 3-е место –Камардин Михаил Романович (СШ № 34 г. Гродно). Всем победителям Олимпиады в индивидуальном зачете были вручены сертификаты на скидку в оплате за первый год на дневной форме обучения: 10% – 3-е место, 15% – 2-е место, 20% – 1 место. Грамотой жюри за лучшее эссе отмечена Хвойницкая Александра Антоновна (СШ № 32 г. Гродно), получившая максимальное количество баллов – 100 из 100 возможных.

Также победителям Олимпиады «Территория права» вручены ценные призы, а от лица Гродненского городского комитета ОО «БРСМ»– еще и возможность отдохнуть после напряженных интеллектуальных соревнований в аквапарке или посетить боулинг. Помимо этого, участникам Олимпиады были вручены сертификаты на 3% скидку в оплате за первый год на дневной форме обучения.

Важной частью мероприятия стала открытая беседа с членами жюри, в состав которого вошли опытные специалисты-практики, ученые-правоведы, представители общественных организаций и учебных заведений – Заслуженный юрист Республики Беларусь Николай Карпович Кичка, прокурор отдела Генеральной прокуратуры Республики Беларусь, старший советник юстиции Юрий Иванович Шерстнев; и.о. первого секретаря Гродненского городского комитета ОО «БРСМ» Раиса Сергеевна Акуленко, заместитель директора Гродненского филиала БИП по учебной и научной работе, кандидат юридических наук, доцент Андрей Алексеевич Богустов; заместитель директора Частного учреждения образования «Гродненский колледж бизнеса и права» Виктор Иванович Демченко.

Одной из злободневных тем стал вопрос о трудоустройстве выпускников юридических специальностей. Ведь, как известно, конкуренция в этой сфере продолжает стремительно расти.

По словам прокурора отдела Генеральной прокуратуры Республики Беларусь, старшего советника юстиции                   Ю.И. Шерстнева, существуют специальные правила комплектования юридических кадров, по которым определяется готовность человека работать в органах прокуратуры. Мы говорим о тех случаях, которые не связаны с дискредитирующими основаниями. Если у человека есть административные проступки, за которые он привлекался к ответственности – это большое препятствие для его трудоустройства, особенно в сфере юриспруденции. Даже нарушения правил дорожного движения сопровождают человека всю жизнь, поскольку фиксируются в базах данных и являются серьезным барьером для того, чтобы претендовать на хорошую должность.

– Порядочность в наше время – это неоценимое качество того, кто стремится достигнуть определенных результатов, – поясняет Заслуженный юрист Республики Беларусь Н.К. Кичка. – Во все времена ценились моральный облик и порядочность юриста.

И.о. первого секретаря Гродненского городского комитета ОО «БРСМ» Р.С. Акуленко назвала главной проблемой, возникающей у выпускников при трудоустройстве, неумение себя презентовать, выгодно преподнести.

– Мы живем в то время, когда специалисту важно уметь демонстрировать свои знания и умения на рынке труда, соответствовать предъявляемым работодателями критериям в высококонкурентной среде. В нашей стране, как и во всем мире, наблюдается большая конкуренция при трудоустройстве, – делится мнением Раиса Сергеевна. – Если работодатель не увидит инициативы со стороны выпускника, его желания совершенствоваться и расти в профессиональной сфере, чаще всего от такого специалиста отказываются.

В завершение беседы будущие абитуриенты поблагодарили членов жюри за обстоятельные ответы и объективное судейство.

– Целеустремленность, сознательность, упорство в достижении цели – вот главные качества, которые отличают студентов Гродненского филиала БИП от студентов других вузов, – отмечает заместитель директора Гродненского филиала БИП по учебной и научной работе А.А. Богустов. Обучение в нашем вузе ведется в компактных группах, а, следовательно, каждому студенту оказывается надлежащее внимание и индивидуальный подход. Ждем Вас! И мы ВМЕСТЕ – пойдём К УСПЕХУ!

Итоговый протокол Олимпиады-2016

Каникулы с пользой! — ОЛ «Солнышко» (СШ 6)

Государственное учреждение образования

«Средняя школа №6 г.Лиды»

 

 

 

 

Анализ работы

  летнего оздоровительного лагеря «Солнышко»

 с дневным пребыванием детей

с 01.06.2015 г. по 25.06.2015 г.

 

 

 

 

 

 

С 1 июня по 25 июня 2015 года в  СШ № 6 г. Лиды, ул. Куйбышева, д.31, на основании приказа по школе от 28.05.2015 № 211 работал летний  оздоровительный лагерь «Солнышко», в котором отдыхало 100 человек в возрасте от 6 до 12 лет (6-10 лет – 95 чел., 11-12 лет – 5 чел.).  Трёхразовое горячее питание (завтрак, обед, полдник) осуществлялось на базе  столовой СШ № 6 г. Лиды. На базе ДУ № 7 г. Лиды был организован дневной сон для 24 человек, на базе ДУ № 31 г. Лиды — для 24 человек, на базе СШ № 6 г. Лиды — для 24человек.

        Для функционирования оздоровительного лагеря была подготовлена необходимая нормативно-правовая документация. Деятельность  лагеря регулировалась   Положением о воспитательно-оздоровительном учреждении образования (от 19.07.2011г.), Положением об оздоровительном лагере, утверждённым директором СШ № 6 г. Лиды Препляско Г.Ф. Санитарными правилами и нормами «Гигиенические требования к устройству, содержанию и организации режима в оздоровительных лагерях» от 26.12.2012 №205.

        Согласно штатному расписанию начальником лагеря являлась  учитель начальных классов Юрик Елена Зигмундовна, старшим воспитателем: учитель начальных классов — Зайко Елена Сигизмундовна, музыкальным работником была назначена учитель музыки Левшунова Татьяна Николаевна,  руководителями физвоспитания: учителя физической культуры – Богуш Наталия Ивановна, Киселёв Олег Борисович. В лагере работали: педагог социальный — Гнюсевич Татьяна Петровна, педагог-психолог — Лях Оксана Владимировна, педагоги – организаторы: Арлукевич Елизавета Дмитриевна, Обурка Анастасия Петровна, педагог оформитель – Струкова Галина Станиславовна.

С работниками оздоровительного лагеря в соответствии с приказом  от 28.05.2015 № 211 был проведён педсовет (протокол от 29.05.2015г. № 1).

        Было организовано  5 отрядов, работу в которых осуществляли 23 воспитателя (учителя начальных классов высшей, первой, второй квалификационных категорий; учителя иностранного языка первой категории, учитель русского языка и литературы первой квалификационной категории,  учитель математики первой квалификационной категории,  учитель белорусского языка и литературы высшей квалификационной категории, учителя-дефектологи высшей, первой, второй квалификационных категорий):

         1 отряд – Бинкевич Татьяна Казимировна, Романова Татьяна Ивановна,

Иванова Ольга Владимировна, Саевич Марина Ромуальдовна;

         2 отряд – Степаненко Елена Петровна, Трайго Светлана Владимировна, Граховская Татьяна Ивановна, Киман Марина Андреевна;       

3 отряд – Почобут Маргарита Мирославовна, Хлюст Валерия Владимировна, Остроух Надежда Владимировна,  Груданова Ирина Евгеньевна;

       4 отряд – Хмилевская Елена Францевна, Санюк Анна Вацлавовна, Лагодская  Ирина Иосифовна, Самойлович Инна Григорьевна;

5 отряд – Иодко Галина Тадеушевна, Шиманская Анна Викторовна, Пышинская Елена Владимировна, Кульнис Лариса Николаевна,

Сидор Зоя Владиславовна;

подменный воспитатель – Костюкевич Екатерина Владимировна.

В лагере была организована работа объединений по интересам:  «Волшебная палитра» (руководитель: Струкова Г. С., учитель начальных классов), «Весёлый мяч» (руководители: Богуш Н. И., Киселёв О. Б, учителя физической культуры), «Мастерица» (руководитель: Зенькевич С.И., учитель трудового обучения)

Работа воспитателей в лагере осуществлялась в соответствии с их педагогической нагрузкой.

        Педагог социальный, педагог — психолог,  учителя физической культуры работали в соответствии с планом, утверждённым начальником лагеря.

Педагог социальный Гнюсевич Т.П. провела с воспитанниками следующую работу: обучение правилам безопасности «Остров безопасности», деловая игра «Кораблекрушение», беседа «Пожилые люди», час общения «Вред табачного дыма», решение ситуаций «Заморочки из бочки», клуб знатоков «Чтобы не было беды…», встреча с инспектором ИДН«Палитра безопасности».

Педагогом-психологом Лях О.В. за время лагерной смены были проведены следующие занятия: игра — знакомство «Ты и я – одна семья!», «Разговор без слов», «Шутка шутке — рознь», «Моя доброта», «Страхи», «Мы изменились», «Вместе мы большая сила!»

Результаты социального  паспорта следующие:

Дети-инвалиды – 1 (Микуть Денис)

Дети, воспитывающиеся в опекунских и приёмных семьях – 1 (Миколайчик Стефан)

Дети из неполных семей – 16

Дети из многодетных семей –  12

Дети, находящиеся в социально опасном положении — 4 (Дежиц Ксения, Вододохов Даниил, Латушко Владислав. Медвецкий Эрик)

Дети, состоящие на профилактическом учёте в ИДН – нет

Дети, состоящие на ВШУ – нет

Дети из малообеспеченных семей – нет

Несовершеннолетние, проживающие с родителями инвалидами – 1(Гриц Дмитрий)

       Процент посещаемости лагеря школьниками составил  в среднем 92%.

Контроль за здоровьем детей осуществляла фельдшер школы Подгайская Татьяна Ивановна.

         За каждым отрядом были закреплены кабинеты с учётом необходимого количества посадочных мест. Выделен отдельный кабинет для кружковой работы. Игровые комнаты были оснащены шашками, настольными играми, принадлежностями для рисования, декоративно-прикладной деятельности и др. В кабинетах отведены специальные места для хранения игрового инвентаря.

        Для спортивных мероприятий, подвижных игр был использован спортивный инвентарь школы (мячи,  шашки, скакалки, обручи), для проведения спортивных мероприятий был задействован спортивный зал и школьный стадион.

         В лагере работал методический штаб — кабинет, где в помощь воспитателям была предложена различная литература для проведения отрядных и общелагерных мероприятий, разработки, сценарии, рекомендации, памятки, наглядный материал по темам:

  1. Основы безопасности жизнедеятельности
  2. Права человека
  3. Формирование здорового образа жизни
  4. Зямля з блакітнымі вачамі (о природе Беларуси, символике, народном творчестве, о Беловежской пуще, об истории, фотоальбомы)
  5. Подвижные и интеллектуальные игры
  6. Материалы о Великой Отечественной войне
  7. Подборка литературы «В мире интересных книг» и др.

На средства, выделенные на нужды лагеря, были приобретены канцелярские товары, которые использовались для оформления лагерной документации, отрядных уголков, для занятий по интересам, конкурсов, в качестве призов, для работы кружков.

        Пришкольный оздоровительный лагерь с дневным пребыванием детей – это не только время отдыха и оздоровления. Это пора новых открытий, творческих поисков в организации деятельности временного детского коллектива.

         Ориентация на интересы ребёнка – одна из важных черт оздоровительного лагеря. Здесь для воспитанников создавались благоприятные условия для самосовершенствования и самореализации личности.

 

Смена была посвящена реализации проекта «Детское телевидение»  

 

В современной жизни нашего общества телевидение составляет значительную часть. Как правило, зрителям отводится пассивная роль слушателей и наблюдателей происходящего на экране. Наша программа дала воспитанникам возможность перейти из разряда пассивных наблюдателей в разряд активных деятелей, приоткрыть завесу телевизионной кухни, самим стать активными участниками телевизионных шоу-программ, режиссёрами и операторами, ведущими и гостями программ. Игра проходила в форме соревнования между отрядами-телекомпаниями за звание лучшей телекомпании. Каждый день смены — тематический, представлял собой телевизионный канал определённой направленности (канал «Детский», «Спорт +», «В гостях у сказки», «АБВГДЕЙКА», « Травел + », «Первый белорусский», «Романтика», «Морские просторы», «Мы вместе», «Здоровье», «ОБЖ», «Лида ТВ», «БТ-2»,  «Культура», «Память», «Природа», «Молодёжный», «Карусель»).

Все телекомпании базировались в телецентре «Солнышко», работали под руководством продюсерского центра, Совета директоров.

        Задача  телекомпаний — заработать как можно больше статуэток и кубков в ходе участия в различных мероприятиях.

 По итогам смены самый активный отряд получил высшую награду «Телеолимп». Заключительным этапом работы стал фестиваль с награждением победителей в номинациях «За оригинальность идей», «За эстетичность оформления», «За лучший сценический образ», «Приз зрительских симпатий» и др. Оформление лагеря соответствовало тематике смены

Воспитательная работа в отрядах планировалась исходя из общелагерного плана работы с учётом возрастных особенностей, интересов и запросов детей. Воспитатели вели педагогические дневники  отрядов с учётом всех рекомендаций. Учитывались основные направления воспитания:

  1. экологическое
  2. гражданско-патриотическое
  3. формирование здорового образа жизни
  4. трудовое
  5. духовно-нравственное
  6. досугово-познавательное
  7. социально-адаптационное
  8. правовое
  9. гендерное
  10. краеведческое

 Работа проводилась так, что каждый ребёнок имел возможность проявить себя в процессе участия в различных видах деятельности. Велась индивидуальная и коллективная работа. Отношения между воспитателями и детьми, друг с другом строились на взаимном уважении, доверии, доброжелательности. Вся работа была направлена на оздоровление, физическое развитие детей, создание положительной модели поведения.

Преследуя цель стимулирования активности воспитанников за участие во всех мероприятиях, конкурсах победители получали грамоты и призы.

Нельзя не отметить наиболее интересные мероприятия лагерной смены: районный праздник «В стране счастливого детства», музыкальная гостиная «Хлопай — топай», открытие лагеря (презентации телекомпаний): «Салют, лагерь!», концертная программа «Зажигая звёзды!», путешествие по станциям «Спортивная толкучка», конкурс рисунков «Там, на неведомых дорожках», игра — викторина «Друзья Берегоши», экскурсия «Природа Лидчины», игры на свежем воздухе «Солнце, воздух и вода – наши лучшие друзья», занятия в фитобаре «Фарма Люкс»,  просмотр фильмов в кинотеатре «Юбилейный», игровая программа в Лидском РЦТДиМ «Капитан Врунгель. Путешествие на Южный полюс» и многое другое

Воспитанники лагеря принял участие в таких трудовых акциях как: «В царстве уюта», «Заразитесь чистотой!», «Мой след на Земле».

                В рамках республиканской акции «Лето на пользу» были проведены следующие мероприятия: ежедневные пятиминутки безопасности, встречи с инспекторами ГАИ,  психологом, экскурсия в пожарную часть конкурс коллажей «Мой любимый вид спорта» оздоровительные прогулки в парк, «Богатырский турнир», «Мои настольные игры», песенный марафон «Маэстро, музыку!», азбука безопасности от службы спасения 101 «Огненные стрелы», спортивные эстафеты «В здоровом теле – здоровый дух!», «Полоса препятствий».

. Среди детей и подростков был проведён социологический опрос по предложенной анкете «Основные аспекты здорового образа жизни». В связи с чем были организованы встречи с сотрудником отделом  общественного здоровья ГУ «ЛЗЦГЭ» Калябкиным А.А., на которых затрагивались такие  вопросы  как: ценность жизни и здоровья, роль рационального питания, «опасные» продукты, профилактика пищевых отравлений летом, использование природных факторов для оздоровления, профилактика вредных привычек. В практическом блоке демонстрировались видеоролики по темам ЗОЖ.

 

В рамках патриотической  акций «Спасибо  солдатам  Победы  за  то,  что  не  знаем  войны» было организовано сотрудничество с Лидским историко-художественным музеем  «Неизвестное об известном» (история предметов ВОВ), слайд — шоу «Память бережно храним», литературная гостиная «Пионеры — герои»,  марш — бросок «Поклонимся великим тем годам», благоустройство памятника расстрелянным мирным жителям в лесном массиве в районе ул. Рыбиновского, волонтёрская акция «Ветеран живёт рядом»,  музей асфальтной живописи «Война глазами детей», встреча в музее СШ №6 “Гiстарычнае мiнулае майго горада”, экскурсия «Музей под открытым небом».

В рамках акции «Квiтней, Беларусь» была организована экскурсия в историко-художественный музей «Природа Лидчины», презентация — экскурс в историю «Мой город!», оформлена выставка рисунков «Родному городу посвящается», представлена презентация «Мир вокруг нас», проведена акция «Не дай капельке упасть», прогука- наблюдение «Всё это называется природой», конкурс стихов»Люблю тебя, мой край родной!», операция «Белорусский дом – и я хозяин в нём».

В рамках республиканской общественно – культурной акции «Мы, Белорусы – мирные люди» воспитанники лагеря приняли участие в Неделе культуры Лидчины: открытие Недели культуры Лидчины, посещение Лидского историко – художественного музея «Домик Тавлая», комплексная культурно – развлекательная программа «Творческий десант». Просмотр спектакля театра «Батлейка» — «Весенняя песня» (отдел ремёсел и традиционной культуры)    

Актуальным  оставалось взаимодействие с библиотекой  по  популяризации чтения среди детей. В рамках акции «Калейдоскоп увлечений» совместно с заведующей школьной библиотекой Явнейко Л.С. проведены следующие мероприятия: выставка книг для чтения «У книжек нет каникул», литературное лото «В таинственном сказочном мире», путешествие «По странам и континентам», викторина «Умники и умницы», интеллектуальный марафон “З любоўю да роднага слова”, викторина «В мире животных», игра-путешествие «К тайнам природы», литературная гостиная «Пионеры — герои».

 

С  целью  реализации  целенаправленной  государственной  политики  по  популяризации  здорового  образа  жизни в лагере ежедневно осуществлялась спортивно-оздоровительная работа: «Мы болеем только спортом!», «На спортивной волне», «В здоровом теле – здоровый дух!», «От старта до финиша», «Парад подвижных игр». Ежедневно с детьми проводились подвижные игры на свежем воздухе. Проведение утренней зарядки, полноценное разнообразное питание, обогащённое свежими овощами и фруктами, способствовали укреплению здоровья детей. Учитывались особенности здоровья каждого ребёнка на основе информации, подготовленной фельдшером школы.

    

С целью профилактики несчастных случаев и правонарушений были проведены встречи  со специалистами по вопросам предупреждения противоправных действий, беседы с детьми проводили не только работники милиции, но и социальный педагог, а также медицинский работник. Каждый день  воспитатели обучали детей правилам безопасного поведения.

Преследуя цель формирования культуры  безопасной жизнедеятельности, в рамках республиканской  акции «Вместе  за  безопасность и правопорядок» были организованы ежедневные минутки безопасности: «Остров безопасности», «Живи по правилам», «Авария и царь Светофор», «Большая опасность от маленького насекомого», «Беде не бывать, если знать…», “ Что делать, если вы…”, «Мы едем, едем, едем …», «Лото осторожностей», «Лесная азбука: ориентиры безопасности», «Нет ничего дороже жизни», «Чтобы не было беды…», встречи с инспектором ГАИ «Инспектор и его команда», «Улица полна неожиданностей», «Палитра безопасности»,проведена операция «Эвакуация».

 

 

       Все проведенные мероприятия способствовали сплочению детского коллектива, укреплению дружбы, обретению новых друзей, развитию взаимовыручки, сопереживанию, воспитанию бережного отношения к природе, воспитанию нравственных ценностей, воспитанию чувства патриотизма, любви к малой родине и чувства национальной гордости за свою страну.

На протяжении всей смены лагерь сотрудничал с Лидским районным центром творчества детей и молодёжи, РДК, Лидским районным экологическим центром детей и молодёжи, с центром народных ремёсел и традиционной культуры, КУКП «Лидакиновидеосеть», Лидским историко-художественным музеем, отделом ГАИ Лидского РОВД, Лидским районным отделом по ЧС, спасательной станцией г.Лиды, Домом Культуры Железнодорожников, ГУ «Лидский ЗЦГЭ».

       Слаженная, организованная работа воспитателей и всех работников лагеря, руководства школы,  школьной столовой позволила провести всю лагерную смену без нарушений и замечаний.

        Начальник лагеря                                                           Е.З. Юрик

        Старший воспитатель                                                    Е.С. Зайко

 

«Ученик года – 2021»

С 8 по 26 февраля проходил муниципальный конкурс «Ученик года начальных классов-2021». На конкурс представили материалы обучающиеся из МБОУ «Гаврилово-Посадская СШ №1», МБОУ «Гаврилово-Посадская СШ №2», МБОУ «Петровская СШ», МКОУ «Осановецкая СШ», МКОУ «Ратницкая ОШ», МКОУ «Шекшовская ОШ» и МКОУ «Бородинская СШ» .

Конкурс состоял из трех этапов:
1. Портфолио «Мои достижения». Ребята собрали внушительное портфолио  своих наград и достижений.
2. Видео рассуждение участника конкурса на тему 2021 год — год Науки.

Ребятам предлагалось рассказать о том, что такое НАУКА? Что она нам дает? К чему приведет научно-технический прогресс в будущем? С чем у них ассоциируется наука, ученый, научные приборы. Рассказать своей работой: Как мы будем жить в будущем? Что нас будет окружать? Какими станут наши города? Что важнее творчество или наука? Выступление ребят сопровождалось различными вспомогательными средствами: компьютерная презентация, рисунки, наглядный материал.

3. «Лэпбук», посвященный 60-летию полета в космос «Космическая одиссея». Ребята должны были  описать космическое путешествие. Предположить, что они, или кто-то из их друзей, отправились к далеким мирам (к планетам Солнечной системы, звездам или галактикам). Какие приключения ожидают их в этом увлекательном путешествии в Космосе? С какими трудностями придется им встретиться? Какую ракету выбрать? Что увидели они в далеком Космосе? И с этим заданием ребята справились замечательно.

Ребята все достойны победы, мы рады, что в школах нашего района учатся такие творческие, спортивные и разносторонне развитые ребята, которые по праву являются лидерами и которых ценят и уважают в школе.

Итак, по итогам конкурса призовые места «Ученик года – 2021» распределились следующим образом:

3 класс
1. Борисов Ефим  Петровская СШ –  1 место – 39 баллов
2. Горбанова Виктория  Ратницкая ОШ – 2 место – 35 баллов
3. Иванова Ксения Гаврилово-Посадская СШ №2  –  3 место – 34 балла
4. Ахмедов Тимур Гаврилово-Посадская СШ №2 – 3 место – 34 балла
5. Крюков Артем Ратницкая ОШ – 3 место – 34 балла
6. Головачев Данил- Гаврилово-Посадская СШ №2 – 33 балла
7. Леонов Кирилл Ратницкая ОШ – 33 балла
8. Степанов Иван Шекшовская ОШ – 33 балла
9. Казакова Анастасия  Гаврилово-Посадская СШ №1 – 32 балла
10. Гейдарова Азиза Гаврилово-Посадская СШ №2 – 32 балла
11. Волкова Маргарита Ратницкая ОШ – 32 балла
12. Корнилова Лида Бородинская СШ – 31 балл
13. Митрофанов Тимофей Осановецкая СШ – 30 баллов

4 класс
1. Ширяева Анна  Гаврилово-Посадская СШ №1 –  1 место – 40 баллов
2. Тютяев Николай    Петровская  СШ – 2 место – 37 баллов
3. Парфенова Ксения Гаврилово-Посадская СШ №2 – 3 место – 32 балла
4. Прохорова Полина Осановецкая СШ – 31 балл
5. Горошков Никита Осановецкая СШ – 31 балл
6. Сибирева Катя Петровская СШ – 30 баллов
7. Ваганов Матвей Петровская СШ – 30 баллов

Все победители и призеры конкурса будут награждены  грамотами  и  подарками.

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

Государственное учреждение образования «Средняя школа № 4 г.Лиды»

Алексеева Наталья Эдуардовна — учитель начальных классов 
 
Бомблевич Крестина Брониславовна — учитель начальных классов
 
Бурблис Людмила Евгеньевна — учитель начальных классов
 
Буткевич Гелена Луцьяновна — учитель начальных классов
 
Ващило Ирина Марьяновна — учитель начальных классов
 
 
Качан Татьяна Владимировна -учитель начальных классов
 
Лысенко Тамара Эдмандовна — учитель начальных классов
 
Радомская Татьяна Михайловна — учитель начальных классов
 
Сегень Ирина Войтеховна — учитель начальных классов
 
Синкевич Алла Михайловна — учитель начальных классов
 
Черняк Анна Леоновна — учитель начальных классов
 
Шот Алиция Генриховна — учитель начальных классов
 
 

 Учителя старших классов:

 
 
Алексей Наталья Казимировна — учитель физической культуры и здоровья
 
Алексей Оксана Марьяновна — учитель изобразительного искусства, черчения
 
Ашвилова Юлия Дмитриевна — учитель русского языка и литературы
 
Борейко Наталья Иосифовна — учитель биологии
 
Смушко Екатерина Валерьевна — учитель химии
 
Бояровский Иван Александрович — учитель математики
 
Гаель Татьяна Степановна — учитель английского языка
 
Гайдис Анджела Леонидовна — учитель физики
 
Горунов Сергей Владимирович — учитель физической культуры и здоровья
 
Гудач Наталья Петровна — учитель белорусского языка и литературы
 
Дагиль Татьяна Ивановна — учитель белорусского языка и литературы
 
Дедович Наталья Юрьевна — педагог-психолог
 
 
Гудень Инга Васильевна — учитель биологии
 
Змитрович Юрий Григорьевич -руководитель по военно-патриотическому воспитанию
 
Кашко Андрей Михайлович — учитель трудового обучения
 
Климович Елена Осиповна — педагог социальный
 
Коваль Валентина Евдокимовна — учитель математики
 
Семашко Елена Викторовна — учитель немецкого языка
 
Ловкис Оксана Валерьевна — учитель информатики
 
Маслова Ирина Петровна — учитель обслуживающего труда
 
 
Митюкевич Марина Витасовна — педагог дополнительного образования
 
Мишкинь Алла Анатольевна — педагог-организатор
 
 
Нагорная Светлана Анатольевна — учитель ОБЖ
 
Попова Светлана Иосифовна — учитель немецкого языка
 
Попова Елена Николаевна — учитель белорусского языка и литературы
 
Ревякин Андрей Александрович — учитель истории и обществоведения
 
Сурьянинов Анатолий Анатольевич — учитель истории и обществоведения
 
Тарасевич Зинаида Михайловна — учитель музыки
 
Хрищанович Рита Мечиславовна — учитель белорусского языка и литературы
 
 
Хруль Валентина Михайловна — учитель русского языка и литературы
 
Шестак Татьяна Анатольевна — учитель географии
 
Чернецкая Диана Иосифовна — учитель физической культуры и здоровья

SSh2 — гомолог 1 протеинфосфатазы Slingshot — Homo sapiens (человек)

В этом подразделе раздела Последовательность указано, соответствует ли каноническая последовательность, отображаемая по умолчанию в записи, завершена или нет.

Подробнее. ..

Статус последовательности i : Завершено.

В этом подразделе раздела Последовательность указано, соответствует ли каноническая последовательность, отображаемая по умолчанию в записи, находится в зрелой форме или представляет собой предшественник.

Подробнее…

Обработка последовательности i : отображаемая последовательность далее обрабатывается в зрелой форме.

.

Эта запись содержит 5 описанных изоформ и 3 потенциальных изоформы, которые сопоставлены с помощью вычислений. Показать всеВыровнять все

6 Длина

6

В этом подразделе раздела «Последовательность» сообщается о различиях между канонической последовательностью (отображаемой по умолчанию в записи) и различными представленными последовательностями, объединенными в запись.Эти различные представления могут исходить из разных проектов секвенирования, разных типов экспериментов или разных биологических образцов. Конфликты последовательностей обычно имеют неизвестное происхождение.

Подробнее…

Конфликт последовательностей i 6

В этом подразделе раздела «Последовательность» описывается последовательность природной альтернативной изоформы белка. Изменения в аминокислотной последовательности могут быть связаны с альтернативным сплайсингом, использованием альтернативного промотора, альтернативной инициацией или сдвигом рамки считывания рибосом.

Подробнее…

Альтернативная последовательность i VSP_016311

190–077

Руководство утверждение основано на мнении в я

Добавить BLAST
I VSP_016316
Ключ функции Позиции ОписаниеДействия Графический вид 2 A → V в AAH62341 (PubMed: 15489334). 1
Конфликт последовательности i 230 L → P в BAB84116 (PubMed:11832213). 1
Ключ функции Позиции ОписаниеДействия Графический вид Длина
1 – 312 Отсутствует в изоформе 4.

Отобранная вручную информация, основанная на утверждениях в научных статьях, для которых нет экспериментальной поддержки.

Подробнее…

Утверждение вручную на основе мнений в i

Add BLAST
312
Альтернативная последовательность i VSP_016312 73
Альтернативная последовательность я VSP_016313 1 — 37 MALVT … KLNLS → MARARRAVVGSVRDVSTAAT NLFYFTDFCIFLQPTHCFCC PEVSSSNY в изоформы основе 5.

Руководство утверждение по заключению в i

  • «Полное секвенирование и характеристика 21 243 полноразмерных кДНК человека».
    Ота Т., Судзуки Ю., Нисикава Т., Оцуки Т., Sugiyama T., Irie R., Wakamatsu A., Hayashi K., Sato H., Nagai K., Kimura K., Makita H., Sekine M., Obayashi M., Nishi T., Shibahara T., Tanaka T., Ishii S. , Yamamoto J., Saito K., Kawai Y., Isono Y., Nakamura Y., Nagahari K., Murakami K., Yasuda T., Iwayanagi T., Wagatsuma M., Shiratori A., Sudo H., Hosoiri T., Kaku Y., Kodaira H., Kondo H., Sugawara M., Takahashi M., Kanda K., Yokoi T., Furuya T., Kikkawa E., Omura Y., Abe K., Kamihara K., Katsuta N., Sato K., Tanikawa M., Yamazaki M., Ninomiya K., Ishibashi T., Yamashita H., Murakawa K., Fujimori K., Tanai H., Kimata M., Watanabe M., Hiraoka S., Chiba Y., Ishida S., Ono Y., Takiguchi S., Watanabe S., Yosida M., Hotuta T., Kusano J., Kanehori K., Takahashi-Fujii A., Hara H., Tanase T.-O., Nomura Y., Togiya S., Komai F., Hara R., Takeuchi K., Arita M., Imose N., Musashino K., Yuuki H., Oshima A., Sasaki N., Aotsuka S., Yoshikawa Y., Matsunawa H., Ichihara T., Shiohata N., Sano S., Moriya S., Momiyama H., Satoh N., Takami S., Terashima Y., Suzuki O., Nakagawa S., Senoh A., Mizoguchi H., Goto Y., Shimizu F., Wakebe H., Hishigaki H., Watanabe T., Sugiyama A., Takemoto M., Kawakami B., Yamazaki M., Watanabe K., Kumagai A., Itakura S., Fukuzumi Y., Fujimori Y., Komiyama M., Tashiro H., Tanigami A., Fujiwara T., Ono T., Yamada K., Fujii Y., Ozaki K., Hirao M., Ohmori Y., Kawabata A., Hikiji T., Kobatake N., Inagaki H., Ikema Y., Okamoto S., Okitani R., Kawakami T., Noguchi S., Itoh T., Shigeta K., Senba T., Matsumura K., Nakajima Y., Mizuno T., Morinaga M., Сасаки М., Тогаси Т., Ояма М., Хата Х., Ватанабэ М., Комацу Т., Мидзусима-Сугано Дж., Сато Т., Шираи Ю., Такахаси Ю., Накагава К., Окумура К. , Нагасе Т., Номура Н., Кикучи Х., Масухо Ю., Ямасита Р., Накаи К., Яда Т., Накамура Ю., Охара О., Исогай Т., Сугано С.
    Нат. Жене. 36:40-45(2004) [PubMed] [Europe PMC] [Abstract]

    Цитируется по: НУКЛЕОТИДНАЯ ПОСЛЕДОВАТЕЛЬНОСТЬ [КРУПНОМАСШТАБНАЯ мРНК] (ИЗОФОРМА 5).

Добавить Blast
37 37
Альтернативные последовательности I VSP_016314 74 — 93 74 — 93 LPQHL … Drikl → mggrhlqrqvsessAlfq в изоформ 3.

Ручное утверждение на основе мнения I

Добавить Blast
20
20
Альтернативная последовательность I VSP_016315 135 — 157 отсутствует в изоформ 3.

Ручное утверждение на основе мнения в I

Добавить Blast
23
245 — 1049 отсутствует в изоформ 3.

Ручное утверждение на основе мнения в I

Add Blast
805
Альтернативная последовательность i VSP_016317 313 – 334 FDHLY…LQGSG → MRCYLSWDRWTSPPLSSIIF IS в изоформе 4.

Руководство утверждение основано на мнении в я

Add BLAST
22
Альтернативная последовательность я VSP_016318 632 — 692 DDAIF … SSPVA → VGRARPAGWHTPSLPSHSNW PTSASVVGTTGTRHHTQLIF FYCLLWAPSSHLQGPEGSFT G в изоформы 2 и изоформы 5.

Ручное утверждение, основанное на мнении i

  • Цитируется по: НУКЛЕОТИДНАЯ ПОСЛЕДОВАТЕЛЬНОСТЬ [МРНК] (ИЗОФОРМЫ 1; 2 И 3), ФУНКЦИЯ, ВЗАИМОДЕЙСТВИЕ С АКТИНОМ, МУТАГЕНЕЗ CYS-393.

  • «Complete sequencing and characterization of 21,243 full-length human cDNAs.»
    Ota T., Suzuki Y., Nishikawa T., Otsuki T., Sugiyama T., Irie R., Wakamatsu A., Hayashi K., Sato H., Nagai K., Kimura K., Makita H., Sekine M., Obayashi M., Nishi T., Shibahara T., Tanaka T., Ishii S. , Yamamoto J., Saito K., Kawai Y., Isono Y., Nakamura Y., Nagahari K., Murakami K., Yasuda T., Iwayanagi T., Wagatsuma M., Shiratori A., Sudo H., Hosoiri T., Kaku Y., Kodaira H., Kondo H., Sugawara M., Takahashi M., Kanda K., Yokoi T., Furuya T., Kikkawa E., Omura Y., Abe K., Kamihara K., Katsuta N., Sato K., Tanikawa M., Yamazaki M., Ninomiya K., Ishibashi T., Yamashita H., Murakawa K., Fujimori K., Tanai H., Kimata M., Watanabe M., Hiraoka S., Chiba Y., Ishida S., Ono Y., Takiguchi S., Watanabe S., Yosida M., Hotuta T., Kusano J., Kanehori K., Takahashi-Fujii A., Hara H., Tanase T.-O., Nomura Y., Togiya S., Komai F., Hara R., Takeuchi K., Arita M., Imose N., Musashino K., Yuuki H., Oshima A., Sasaki N., Aotsuka S., Yoshikawa Y., Matsunawa H., Ichihara T., Shiohata N., Sano S., Moriya S., Momiyama H., Satoh N., Takami S., Terashima Y., Suzuki O., Nakagawa S., Senoh A., Mizoguchi H., Goto Y., Shimizu F., Wakebe H., Hishigaki H., Watanabe T., Sugiyama A., Takemoto M., Kawakami B., Yamazaki M., Watanabe K., Kumagai A., Itakura S., Fukuzumi Y., Fujimori Y., Komiyama M., Tashiro H., Tanigami A., Fujiwara T., Ono T., Yamada K., Fujii Y., Ozaki K., Hirao M., Ohmori Y., Kawabata A., Hikiji T., Kobatake N., Inagaki H., Ikema Y., Okamoto S., Okitani R., Kawakami T., Noguchi S., Itoh T., Shigeta K., Senba T., Matsumura K., Nakajima Y., Mizuno T., Morinaga M., Sasaki M., Togashi T., Oyama M., Hata H., Watanabe M., Komatsu T., Mizushima-Sugano J., Satoh T., Shirai Y., Takahashi Y., Nakagawa K., Okumura K., Nagase T., Nomura N., Kikuchi H., Masuho Y., Yamashita R., Nakai K., Yada T., Nakamura Y., Ohara O., Isogai T., Sugano S.
    Nat. Genet. 36:40-45(2004) [PubMed] [Europe PMC] [Abstract]

    Cited for: NUCLEOTIDE SEQUENCE [LARGE SCALE MRNA] (ISOFORM 5).

Добавить Blast
61
альтернативные последовательности I VSP_016319 693 — 1049 отсутствуют в изоформ 2 и изоформ 5.

Ручное утверждение на основе мнения в I

      • Цитируется по: НУКЛЕОТИДНАЯ ПОСЛЕДОВАТЕЛЬНОСТЬ [МРНК] (ИЗОФОРМЫ 1; 2 И 3), ФУНКЦИЯ, ВЗАИМОДЕЙСТВИЕ С АКТИНОМ, МУТАГЕНЕЗ CYS-393.

      • «Полное секвенирование и характеристика 21 243 полноразмерных кДНК человека.»
        Ota T., Suzuki Y., Nishikawa T., Otsuki T., Sugiyama T., Irie R., Wakamatsu A., Hayashi K., Sato H., Nagai K., Kimura K., Makita H., Sekine M., Obayashi M., Nishi T., Shibahara T., Tanaka T., Ishii S. , Yamamoto J., Saito K., Kawai Y., Isono Y., Nakamura Y., Nagahari K., Murakami K., Yasuda T., Iwayanagi T., Wagatsuma M., Shiratori A., Sudo H., Hosoiri T., Kaku Y., Kodaira H., Kondo H., Sugawara M., Takahashi M., Kanda K., Yokoi T., Furuya T., Kikkawa E., Omura Y., Abe K., Kamihara K., Katsuta N., Sato K., Tanikawa M., Yamazaki M., Ninomiya K., Ishibashi T., Yamashita H., Murakawa K., Fujimori K., Tanai H., Kimata M., Watanabe M., Hiraoka S., Chiba Y., Ishida S., Ono Y., Takiguchi S., Watanabe S., Yosida M., Hotuta T., Kusano J., Kanehori K., Takahashi-Fujii A., Hara H., Tanase T.-O., Nomura Y., Togiya S., Komai F., Hara R., Takeuchi K., Arita M., Imose N., Musashino K., Yuuki H., Oshima A., Sasaki N., Aotsuka S., Yoshikawa Y., Matsunawa H., Ichihara T., Shiohata N., Sano S., Moriya S., Momiyama H., Satoh N., Takami S., Terashima Y., Suzuki O., Nakagawa S., Senoh A., Mizoguchi H., Goto Y., Shimizu F., Wakebe H., Hishigaki H., Watanabe T., Sugiyama A., Takemoto M., Kawakami B., Yamazaki M., Watanabe K., Kumagai A., Itakura S., Fukuzumi Y., Fujimori Y., Komiyama M., Tashiro H., Tanigami A., Fujiwara T., Ono T., Yamada K., Fujii Y., Ozaki K., Hirao M., Ohmori Y., Kawabata A., Hikiji T., Kobatake N., Inagaki H., Ikema Y., Okamoto S., Okitani R., Kawakami T., Noguchi S., Itoh T., Shigeta K., Сенба Т., Мацумура К., Накадзима Ю., Мизуно Т., Моринага М., Сасаки М., Тогаси Т., Ояма М., Хата Х., Ватанабэ М., Комацу Т., Мидзусима-Сугано Дж. , Сато Т., Шираи Ю., Такахаси Ю., Накагава К., Окумура К., Нагасе Т., Номура Н., Кикучи Х., Масухо Ю., Ямасита Р., Накаи К., Яда Т., Накамура Ю., Охара О., Исогай Т., Сугано С.
        Нац. Жене. 36:40-45(2004) [PubMed] [Europe PMC] [Abstract]

        Цитируется по: НУКЛЕОТИДНАЯ ПОСЛЕДОВАТЕЛЬНОСТЬ [КРУПНОМАСШТАБНАЯ мРНК] (ИЗОФОРМА 5).

      Добавить BLAST
357

Анти-Slingshot гомолог 1/SSh2 антитело (ab76943)

Обзор

  • Название продукта

  • Описание

    Кролик, поликлональный гомологу Slingshot 1/СШ2

  • Виды-хозяева

    Кролик

  • Протестированные приложения

  • Реактивность видов

    Реагирует с: Человек
    Предполагается работа с: Горилла, Орангутанг
  • Иммуноген

    Синтетический пептид, соответствующий гомологу Human Slingshot 1/SSh2 а.о. 675-725.
    Ссылка на базу данных: NP_061857.2

  • Положительный контроль

    • WB: лизаты целых клеток HeLa и 293T; IP: лизаты цельных клеток HeLa
  • Общие примечания

    Науки о жизни уже несколько лет находятся в тисках кризиса воспроизводимости. Abcam лидирует в решении этой проблемы с помощью нашего ассортимента рекомбинантных моноклональных антител и нокаут-отредактированных клеточных линий для подтверждения золотого стандарта.Перед покупкой убедитесь, что этот продукт соответствует вашим потребностям.

    Если у вас есть какие-либо вопросы, особые требования или проблемы, отправьте нам запрос и/или свяжитесь с нашей службой поддержки перед покупкой. Рекомендуемые альтернативы для этого продукта можно найти ниже вместе с публикациями, отзывами клиентов и вопросами и ответами

    .

Свойства

  • Форма

    Жидкость

  • Инструкции по хранению

    Поставляется при 4°C.После доставки аликвоту и хранить при -20°C. Избегайте циклов замораживания/оттаивания.

  • Буфер хранения

    pH: 6,8
    Консервант: 0,09 % азид натрия
    Составляющие: 0,1 % BSA, трис-буферный солевой раствор

  • Загрузка информации о концентрации…
  • Чистота

    Очищенный аффинный иммуноген

  • Примечания по очищению

    ab76943 подвергали аффинной очистке с использованием эпитопа, специфичного к гомологу Slingshot 1/SSh2, иммобилизованному на твердой подложке.

  • Клональность

    Поликлональный

  • Изотип

    IgG

  • Области исследований

Сопутствующие товары

  • Совместимые вторичные модули

  • Контроль изотипа

  • Положительные контроли

Приложения

Гарантия Abpromise

Наша гарантия Abpromise распространяется на использование ab76943 в следующих протестированных приложениях.

Примечания по применению включают рекомендуемые начальные разведения; оптимальные разведения/концентрации должны определяться конечным пользователем.

Приложение Сокращения Примечания
ВБ

1/2000 — 1/10000. Обнаруживает полосу примерно 150 кДа (предполагаемая молекулярная масса: 116 кДа).

IP

Использовать в дозе 2–5–5 мкг/мг лизата.

Примечания

ВБ
1/2000 — 1/10000. Обнаруживает полосу примерно 150 кДа (предполагаемая молекулярная масса: 116 кДа).

IP
Использовать при 2-5-5 мкг/мг лизата.

Цель

  • Функция

    Протеинфосфатаза, регулирующая динамику актиновых филаментов. Дефосфорилирует и активирует фактор связывания/деполимеризации актина кофилин, который впоследствии связывается с филаментами актина и стимулирует их разборку. Ингибирующее фосфорилирование кофилина опосредуется LIMK1, который также может быть дефосфорилирован и инактивирован этим белком.

  • Сходства последовательностей

    Относится к семейству протеинтирозинфосфатаз.
    Содержит 1 домен тирозин-протеинфосфатазы.

  • Посттрансляционные


    модификации

    Фосфорилированный. Ингибирующее фосфорилирование с помощью PAK4 способствует связыванию с YWHAZ. Фосфорилирование Ser-978 снижается под действием стимулов, которые способствуют реорганизации актина и образованию ламеллиподий.Может дефосфорилироваться и активироваться с помощью PPP3CA/кальциневрина А. Фосфорилирование снижается непосредственно перед телофазой.

  • Сотовая локализация

    Цитоплазма > цитоскелет. Клеточная проекция > ламеллиподия. Декольте борозды. Середина тела. Также рекрутируются в богатые актином выпячивания мембраны, такие как ламеллиподии, которые могут обеспечивать локальный контроль динамики актина в местах клеточной локомоции. Также локализуется в борозде дробления и в средней части тела во время цитокинеза.

  • Информация от ЮниПрот
  • Ссылки на базу данных

  • Альтернативные названия

    • Антитело AW551225
    • Антитело Coro1c
    • коронин, антитело к актин-связывающему белку 1C
    • Антитело Gm1394
    • Антитело Gm1395
    • Антитело hSSH-1L
    • mSSH 1L антитело
    • OTMUSP00000031415 антитело
    • Антитело гомолога 1 протеинфосфатазы Slingshot
    • Антитело Slingshot 1
    • рогатка 1 л антитела
    • гомолог рогатки 1 антитела
    • рогатка как 1 антитело
    • Антитело Slingshot1
    • Антитело SSH-1
    • Антитело SSH 1L
    • Антитело SSH-1L
    • Антитело к SSH-подобному белку 1
    • Антитело Ssh2
    • Антитело SSh2_HUMAN

    посмотреть все

Изображения

  • Иммунопреципитация — гомолог антитела против Slingshot 1/SSh2 (ab76943)

    Slingshot/SSh2 подвергали иммунопреципитации из лизата цельных клеток HeLa (1 мг на внутрибрюшинную реакцию, 20% загрузки) с ab76943 в дозе 3 мкг на реакцию.Вестерн-блоттинг проводили на иммунопреципитате с использованием ab76943 в концентрации 0,04 мкг/мл.

    Дорожка 1: ab76943 IP в лизате цельных клеток HeLa.

    Дорожка 2: кроличьи антитела против SSh2, распознающие нижележащий эпитоп IP в лизате цельных клеток HeLa.

    Дорожка 3: кроличье антитело против SSh2, распознающее нижележащий эпитоп IP в лизате цельных клеток HeLa.

    Дорожка 4: Контрольный IgG в лизате цельных клеток HeLa.

    Обнаружение: хемилюминесценция при времени экспозиции 10 секунд

  • Вестерн-блоттинг — антитело против гомолога Slingshot 1/SSh2 (ab76943)

    Все дорожки: антитело гомолог 1/SSh2 против Slingshot (ab76943) при 0.04 мкг / мл

    Лейн 1: HELA Всего клеточного лизата на 50 мкг
    Лейн 2: HELA Всего клеточного лизата в 15 мкг
    Лейн 3: HELA Всего клеточного лизата в 5 мкг
    Lane 4: 293T лизат целых клеток при 50 мкг

    Прогнозируемый размер полосы: 116 кДа
    Наблюдаемый размер полосы: 150 кДа Почему фактический размер полосы отличается от предсказанного?

Каталожные номера (11)

ab76943 упоминается в 11 публикациях.

  • Луо X   и др. Сосудистый NRP2 запускает ангиогенез PNET путем активации оси SSh2-кофилина. Cell Biosci 10:113 (2020). ПабМед: 32983407
  • Луо Кью и др. Экспрессия гомолога-1 Slingshot является плохим прогностическим фактором уротелиальной карциномы мочевого пузыря pT1 после трансуретральной резекции. World J Urol 38: 2849-2856 (2020). ПабМед: 31965287
  • Маймаити Y и др.Экспрессия SSh2 связана с прогрессированием рака желудка и предсказывает неблагоприятный прогноз. BMC Gastroenterol 18:12 (2018). ПабМед: 29338701
  • Majumder P   et al. Клеточные уровни Grb2 и стабильность цитоскелета коррелируют при нейродегенеративном сценарии. Dis Model Mech 10: 655-669 (2017). ПабМед: 28360125
  • Чен С и др. Slingshot-1L, кофилинфосфатаза, вызывает метастазирование первичного рака молочной железы. Oncotarget 8:66195-66203 (2017). ПабМед: 2
  • 03
Посмотреть все публикации для этого продукта

Отзывы клиентов и ответы на вопросы

Гомолог 1 кофилинфосфатазы Slingshot (SSh2) связывает передачу сигналов NOD1 с ремоделированием актина

Abstract

NOD1 представляет собой внутриклеточный рецептор распознавания патогенов, который способствует антибактериальным реакциям врожденного иммунитета, адаптивному иммунитету и тканевому гомеостазу.Индуцированная NOD1 передача сигналов зависит от ремоделирования актина, однако детали связи NOD1 и актинового цитоскелета остаются неясными. Здесь мы идентифицировали в скрининге миРНК по всему геному с лекарственным средством кофилинфосфатазу SSh2 как специфический и важный компонент пути NOD1. Мы показываем, что истощение патогена с нарушением SSh2 индуцирует передачу сигналов NOD1, что проявляется в снижении активации NF-κB и высвобождении цитокинов. Химическое ингибирование полимеризации актина с использованием цитохалазина D восстанавливало потерю SSh2.Далее мы демонстрируем, что NOD1 напрямую взаимодействует с SSh2 в сайтах, богатых F-актином. Наконец, мы показываем, что повышенная активность кофилина тесно связана с передачей сигналов NOD1. Таким образом, наши данные свидетельствуют о том, что NOD1 нуждается в сети SSh2/cofilin для передачи сигналов и для обнаружения индуцированных бактериями изменений в динамике актина, ведущих к активации NF-κB и врожденным иммунным ответам.

Резюме автора

NOD1 был одним из первых членов семейства NLR, для которого было показано, что он действует как важная внутриклеточная молекула распознавания образов, опосредующая антимикробную активность у млекопитающих.Было продемонстрировано, что нарушение активности F-актина и RhoGTPase влияет на передачу сигналов NOD1 и NOD2, однако эффекторы этого процесса оставались неуловимыми. Используя многоуровневый высокопроизводительный подход к скринингу миРНК по всему геному с высокой пропускной способностью для обнаружения новых компонентов, специфичных для пути NOD1, мы идентифицировали кофилинфосфатазу SSh2, которая действует ниже RhoA-ROCK, в качестве ключевого регулятора передачи сигналов NOD1. Мы показываем, что SSh2 образует комплекс с NOD1 в богатых F-актином участках клеток человека и необходим для NOD1-опосредованных ответов на воздействие TriDAP и инфекцию Shigella flexneri .Функционально это достигается SSh2-опосредованной активацией кофилина. Наши результаты раскрывают ранее непризнанную роль SSh2 в передаче сигналов NOD1 и обеспечивают правдоподобное объединяющее механистическое объяснение того, как возмущения актинового цитоскелета могут вызывать NOD1-опосредованные воспалительные ответы.

Образец цитирования: Bielig H, Lautz K, Braun PR, Menning M, Machuy N, Brügmann C, et al. (2014) Гомолог 1 кофилинфосфатазы Slingshot (SSh2) связывает передачу сигналов NOD1 с ремоделированием актина.PLoS Патог 10(9): е1004351. https://doi.org/10.1371/journal.ppat.1004351

Редактор: Андреас Дж. Баумлер, Калифорнийский университет, Дэвис, США

Поступила в редакцию: 4 февраля 2014 г.; Принято: 15 июля 2014 г.; Опубликовано: 4 сентября 2014 г.

Авторское право: © 2014 Bielig et al. Это статья с открытым доступом, распространяемая в соответствии с лицензией Creative Commons Attribution License, которая разрешает неограниченное использование, распространение и воспроизведение на любом носителе при условии указания оригинального автора и источника.

Финансирование: Эта работа была поддержана грантами DFG (SFB670) и программы Koeln Fortune/медицинского факультета Кельнского университета для TAK и Гейдельбергской академии наук и гуманитарных наук для AH (WIN-Kolleg). Спонсоры не участвовали в разработке исследования, сборе и анализе данных, принятии решения о публикации или подготовке рукописи.

Конкурирующие интересы: Авторы заявили об отсутствии конкурирующих интересов.

Введение

Эффективная иммунная защита у млекопитающих зависит от обнаружения консервативных структур патогенов с помощью рецепторов распознавания образов (PRR) врожденной иммунной системы для запуска иммунных ответов [1].

За последнее десятилетие было идентифицировано и тщательно изучено несколько PRR. В частности, внимание привлекли члены семейства NOD-подобных рецепторов (NLR) из-за их внутриклеточной локализации [2], [3]. Одним из первых NLR, который действует как PRR, является NOD1. NOD1 представляет собой внутриклеточный белок, который может активироваться содержащими диаминопимелиновую кислоту пептидами, полученными из бактериального пептидогликана, и действует как сенсор для инвазивных бактерий, таких как Shigella flexneri [4]–[6].

Множество данных свидетельствует о том, что NOD1 является важным PRR для множества бактерий у млекопитающих, который также способствует системной активации нейтрофилов, индукции адаптивного иммунитета и гомеостаза иммунной ткани (обзор в [2], [3]).При активации NOD1 образует комплекс с взаимодействующей с рецептором серин/треонин-протеинкиназой 2 (RIP2), что приводит к активации сигнальных путей NF-κB и митоген-активируемых протеинкиназ (MAPK) [2], [3] . Было идентифицировано несколько компонентов пути ниже NOD1. Например, партнер по связыванию NOD1 RIP2 опосредует активацию комплекса TGF-β-ассоциированной киназы 1 (TAK1), который индуцируется убиквитилированием RIP2 посредством убиквитинлигазы, включая X-связанный ингибитор белка апоптоза (XIAP) [7] и клеточный ингибитор белков апоптоза-1 и -2 (cIAP1 и cIAP2) [8].NOD1 находится на плазматической мембране, где он локализуется вместе с F-актином. Предполагается, что эта локализация является предпосылкой для передачи сигналов, т.к. воздействие на полимеризацию актина изменяет передачу сигналов NOD1 [9]. Кроме того, эффектор SopE Salmonella активирует NOD1, включая изменения активности малой Rho GTPase [10]. Кроме того, фактор обмена гуаниновых нуклеотидов RhoA h2 (GEF-h2) был связан с активацией NOD1 [11]. Следует отметить, что родственный NOD1 белок NOD2 также регулируется малой ГТФазой Rac1 [12], [13] и локализуется на плазматической мембране в кортикальных структурах F-актина, подобно NOD1 [9], [13], [14]. .Вместе это указывает на тесную связь передачи сигналов NOD1 и NOD2 с актиновым цитоскелетом, хотя механистические детали остаются в значительной степени неуловимыми. Динамика клеточного актина строго контролируется действием факторов нуклеации, таких как Arp2/3, которые связываются со сторонами ранее существовавших филаментов и способствуют росту новых филаментов в этих местах. Актин-связывающие белки, принадлежащие к семейству актиновых факторов деполимеризации (ADF)/cofilin, контролируют разборку актиновых филаментов путем разрезания F-актиновых филаментов, тем самым создавая новые сайты полимеризации актина.Кроме того, есть доказательства того, что кофилин деполимеризует F-актин, чтобы обеспечить новые молекулы G-актина для полимеризации. Сама активность кофилина жестко контролируется LIMK1 и LIMK2, которые фосфорилируют кофилин по серину 3, в результате чего его активность блокируется. Соответственно, дефосфорилирование гомологом фосфатазы slingshot 1 (SSh2) реактивирует кофилин (обзор в [15]).

Здесь мы идентифицируем кофилинфосфатазу SSh2 как важный компонент сигнального пути NOD1 человека и показываем, что SSh2 связывает активацию NOD1 с опосредованными кофилином изменениями в ремоделировании актина.

Результаты

Высокопроизводительный скрининг siRNA идентифицирует SSh2 как важный компонент NOD1-опосредованной передачи сигналов NF-κB

Чтобы идентифицировать новые факторы, участвующие в NOD1-опосредованной активации NF-κB, мы адаптировали клеточный анализ репортерного гена NF-κB-люциферазы в клетках HEK293T [16] для высокопроизводительного (HT) скрининга малой интерферирующей РНК (siRNA) (рис. S1A и Б).

Библиотека миРНК с лекарственным геномом (суббиблиотека генома человека, охватывающая примерно 7000 генов с известными белковыми доменами), содержащая четыре независимых миРНК на ген, была проверена в четырех повторах на совпадения, ингибирующие NOD1-опосредованную активацию NF-κB при лечении NOD1-специфический элиситор TriDAP (рис. S1A).После контроля качества и устранения токсичных миРНК предварительные кандидаты были отобраны с использованием вероятностного алгоритма (избыточная активность миРНК; RSA) [17] (таблица S1). Статистический анализ подтвердил высокую воспроизводимость результатов и надежность контролей анализа (p65 и нецелевая миРНК Allstars) (рис. S2A). Лучшие 435 кандидатов ранжирования RSA с по крайней мере двумя хитовыми миРНК были по-разному протестированы на TriDAP-, а также на TNF-индуцированную активацию NF-kB (обозначаемую здесь как «валидационный скрининг» и «встречный скрининг» соответственно) с использованием две независимые миРНК в клетках HEK293T (рис. 1А и S1B).Нокдаун 173 генов для этого набора показал ингибирующий эффект на TriDAP-индуцированную активацию NF-κB. Из них 66 генов были специфически вовлечены в передачу сигналов NOD1 в клетках HEK293T, т. е. они существенно не влияли на TNF-опосредованную активацию NF-κB (рис. 1B, таблица S1). Среди них можно было найти 28 известных регуляторов NF-κB, частично с известной специфичностью в отношении передачи сигналов NOD1, что подтверждает достоверность результатов скрининга (таблица S1). Анализ обогащения генной онтологии (GO) показал, что термины GO, связанные с иммунной функцией и, в частности, с функцией NLR, были значительно перепредставлены среди предварительных совпадений (рис. S2B).Углубленный анализ с использованием анализа путей Ingenuity показал, что 56 из 435 результатов предварительного скрининга (12,9%) являются известными компонентами передачи сигналов NF-κB (рис. S2C). Среди этих 56 предварительных попаданий 28 можно было подтвердить на экране проверки HEK293T, из которых 14 не влияли на TNF-α-индуцированную активацию NF-κB.

Рисунок 1. Скрининг миРНК HTS идентифицирует SSh2 как новый компонент NOD1-пути.

(A) Комбинированные Z-показатели первичных попаданий на экране счетчика с активацией TriDAP (NOD1, ордината) и TNF (абсцисса).(B) Блок-схема, представляющая процедуру скрининга. Указано количество попаданий (генов) каждого шага. (C) Финальный хит-лист ранжирован по результатам THP1 (лучший). Кандидаты, проверенные на всех этапах и не влияющие на передачу сигналов TNF, выделены жирным шрифтом. Z-оценка была нормализована для контрольных siRNAs, установленных на 0 (см. также рисунки S1, S2 и таблицу S1).

435 предварительных кандидаты были дополнительно протестированы на их влияние на эндогенную NOD1-опосредованную активацию NF-κB в миелоидных клетках THP1 человека (репортерная линия THP1-синяя) (рис. S2D), выявив кластер генов, демонстрирующих функциональные взаимодействия, как было выявлено с помощью анализа STRING (рис. S2E) .Результаты подтвердили 28 генов, которые показали влияние на NOD1-опосредованную активацию NF-κB как в клетках HEK293T, так и в клетках THP1. Среди них рецептор-взаимодействующая серин/треонин-протеинкиназа 2 (RIPK2), NOD1, фактор транскрипции p65 (RELA), X-связанный ингибитор белка апоптоза (XIAP), deltex 4 (DTX4), кальретикулин (CALR), обонятельный рецептор. семейство 12, подсемейство D, член 2 (OR12D2) и белок безымянного пальца 31 (RNF31) были самыми сильными кандидатами (> 3 SD). Исключение генов, которые влияли на TNF-индуцированную активацию NF-κB в клетках HEK293T, привело к короткому списку из 18 генов (рис. 1C, таблица S1).Хотя этот список кандидатов, полученный в клетках THP1, отличался от списка, полученного из клеток HEK293T, гены RIPK2, XIAP, рецептор урациловых нуклеотидов/цистеиниллейкотриенов (GPR17), SSh2, цинковый палец 1 семейства улиток (SNAI1) и CHUK (IKKα ) были подтверждены как хиты в обеих клеточных линиях с помощью этой очень строгой процедуры (рис. 1C, таблица S1). Идентификация RIPK2, XIAP и ингибитора субъединицы альфа киназы каппа-В ядерного фактора (IKKα), все из которых недавно были связаны с путем NOD1 [7], [18], [19], подтвердили успех процедуры скрининга. .

Чтобы продемонстрировать, что мы можем обратно воспроизвести результаты скрининга, XIAP заглушили с помощью независимой от скрининга миРНК. Это сильно нарушило активацию NF-κB при стимуляции NOD1 или NOD2 в клетках HEK293T (рис. S3A и B) и клетках THP1-blue (рис. S3C). Кроме того, индуцированная TriDAP или MDP секреция IL-8 в клетках THP1 была значительно снижена (рис. S3D). В совокупности наш скрининг подтвердил, что XIAP является важным компонентом сигнального пути NOD1, в соответствии с предыдущими сообщениями, показывающими участие XIAP в передаче сигналов NOD1 и NOD2 [7], [18].Было показано, что XIAP опосредует линейное убиквитинирование RIP2 [18], опосредованное так называемым комплексом LUBAC. Следует отметить, что наш скрининг также выделил один компонент комплекса LUBAC, RNF31 (HOIP), как сильного кандидата (таблица S1), который был независимо идентифицирован в недавнем скрининге компонентов сигнального пути NOD2 [20]. Примечательно, что мы идентифицировали три новых гена, а именно рецептор урациловых нуклеотидов/цистеиниллейкотриена GPR17, кофилинфосфатазу SSh2 и репрессор транскрипции SNAI1, о которых до сих пор не сообщалось в контексте передачи сигналов NOD1.

SSh2 специфически способствует NOD1- и NOD2-опосредованным воспалительным реакциям

Среди этих строго подтвержденных совпадений наше внимание привлекла фосфатаза SSh2 (Table S1), ключевой регулятор динамики актина (rev. [21]). Чтобы подтвердить, что SSh2 является критическим компонентом передачи сигналов NOD1, мы истощили белок с помощью двух разных миРНК в миелоидоподобных дифференцированных клетках THP1-blue и измерили активность NF-κB и высвобождение IL-8 при обработке NOD1, NOD2, TLR4. и агонисты TNFR TriDAP, MDP, LPS и TNF соответственно (рис. 2A и B).Это выявило значительное снижение воспалительных реакций, опосредованных NOD1 и NOD2 (рис. 2A и B), одновременно со снижением уровней SSh2 при лечении siRNA (рис. 2C). Напротив, на TNF- и TLR4-индуцированные ответы не сильно влияли сниженные уровни SSh2 (рис. 2A и B). Аналогичные результаты были получены в клетках THP1, не содержащих репортерную конструкцию, что показывает, что NOD1-опосредованное высвобождение нескольких ключевых воспалительных цитокинов снижалось при истощении SSh2 (рис. S4).

Рисунок 2. SSh2 важен и специфичен для NOD1-опосредованной передачи сигналов.

(A–B) PMA-дифференцированные клетки THP1-blue обрабатывали в течение 72 ч нецелевым (siCTRL) или двумя SSh2-специфичными siRNA-дуплексами и инкубировали с TriDAP (10 мкг/мл), MDP (10 мкг/мл) ), TNF (0,1 мкг/мл) или LPS (0,05 мкг/мл). (A) Активация NF-κB измерялась секрецией SEAP. (B) Уровни IL-8 в культуральных супернатантах клеток из (A). Значения средние + S.D. из двух независимых экспериментов, проведенных в трехкратной повторности.Значимость рассчитывали по критерию Стьюдента (непарный, двусторонний) *p<0,05, **p<0,005. нс: не имеет значения. (C) Показан иммуноблот одного из экспериментов из (A), зондирующих SSh2 и актин в качестве контроля загрузки. (D) Ранние эффекты нокдауна СШ2. Уровни мРНК IL-8 (левая панель) и SSh2 (правая панель) в клетках THP1-blue, обработанных как индуцированные, измеряли с помощью количественной ПЦР. Среднее + С.Д. показаны результаты трехкратных измерений одного репрезентативного эксперимента (см. также рисунок S4).

https://дои.org/10.1371/journal.ppat.1004351.g002

Иммуноблоттинг показал, что обе миРНК уменьшали экспрессию SSh2 и показали, что уровни белка SSh2 повышались при стимуляции PAMP (рис. 2C). Чтобы оценить эффект нокдауна SSh2 в ранние моменты времени после активации, мы измерили уровни мРНК IL-8 и SSh2 через 3 часа после стимуляции TriDAP или TNF в клетках THP1-blue. Это показало, что снижение SSh2 коррелирует со сниженными уровнями мРНК IL-8, когда клетки были активированы TriDAP, но не при стимуляции TNF (рис. 2D).

Чтобы выяснить влияние SSh2 на физиологическую активацию NOD1 бактериями, мы заразили клетки HeLa грамотрицательным инвазивным бактериальным патогеном Shigella flexneri , который в этих клетках воспринимается главным образом NOD1. Истощение мРНК SSh2 двумя SSh2-специфичными siRNA-дуплексами привело к значительному нарушению продукции IL-8 и IL-6 через 6 часов после заражения инвазивным штаммом M90T S. flexneri (рис. 3A). Примечательно, что это не было связано со снижением бактериальной инвазии и репликации, что было продемонстрировано анализами защиты от гентамицина (рис. 3В).Чтобы расшифровать, участвует ли SSh2 предпочтительно в ранних или поздних событиях во время воспалительной реакции на S. flexneri , мы измерили мРНК IL-8 и высвобождение IL-8 в разные моменты времени после бактериальной инфекции. Истощение SSh2 (рис. S5A) привело к значительному снижению транскрипции IL-8 уже через 30 минут после заражения (рис. 3C). Через два часа после инфицирования, когда IL-8 стал измеряться в супернатанте инфицированных клеток, наблюдалась значительная разница в секреции IL-8 между клетками, обработанными SSh2, нацеленной на миРНК, и клетками, обработанными нецелевой контрольной миРНК (рис. 3C).Это говорит о том, что SSh2 уже участвует в ранней активации NOD1. Как и ожидалось, нокдаун SSh2 привел к сильному увеличению фосфорилирования его субстрата кофилина по серину 3 (рис. S5B), доказывая, что SSh2 активен в нашей клеточной системе. Чтобы исключить, что описанные выше эффекты были связаны со злокачественным происхождением клеточных линий, мы оценили фенотип истощения SSh2 в первичных дермальных фибробластах человека. В соответствии с результатами, полученными с клеточными линиями, в первичных дермальных фибробластах человека NOD1-опосредованная секреция IL-8 также значительно снижалась при нокдауне SSh2, тогда как истощение SSh2 влияло на TNF-индуцированную секрецию IL-8 в меньшей степени (рис. S5C). ).

Рисунок 3. SSh2 участвует в ранних провоспалительных реакциях, индуцированных Shigella .

(A) Клетки HeLa трансфицировали миРНК CTRL или SSh2, инкубировали в течение 72 ч и инфицировали Shigella flexneri M90T или BS176 (MOI = 10). Секрецию IL-8 и IL-6 (правая панель) определяли через 6 ч после инфицирования с помощью ELISA. Значения средние + S.D. (n = 2), представитель трех независимых экспериментов. Эффективность нокдауна определяли с помощью ОТ-ПЦР (правая панель).(B) Внутриклеточные бактерии подсчитывали после обработки гентамицином клеток, обработанных, как в (A) через 2 часа после инфицирования. (C) Клетки HeLa, обработанные в течение 72 ч siCTRL (закрашенные столбцы) или siSSh2_1 (серые столбцы), анализировали в указанные моменты времени после заражения S. flexneri M90T afaE. Количественная ПЦР кДНК, нормализованная по экспрессии GAPDH и концентрации IL-8 в супернатанте (правая панель), среднее + S.D. (n = 3). Значимость рассчитывали по t-критерию Стьюдента (непарный, двусторонний) *p<0.05, **p<0,005 (см. также рисунок S5).

https://doi.org/10.1371/journal.ppat.1004351.g003

В совокупности наши данные идентифицировали SSh2 как важный компонент NOD1-опосредованной активации провоспалительных реакций в миелоидных и эпителиальных клетках человека.

SSh2 взаимодействует с NOD1 на структурах F-актина

Сообщалось, что

SSh2 связывает F-актин и совместно локализуется с актиновыми стрессовыми волокнами [22], [23]. Мы подтвердили, что эктопически экспрессируемый SSh2 частично локализуется совместно с F-актином в клетках HeLa, которые стабильно экспрессируют YFP-NOD1.Хотя два белка показали несколько разные паттерны локализации, частичная совместная локализация SSh2 и NOD1 также наблюдалась при конфокальной визуализации (рис. S6A). В экспериментах по совместной иммунопреципитации временно экспрессированных белков SSh2 и NOD1/2 и NOD1, и NOD2 соосаждали с SSh2 (рис. 4А), подтверждая, что оба белка NLR способны образовывать комплекс с SSh2. При активации NOD1 с помощью TriDAP мы наблюдали изменение стехиометрии этого комплекса с увеличением аффинности примерно через 30 минут после стимуляции TriDAP и снижением связывания в более поздние моменты времени (рис. 4B).Для более подробного анализа этого белок-белкового взаимодействия мы использовали in situ анализов проксимального лигирования (PLA). Мы обнаружили, что GFP-SSh2 и Flag-NOD1 связаны преимущественно с положительными по F-актину структурами (рис. 4C). Количественный анализ с использованием высокопроизводительной микроскопии показал, что площадь, покрытая пятнами PLA, была примерно в 4 раза выше в клетках, экспрессирующих GFP-SSh2 и Flag-NOD1, чем в соседних GFP-отрицательных клетках, что подтверждает специфичность сигнала (рис. 4C и S6B). .Более того, мутант C393S SSh2 с мертвой фосфатазой дал такие же результаты в анализах PLA, как и SSh2 дикого типа (рис. S6C), показывая, что ассоциация SSh2 и NOD1 не зависела от фосфатазной активности SSh2. Соответственно, SSh2 не участвовал в нацеливании на мембраны NOD1 и NOD2 в клетках HeLa, поскольку субклеточная локализация временно трансфицированных NOD1 и NOD2 не претерпела заметных изменений в клетках с сильно сниженной экспрессией SSh2 по сравнению с контролем (рис. S7A и S7B).

Рис. 4.SSh2 взаимодействует с NOD1 и регулирует фосфорилирование кофилина после активации NOD1.

(A) Коиммунопреципитация эктопически экспрессированного SSh2 с NOD1 и NOD2 в клетках HEK293T человека. Во всех образцах Flag-SSh2 осаждали с использованием Flag-специфического антитела. (B) Кинетика совместной иммунопреципитации NOD1 и SSh2 в клетках HEK293T, обработанных в течение указанного времени 500 нМ TriDAP. Flag-SSh2 осаждали с использованием Flag-специфического антитела. (C) In situ PLA обнаружение взаимодействия между GFP-SSh2 (показано зеленым) и Flag-NOD1 в временно трансфицированных клетках HeLa.Белок-белковые взаимодействия визуализируются в виде небольших отчетливых красных пятен (сигналы PLA). F-актин (синий) окрашивали меченным Alexa633 фаллоидином. Показана одна секция z. Масштабная линейка 5 мкм. Правая панель: количественная оценка общей площади пятна на ячейку. Значимость рассчитывали по критерию Стьюдента (непарный, двусторонний), p<0,0001. (D) Непрямое иммунофлуоресцентное исследование эктопически экспрессированного myc-SSh2 в клетках HeLa после 30-минутного заражения S. flexneri (MOI = 10). Бактерии были окрашены специфическими для ЛПС антителами и показаны красным цветом на изображении слияния вместе с окрашиванием ДНК синим цветом.Бар: 10 мкм. (E) Клетки HEK293T, экспрессирующие низкие количества NOD1, стимулировали TriDAP. Высвобождение IL-8 (столбцы) измеряли с помощью ELISA (накопление в супернатанте с момента t = 0) и мРНК IL-8 (линия) с помощью количественной ПЦР (верхняя панель). Значения средние + S.D. (n = 3). Фосфорилирование кофилина (S3) контролировали с помощью вестерн-блоттинга (нижние панели). Определение общего количества кофилина и актина служило контролем нагрузки. Показан один репрезентативный эксперимент из трех. (F) уровни p-кофилина и общего белка кофилина анализировали в клетках HEK293T в указанные моменты времени после стимуляции 50 нг/мл TNF (верхняя панель).В качестве альтернативы NOD1 подавляли обработкой siRNA в течение 48 часов, а клетки стимулировали TriDAP (нижние панели) (см. также рисунок S6).

https://doi.org/10.1371/journal.ppat.1004351.g004

Сообщалось, что в эпителиальных клетках обогащен SSh2 в очагах входа Salmonella [24]. Точно так же NOD1 обогащен в сайтах проникновения S. flexneri [9]. Таким образом, мы проанализировали локализацию SSh2 в клетках, инфицированных S. flexneri , выявив обогащение SSh2 в очагах проникновения бактерий (рис. 4D).

Ранее мы сообщали, что деполимеризация F-актина микотоксином цитохалазином D усиливает NOD1-опосредованную активацию NF-κB [9]. Основываясь на наших результатах, мы предположили, что влияние SSh2 на передачу сигналов NOD1 может быть опосредовано ремоделированием актина, контролируемым кофилином, и что образование комплекса SSh2-NOD1/2 может контролировать локальную активность NOD1/2 в местах проникновения бактерий. Чтобы решить эту проблему, мы косвенно отслеживали активность SSh2, измеряя фосфорилирование его субстрата кофилина в серине 3 (p-кофилин) после индуцированной TriDAP активации NOD1.Обработка TriDAP клеток HEK293T, экспрессирующих низкие уровни NOD1, сильно индуцировала высвобождение IL-8 из этих клеток (фиг. 4E). Интересно, что базальные уровни p-кофилина снижались в то время, когда транскрипция IL-8 была максимальной (примерно через 180 минут после обработки TriDAP) (рис. 4E). После более длительных периодов инкубации (16 часов) уровни p-кофилина увеличились выше уровня, наблюдаемого в необработанных клетках (рис. 4E). Более медленная кинетика в этих экспериментах по сравнению с инфекцией S. flexneri в клетках HeLa (рис. 3), вероятно, связана с различной кинетикой поглощения TriDAP в клетках HEK293T [5].Примечательно, что после стимуляции клеток HEK293T с помощью TNF не наблюдалось явного изменения уровней p-кофилина, хотя TNF индуцировал высокий уровень высвобождения IL-8 (рис. 4F и S6D). Более того, в клетках, в которых NOD1 был истощен обработкой siRNA TriDAP, не оказывалось сильного влияния на уровни p-кофилина с течением времени (рис. 4F). Соответственно, TriDAP не смог индуцировать секрецию IL-8 из этих клеток (рис. S6D). Более того, экспрессия SSh2 не приводила к повышению базовой активности NF-κB (рис. S8B).

В совокупности эти данные свидетельствуют о том, что передача сигналов NOD1 зависит от присутствия SSh2, который действует ниже NOD1 и включает активацию кофилина.

Передача сигналов NOD1 связана с изменениями актинового цитоскелета

Затем мы спросили, вносят ли другие компоненты регуляторной сети кофилина также вклад в результат передачи сигналов NOD1. Используя нокдаун, опосредованный siRNA, мы подтвердили, что снижение кофилина приводило к такому же нарушению передачи сигналов NOD1, как и нокдаун SSh2 (рис. 5А). Кофилин регулируется преимущественно фосфорилированием через киназы LIMK1/2, которому противодействует фосфатазная активность SSh2.И SSh2, и LIMK1/2 сами по себе регулируются событиями фосфорилирования, опосредованными протеинкиназой D (PKD), ROCK1/2 и PAK1/4 соответственно (rev. [25]). Экспрессия доминантно-негативной формы ROCK1 (KD-IA, у которой отсутствует киназо- и Rho-связывающая активность) усиливала, хотя и незначительно, NOD1-опосредованные ответы дозозависимым образом, тогда как конститутивно активный мутант ROCK1 (delta1) значительно ингибировал сигнализация NOD1 (рис. 5B). Чтобы дополнительно подтвердить это, мы проверили влияние двух мощных химических ингибиторов ROCK — Y-27632 и Glycyl-h2152 — на NOD1-опосредованную передачу сигналов.В клетках HEK293T оба ингибитора усиливали индуцированную TriDAP NOD1-опосредованную активацию NF-κB дозозависимым образом, это усиление было значительным в случае Glycyl-h2152 (фиг. 5C). Напротив, оба соединения приводили к значительному снижению TNF-индуцированных ответов NF-kB (рис. S8A). Химическое ингибирование ROCK также приводило к более высоким NOD1-опосредованным провоспалительным ответам в стимулированных TriDAP клетках HeLa и THP1 (рис. 5D и E). Ингибирование ROCK дозозависимым образом коррелирует со сниженными уровнями p-кофилина, что позволяет предположить, что повышенная активность кофилина вызывает этот эффект на передачу сигналов NOD1.Как было показано ранее, стимуляция клеток с помощью TriDAP дополнительно усиливала дефосфорилирование кофилина (рис. 5D и E). Чтобы предоставить прямые доказательства того, что фосфатазная активность SSh2 отвечает за модуляцию активности NOD1, мы сверхэкспрессировали мутант C535S SSh2 с мертвой фосфатазой в клетках HEK293T. В соответствии с нашей гипотезой это не влияло на NOD1-опосредованную передачу сигналов (рис. S8C).

Рисунок 5. Активность ROCK влияет на передачу сигналов NOD1.

(A) Клетки HEK293T трансфицировали CTRL или siRNA, специфичными для указанной мишени, и инкубировали в течение 48 часов.Затем клетки трансфицировали репортером люциферазы NF-κB и NOD1 и стимулировали TriDAP (закрашенные столбцы). Через 16 ч клетки лизировали, определяли активацию люциферазы и нормализовали значениями β-галактозидазы (nRLU). Значения средние + S.D. (n = 3). Нокдаун соответствующей мишени показан с помощью иммуноблота на правой панели. (B) Влияние экспрессии конститутивно активной (CA) и доминантно-негативной (DN) форм ROCK1 на NOD1-опосредованную активность NF-κB, измеренную с помощью репортерных анализов люциферазы в клетках HEK293T.Значения средние + S.D. (n = 3). ( C ) NOD1-индуцированная активность NF-κB, измеренная с помощью репортерных анализов люциферазы в клетках HEK293T в течение 6 часов с ингибиторами ROCK Y-27632 и Glycyl-h2152. Значения средние + S.D. (n = 3). (D) Клетки THP1 обрабатывали указанным количеством ингибитора ROCK Glycyl-h2152 в течение 6 ч, и секрецию IL-8, индуцированную TriDAP, определяли с помощью ELISA. Среднее + С.Д. (n = 3). Клетки лизировали и определяли п-кофилин с помощью вестерн-блоттинга с использованием специфического антитела (нижняя панель).Обнаружение GAPDH служило контролем нагрузки. (E) Те же экспериментальные установки, что и (D), с использованием клеток HeLa, стимулированных 10 мкг/мл TriDAP. Среднее + С.Д. Показано. * p<0,05, ** p>0,005 по сравнению с контрольной группой (см. также рисунок S8).

https://doi.org/10.1371/journal.ppat.1004351.g005

Эти результаты показывают, что нарушение пути кофилина на разных уровнях влияет на передачу сигналов NOD1, предполагая, что передача сигналов NOD1 зависит от опосредованных кофилином изменений в ремоделировании актина.Соответственно, передача сигналов NOD1, индуцированная микотоксинами, нарушающими полимеризацию актина, должна быть независимой от SSh2. Как сообщалось для клеток HEK293T [9], мы обнаружили, что деполимеризация F-актина с использованием цитохалазина D сильно усиливала NOD1-опосредованную передачу сигналов в клетках THP1 (рис. 6А). В соответствии с предыдущими сообщениями, цитохалазин D усиливал высвобождение IL-8, индуцированное другими PAMP, примерно в 2 раза [26], [27]. Однако в случае активации NOD1 с помощью TriDAP наблюдалось значительно более высокое увеличение примерно в 3 раза (рис. 6B).Примечательно, что этого не было при активации NOD2 с помощью MDP. Затем мы истощили экспрессию SSh2 в клетках THP1-blue и впоследствии нарушили полимеризацию актина обработкой цитохалазином D. Нокдаун SSh2 значительно снижал NOD1-опосредованную активность NF-κB в клетках, обработанных TriDAP, однако обработка цитохалазином D восстанавливала эффект истощения SSh2 на TriDAP-индуцированную активацию NOD1 (рис. 6C). Это убедительно свидетельствует о том, что F-actin влияет на передачу сигналов NOD1 ниже по течению от SSh2.

Рисунок 6.Передача сигналов NOD1 зависит от F-актина.

(A) Влияние 6-часовой обработки цитохалазином D (cytoD) на индуцированную TriDAP/NOD1 активацию NF-κB в PMA-дифференцированных репортерных клетках THP1-blue. Среднее + С.Д. (n = 3). Значимость рассчитывали по критерию Стьюдента (непарный, двусторонний) *p<0,05, **p<0,005 (по сравнению с 0 нМ цитоД). (B) Секреция IL-8 клетками THP1, обработанными в течение 6 часов указанным PAMP в присутствии или в отсутствие цитохалазина D. Показано среднее значение трех повторов из двух независимых экспериментов + S.Д. (n = 6). Кратность индукции IL-8 цитоД показана ниже. ( C ) Эффект нокдауна SSh2 на усиленную цитоD передачу сигналов NOD1. Дифференцированные клетки THP1 обрабатывали цитоD в течение 6 часов и стимулировали 10 мкг/мл TriDAP (черные столбцы) или имитировали обработку (незаштрихованные столбцы). Показана секреция IL-8, измеренная в супернатанте через 6 часов инкубации, среднее + S.D. (n = 3), * р<0,05, ** р<0,005.

https://doi.org/10.1371/journal.ppat.1004351.g006

В совокупности наши данные подтверждают, что для активации NOD1 и индукции провоспалительных реакций требуется ремоделирование актина, контролируемое сетью SSh2 и кофилина.

Обсуждение

Используя беспристрастный высокопроизводительный скрининг siRNA, мы идентифицировали новые факторы, участвующие в регуляции сигнального каскада NOD1. Обоснованность и качество нашего подхода к скринингу подчеркиваются тем фактом, что скрининг выявил множество факторов, участвующих в канонической передаче сигналов NF-κB и/или NOD1. Наиболее заметно, что первичный скрининг подтвердил белки RIPK2 (обзор в [2]), IKKα [19], IKKβ (обзор в [2]), TAB2 [28], [29], RNF31 [30], p50 и RELA [3]. 31] в качестве важных положительных регуляторов передачи сигналов NOD1.Помимо RIP2, XIAP занял самое высокое место на протяжении всей процедуры скрининга среди конкретных попаданий NOD1. В соответствии с недавней публикацией мы наблюдали притупленные ответы истощенных по XIAP клеток на стимуляцию элиситорами NOD1 и NOD2 [7]. Недавнее исследование теперь обеспечивает основу для функции XIAP в этом процессе, показывая, что он действует как убиквитинлигаза для RIP2, катализируя события линейного убиквитинирования, по крайней мере, в передаче сигналов NOD2 [18]. Используя S. flexneri в качестве модели инфекции, мы недавно смогли продемонстрировать физиологическую значимость этих результатов in vitro и in vivo , подчеркнув влияние XIAP на антибактериальный иммунитет [32].

С высокой достоверностью скрининг идентифицировал центральный регулятор актиновой динамики цитоскелета, фосфатазу SSh2, как новый компонент сигнального каскада NOD1. Примечательно, что SSh2 также был недавно идентифицирован как потенциальный хит в двух независимых усилиях по скринингу siRNA в поисках сигнальных компонентов NOD1 и NOD2, хотя это не было подтверждено ни в одном из этих исследований [20], [33]. Лучше всего описанная функция SSh2 — это дефосфорилирование и последующая активация фактора деполимеризации актина кофилина.Известно, что его активности противодействуют LIMK1 и LIMK2, которые фосфорилируют и, таким образом, инактивируют кофилин на серине 3 (обзор в [21]). Использование очень строгого и беспристрастного многоуровневого скрининга обеспечивает высокую достоверность полученных данных. Однако кандидаты могут быть пропущены из-за потерь из-за несоответствия критериям качества. Это, вероятно, объясняет, почему кофилин, ROCK1, ROCK2 и другие, хотя и представлены в проверенной библиотеке, не были идентифицированы как проверенные хиты.

Мы подтвердили функцию SSh2 в передаче сигналов NOD1 с помощью независимых экспериментов по нокдауну siRNA в различных линиях клеток человека и первичных дермальных фибробластах человека.Это подтвердило, что подавление SSh2 значительно нарушает NOD1-опосредованные ответы в клетках человека, запускаемые TriDAP и инфекцией инвазивным бактериальным патогеном S. flexneri . В соответствии с данными скрининга, нокдаун SSh2 влиял на активацию TNF и LPS-индуцированную активацию NF-kB в гораздо меньшей степени, чем NOD1- и NOD2-опосредованные ответы, показывая, что SSh2 способствует передаче сигналов NOD1 и NOD2 довольно специфическим образом. Таким образом, SSh2 вносит вклад в передачу сигналов NOD1 в ранние времена. В совокупности наши результаты показывают, что SSh2 влияет на передачу сигналов NOD1 посредством своей фосфатазной активности.Это лучше всего подтверждается наблюдением, что NOD1-индуцированная активация транскрипции IL-8 сопровождалась снижением фосфорилирования кофилина и отсутствием эффекта фосфатазно-мертвого мутанта SSh2 на передачу сигналов NOD1. Наши данные не позволяют сделать выводы о том, как в этом процессе запускается активность SSh2. Однако наблюдаемое комплексообразование SSh2 и NOD1, которое демонстрирует измененную стехиометрию при запуске NOD1 его элиситором TriDAP, заставляет предположить, что связывание NOD1 с комплексом, содержащим SSh2, инициирует локальную активацию SSh2.Примечательно, что мы наблюдали, что обработка несколькими PAMP приводила к повышению уровня белков SSh2 в клетках THP1. Правдоподобная интерпретация этого открытия может заключаться в том, что более высокие уровни SSh2 могут делать клетки-хозяева более склонными к усиленной и более быстрой NOD1-опосредованной иммунной передаче сигналов. Дальнейшие исследования помогут решить эту проблему и установить биологическую значимость этого открытия.

Инвазивные бактерии, такие как Shigella и Salmonella , зависят от жестко контролируемой пространственной и локальной реорганизации F-актина на плазматической мембране для проникновения в клетку-хозяина.NOD1 хорошо известен как важный сенсор бактериальной инвазии, и ранее мы показали, что он совместно локализуется с F-актином на клеточной мембране и что деполимеризация F-актина цитохалазином D усиливает передачу сигналов NOD1 в эпителиальных клетках [9]. В клетке динамика актина контролируется балансом между активностью малых ГТФаз RhoA и Rac1, и сообщалось, что изменение их активности влияет на передачу сигналов NOD1 и NOD2 [12], [13], [34]. Патогенная бактерия Klebsiella pneumonia , по-видимому, ингибирует активность Rac1, запуская передачу сигналов NOD1, что приводит к ослаблению реакции врожденного иммунитета [34].Кроме того, фактор обмена гуаниновых нуклеотидов активатора Rho h2 (GEF-h2) был идентифицирован как важный компонент NOD1-опосредованной передачи сигналов в ответ на Shigella и муропептиды [11]. Однако во всех этих исследованиях механистическая связь с модуляцией передачи сигналов NOD1 не была окончательно идентифицирована. Наши результаты показывают, что способность передачи сигналов NOD1 зависит от ремоделирования актина через кофилин. Активация NOD1 химическими лигандами снижала уровень клеточного р-кофилина в то время, когда индуцировалась провоспалительная передача сигналов.Поскольку SSh2 и NOD1 непосредственно взаимодействуют на плазматической мембране, SSh2 может действовать как локальная платформа для рекрутирования NOD1 в место проникновения патогенов. Тот факт, что активность кофилина также модулируется активностью RhoA и Rac1 [25], убедительно свидетельствует о том, что SSh2 и кофилин являются ключевыми эффекторами, которые связывают активацию NOD1 с нарушениями в сети регуляции актина. В поддержку этого представления наши данные показывают, что «стерильное» вмешательство в путь кофилина на нескольких уровнях, а также фармакологическое нарушение актинового цитоскелета модулирует исход передачи сигнала NOD1.Например, мы наблюдали усиление передачи сигналов NOD1 при сверхэкспрессии доминантно-негативного белка эффекторной киназы RhoA ROCK или при фармакологическом ингибировании киназ ROCK. Мы не можем формально исключить влияние ингибиторов на другие клеточные мишени. Однако, в заключение, все данные убедительно подтверждают, что вмешательство в сеть F-actin ниже по течению от RhoA и выше по течению от cofilin глубоко изменяет передачу сигналов NOD1. Наконец, мы заметили, что индукция NOD1-опосредованных ответов путем деполимеризации F-актина не зависит от SSh2.В совокупности эти эксперименты показали, что результат передачи сигналов NOD1 напрямую коррелирует с активностью кофилина.

Было показано, что деполимеризация

F-актина цитохалазином D в миелоидных клетках влияет на передачу сигналов NF-κB более широким образом, что подтверждается нашими результатами [26], [27]. Следует отметить, что в этих исследованиях не проводился сравнительный анализ с включением множественных PRR. Мы наблюдали гораздо более высокий синергизм при NOD1-индуцированной активации NF-κB, что указывает на то, что передача сигналов NOD1 особенно склонна к изменениям в динамике актина.Неожиданно также NOD2-индуцированные ответы IL-8 были менее сильно усилены цитохалазином D в миелоидных клетках по сравнению с NOD1, хотя SSh2 взаимодействовал с NOD2, и нокдаун SSh2 также влиял на NOD2-опосредованную передачу сигналов. Необходимы дальнейшие исследования, чтобы определить неожиданные различия во вкладе актинового цитоскелета и SSh2 в передачу сигналов NOD1 по сравнению с NOD2. Регуляция передачи сигналов PRR с помощью актина не лишена прецедента, поскольку ранее была показана роль Rac1 в регуляции функции TLR2 [35].Более того, существуют интересные параллели в регуляции NLR млекопитающих и растений, указывающие на то, что эффекторный запускаемый иммунитет (ETI) у растений, вызываемый активацией растительных белков NLR, также тесно связан с динамикой актина. У Arabidopsis есть генетические доказательства того, что ремоделирующий актин белок ADF-4 негативно влияет на RPS4-опосредованные ответы ETI, хотя авторы не раскрывают, связано ли это с измененной динамикой актина [36].

Совсем недавно было высказано предположение, что NOD1 действует как сенсор активности Rac1 и CDC42, индуцированной эффекторными белками бактериального типа III, такими как фактор вирулентности Salmonella SopE [10].Однако до сих пор неясно, как это механистически связано с изменениями в активности NOD1. В любом случае, вызванное бактериями нарушение динамики актина, которое необходимо для проникновения бактериальных клеток, в частности, в эпителиальные клетки, может привести к усилению NOD1-опосредованных воспалительных ответов. Представленные здесь данные обеспечивают новое понимание основных механизмов, показывающих, что SSh2-опосредованное ремоделирование актина является центральным компонентом активации NOD1 и врожденных иммунных ответов.

Материалы и методы

Клетки и бактерии

клетки HEK293T, HeLa, THP1 и THP1-blue (InvivoGen, Франция) культивировали, как описано в [37].Для иммунофлуоресценции была создана линия HeLa, стабильно экспрессирующая EGFP-меченый NOD1. Все клеточные линии постоянно тестировали на отсутствие контаминации микоплазмой методом ПЦР. Первичные кожные фибробласты человека получали, как описано ранее [38].

Плазмиды и реагенты

Плазмиды, кодирующие меченые myc NOD1 и NOD1 человека, были получены путем ПЦР-клонирования в каркасе pCDNA3.1.

плазмиды, кодирующие SSh2, описаны в [39]. Плазмиды, кодирующие ROCK и мутанты, описаны в [40], а плазмиды RhoA и Rac1 были любезно предоставлены Monilola Olayioye (Университет Штутгарта).Ингибиторы ROCK и цитохалазин D были приобретены у Tocris.

обработка миРНК

Нокдаун на основе siРНК

в клетках HeLa и THP1 проводили, как описано ранее в [37]. Используемые миРНК: SSh2_1: SI00123585, SSh2_3: SI00123599 (Qiagen) и отрицательный контроль AllStars (Qiagen).

Бактериальная инфекция

Shigella flexneri

Для инфекции S. flexneri клетки HeLa высевали в 24-луночные планшеты. Заражение осуществляли штаммом M90T afaE, как описано ранее [41].Гентамицин (100 мкг/мл) добавляли к клеткам через 30 мин после добавления бактерий. В качестве контроля использовали неинвазивное производное (BS176 afaE).

Поглощение S. flexneri анализировали путем лизиса инфицированных клеток в 0,5% SDS/H 2 O. Серийные разведения клеточных лизатов высевали на чашки с бактоагаром с триптиказо-соевым бульоном без антибиотиков и инкубировали при 37°C в течение 24 час Подсчитывали колонии и определяли восстановление.

Коиммунопреципитация и иммуноблот-анализ

Иммунопреципитацию и иммуноблоты проводили с использованием 9E10-агарозы (Santa Cruz) по существу, как описано ранее [41].Клетки временно трансфицировали конструкциями SSh2 и экспрессионными плазмидами NOD1 или NOD2 в течение 24 часов. Используемые антитела: мышиные анти-Flag (Sigma, M2), мышиные анти-myc (Santa Cruz, 9E10), козьи антимышиные IgG, конъюгированные с HRP (Bio-Rad), и козьи антикроличьи IgG, конъюгированные с HRP (Bio-Rad). ), анти-SSh2 кролика (Abcam, 76943), антикофилин кролика P-S3 (Cell Signaling, 3313), антикофилин кролика (Cell Signaling, 5175), бета-актин кролика, конъюгированный с HRP (Santa Cruz, sc- 47778 HRP), кроличьи анти-альфа-тубулины (Sigma, T7816), кроличьи анти-GAPDH (Santa Cruz, 25778).

Репортер люциферазы анализирует

Активацию воспалительных путей измеряли с помощью репортерного анализа люциферазы, описанного ранее [16]. Средние значения и стандартные отклонения рассчитывали из трех повторов.

Получение РНК и ОТ-ПЦР

Тотальную РНК экстрагировали из клеток с использованием набора RNeasy (Qiagen). Один мкг РНК подвергали обратной транскрипции с использованием набора для синтеза кДНК First-Strand (Fermentas).

Для проведения количественного ПЦР анализировали 50 нг кДНК в общем объеме 25 мкл с использованием iQ SYBR Green Supermix (Bio-Rad) в соответствии с протоколом производителя.Все реакции количественной ПЦР проводили на циклере Bio-Rad iQ5, а данные оценивали с помощью системного программного обеспечения iQ5 (версия 2.0) с использованием метода ΔΔCT.

Для количественного определения SSh2 использовали следующие праймеры (5′-3′): CGTTGCGAAGACAGAATCAA и CTCCACAGTCGGAGAACCAT. Праймеры для IL-8, NOD1, NOD2 и GAPDH описаны в [37].

Непрямая иммунофлуоресцентная микроскопия

Клетки

трансфицировали с использованием липофектамина 2000 (Invitrogen). Через 16–24 ч инкубации клетки фиксировали и обрабатывали, как описано ранее [37].

ДНК

окрашивали с использованием DAPI. Изображения были получены на конфокальном микроскопе Olympus Fluoview 1000 и обработаны с помощью ImageJ.

Анализ близлежащего лигирования in situ

Анализ проксимального лигирования проводили с помощью системы Duolink (Olink bioscience). Клетки HeLa, выращенные на покрытых коллагеном покровных стеклах, трансфицировали и фиксировали через 24 ч после трансфекции в 4% параформальдегиде в течение 15 мин, промывали, пермеабилизировали 0,1% тритоном Х-100 и блокировали блокирующим буфером (Olink bioscience) в течение 30 мин при 37°С. С.Клетки инкубировали с первичными антителами (кроличьи GFP-специфические антитела и мышиные Flag-специфические антитела), разведенными в блокирующем буфере, в течение 2 часов. В качестве отрицательного контроля использовали клетки, трансфицированные GFP-SSh2 и Flag-NOD1, которые инкубировали в разбавителе антител без первичных антител. Инкубацию со вторичными антителами, лигирование и амплификацию проводили в соответствии с рекомендациями производителя. Клетки окрашивали с помощью HCS Cellmask темно-красного цвета (Life Technologies) и заключали в монтажную среду (Olink bioscience).Точки PLA были получены с помощью конфокального микроскопа LSM710 (Zeiss). Мечение F-актином (фаллоидин, связанный с Alexa633, Life Technologies) выполняли после окрашивания PLA. Количественную оценку точек PLA проводили с помощью автоматического обнаружения пятен PLA на основе HCS/HTS. Вкратце, изображения были получены с помощью системы WiSCAN Hermes (Idea Biomedical, Израиль), оснащенной объективом Olympus 20×0,75 NA. Количественный точечный анализ проводили с использованием программного обеспечения для анализа изображений WiSOFT (Idea Biomedical, Израиль).Клетки были сегментированы с помощью окрашивания маски клеток HCS в темно-красный цвет. После сегментации клетки были классифицированы на GFP-положительные и отрицательные клетки с использованием порога в зеленом канале. Пятна идентифицировали в красном канале и рассчитывали общую площадь, покрытую всеми пятнами в одной ячейке. Пятна за пределами клеточной маски не учитывались.

Обнаружение цитокинов методом ИФА

Измерение цитокинов проводили с использованием соответствующих наборов ELISA (Duoset, R&D) в соответствии с инструкциями производителя.Мультиплексный анализ цитокинов проводили с помощью проточной цитометрии с использованием набора 2plex для воспаления человека (eBioscience).

Статистический анализ

Данные анализировали с помощью двустороннего критерия Стьюдента с использованием Microsoft Excel 2007 и GraphPad Prism 5.04.

Крупномасштабный скрининг люциферазы siRNA NF-κB

Скрининг siRNA проводили с использованием библиотеки siRNA для лекарственного генома человека от Qiagen (Hilden, Германия), состоящей из четырех отдельных siRNA для каждого гена. Клетки HEK293T трансфицировали миРНК (20 нМ) с использованием HiPerFect (Qiagen) и обрабатывали TriDAP (0.5 мкМ, InvivoGen, Сан-Диего, Калифорния, США) или TNF (5 нг/мл), соответственно, в случае контрскрина.

Для скрининга использовали клетки с номером пассажа 2. Вся процедура анализа выполнялась автоматически с использованием лабораторной автоматизированной рабочей станции Biomek FXP (Beckman Coulter) в 384-луночных планшетах (Corning).

4 мкл 200 нМ миРНК (Qiagen) предварительно помещали на 384-луночные планшеты, чтобы обеспечить обратную трансфекцию клеток. Все планшеты содержали нецелевые (Allstars; Qiagen), а также siРНК p65, NOD1 и PLK в качестве внутреннего контроля.Для трансфекции 8 мкл среды на лунку смешивали с 0,25 мкл HiPerFect и добавляли к миРНК. Смеси инкубировали при комнатной температуре в течение 15 минут перед добавлением 1000 клеток HEK293T в 30 мкл среды.

После 48-часовой инкубации среду меняли и клетки трансфицировали репортерной системой NF-κB-люциферазы (11,6 нг плазмиды β-gal, 7,03 мкл плазмиды NF-κB-люциферазы, 0,135 нг NOD1-экспрессирующей плазмиды, 8,78 нг pcDNA- плазмиды и 0,0918 мкл Fugene6 (Roche)). Затем клетки стимулировали 0.5 мкМ TriDAP (InvivoGen) в объеме 3 мкл H 2 O. Для противоскрининга TNF вместо него добавляли 5 нг/мл TNF. После стимуляции клетки инкубировали при 37°С и 5% СО 2 в течение 16 часов.

Для считывания клетки лизировали, добавляя 30 мкл буфера для двукратного лизиса (50 мМ трис, pH 8,0, 16 мМ MgCl2, 2% тритона, 30% глицерина, H 2 O) и затем перемешивали пипеткой. Затем 35 мкл лизата добавляли в белый 384-луночный планшет, содержащий 35 мкл буфера для считывания (1× буфер для лизиса без тритона, содержащий 0.77 мкг/мл D-люциферина и 1,33 мМ АТФ). Затем измеряли биолюминесценцию образцов с помощью планшетного ридера Envision (PerkinElmer).

Для считывания β-gal к оставшемуся лизату добавляли 35 мкл буфера для проявления ONPG (4 мг/мл ONPG в 60 мМ Na2HPO4, 40 мМ Nah3PO4, 10 мМ KCl, 1 мМ MgSO4, pH 7,0). После 15-минутной инкубации при 37°C и 5% CO 2 абсорбция образцов при 405 нм автоматически измерялась с помощью планшетного ридера Envision (PerkinElmer). Каждую индивидуальную миРНК тестировали в четырех биологических повторностях.

THP1-синий экран киРНК

Для скрининга siRNAs были предварительно нанесены на 384-луночные планшеты для культивирования клеток. Все планшеты содержали миРНК Allstars, p65, NOD1 и PLK в качестве внутреннего контроля. Для трансфекции к миРНК добавляли 0,25 мкл HiPerFect. Смеси инкубировали при комнатной температуре в течение 15 минут, после чего добавляли клетки THP1-blue и 0,1 мкМ PMA (Sigma, Мюнхен, Германия). Клетки инкубировали в течение 72 ч, при этом питательную среду заменяли два раза в сутки.

Затем клетки стимулировали TriDAP (10 мкг/мл, InvivoGen).Клетки инкубировали в течение 16 часов перед считыванием. Для обнаружения SEAP 10 мкл супернатанта на лунку переносили в планшет, содержащий 50 мкл среды для обнаружения SEAP QUANTI-Blue (InvivoGen), и инкубировали в течение 5 часов. К оставшимся 10 мкл добавляли 10 мкл реагента ХТТ и инкубировали при 37°С в течение 1 часа. Поглощение при 632 нм и 485 нм соответственно измеряли с помощью планшетного ридера PerkinElmer EnVision.

Анализ данных скрининга киРНК

Данные обрабатывали с помощью пакета CellHTS2 [42], Bioconductor/R и Excel (Microsoft).Путем деления сигнала люциферазы (относительные световые единицы; RLU) на сигнал β-gal (ABS405) были получены нормализованные относительные световые единицы (RLU/ABS405 = nRLU). Чтобы исключить экспериментальные артефакты, все данные с данного планшета исключали, если средний сигнал β-гал нецелевых контролей (ABS405) был >2,5, <0,2 или имел стандартное отклонение >50%. Затем все лунки, демонстрирующие сигнал β-gal <40% от некодирующих контролей, предположительно из-за низкой эффективности плазмидной трансфекции или токсичности siRNA, были исключены из дальнейшего анализа.Затем nRLU нормализовали относительно ингибирующего эффекта p65-control-siRNA по сравнению с нецелевыми контролями (нормализованный процент ингибирования; NPI) и рассчитывали медианные z-показатели 4 биологических повторностей (отцентрированные по медиане нецелевых контролей). -управление таргетингом), используя CellHTS2.

На следующем этапе медианы z-показателей отдельных siRNA использовали для расчета ранжированного списка генов с использованием алгоритма анализа избыточных siRNA; гены с менее чем двумя хит-миРНК («OPI-хиты») были исключены (RSA) [17].Этот список включает гены, приводящие к снижению активности p65 при нокдауне (так называемые «ингибирующие удары»).

Для скрининга счетчиков TNF в клетках HEK293T, а также для проверки попаданий в клетки HEK293T и THP1 были отобраны 435 лучших ингибирующих попаданий. Для каждого из этих генов две siРНК, показавшие наиболее сильный эффект при скрининге, были повторно синтезированы и собраны на 384-луночных планшетах («планшеты для проверки»).

Для подтверждения результатов первичного скрининга эксперименты были повторены, как описано выше.Анализ данных с использованием CellHTS2 проводили, как описано выше; siРНК были выбраны как «ингибирующие попадание Tri-DAP», если их медиана Z-оценки превышала медиану нецелевых контролей более чем на два стандартных отклонения.

Чтобы исключить неспецифические совпадения, все миРНК, отобранные для проверки, подвергали скринингу на предмет их влияния на TNF-индуцированную активацию p65. Анализ данных был выполнен аналогично экрану проверки Tri-DAP. «Ингибирующие TNF-попадания» были исключены из дальнейшего анализа.

Данные синего экрана THP1 состоят из двух параметров (поглощение QUANTI-Blue при 632 нм для ответа Tri-DAP [QB] и поглощение XTT при 485 нм для жизнеспособности клеток [XTT]) и обрабатывались аналогично описанному выше: QB-сигнал каждой лунки нормализовали по жизнеспособности клеток (XTT), получая nQB (нормализованное поглощение QUANTI-Blue; QB/XTT = nQB).После контроля качества и пометки выбросов три лучших экспериментальных повтора были нормализованы по NPI к нецелевым и NOD1-контрольным миРНК с использованием CellHTS2, а медианы Z-показателей использовались для идентификации попаданий. Все гены с двумя миРНК, показывающими снижение стандартного отклонения >1,5 раза по сравнению с нецелевым контролем, считались подтвержденными ингибирующими совпадениями. Подмножество из них с одной миРНК, показывающей снижение стандартного отклонения >3,0 раз, было классифицировано как «сильные ингибирующие удары» (8 генов).

Номера доступа генов

SSh2: ID гена 54434; NOD1: ген ID 10392; NOD2: ген ID 64127; ROCK1: ген ID 6093; ROCK2: Ген ID 9475.

Дополнительная информация

Рисунок S2.

Анализ данных экрана. (A) Распределение нецелевого контроля (зеленый), положительного контроля (p65, оранжевый) и всех протестированных siRNAs (синий). Левая панель: Точечный график. Правая панель: Ранжированное представление всех хитов. (B) Обогащение генной онтологии (GO) из 435 предварительных генов-попаданий, извлеченных с помощью первичного скрининга, по сравнению с библиотекой генома для наркотиков (фон).Количество генов-попаданий связано с обогащенными терминами согласно ГО биологических процессов. Факторы обогащения и отрицательный логарифм (P-значения) указаны в скобках. (C) Известные регуляторы NF-κB, полученные с помощью экранов. Ingenuity Анализ путей 56 (из 435) предварительных ингибирующих скринингов, о которых уже известно, что они участвуют в регуляции NF-κB. Среди них 28 можно было проверить на экране проверки HEK (темно-красный: сильное попадание; светло-красный: слабое попадание; белый: не подтверждено). Подгруппа из 14 человек не влияла на TNF-α-индуцированную активацию NF-κB (синие границы).(D) Распределение миРНК на экране проверки THP1-синий. Каждая точка представляет собой медиану Z-показателя экспериментальных повторов после нормализации NPI (нормализованное процентное ингибирование) по отношению к внутренним NOD1-контролям планшета. Положительное значение представляет ингибирующий эффект соответствующей siRNA на активацию NF-κB. Хит-миРНК THP1 определяются как превышающие 1,5 SD. CTRL от медианы siРНК CTRL. Z-баллы были нормализованы для контрольных siRNAs, установленных на 0. CTRL: нецелевые контроли.(E) Анализ базы данных STRING по 28 совпадениям с экрана THP1. Genes, где значения NPI обеих siРНК превышали 1,5 S.D. CTRL от медианы CTRL считались подтвержденными. Более сильные ассоциации представлены более толстыми синими линиями. Гены были кластеризованы в соответствии с алгоритмом кластера Маркова (MCL). Связано с рис. 1.

https://doi.org/10.1371/journal.ppat.1004351.s002

(PDF)

Рисунок S3.

Валидация XIAP как важного компонента сигнального пути NOD1. (A) Клетки HEK293T трансфицировали CTRL или XIAP siRNA и инкубировали в течение 48 часов. Затем клетки трансфицировали экспрессионными плазмидами NOD1 (левая панель) или NOD2 (правая панель) с RPS-люциферазой NF-κB и стимулировали TriDAP (0,5 мкМ) или MDP (50 нМ) соответственно. Через 16 ч клетки лизировали, определяли активацию люциферазы и нормализовали значениями β-галактозидазы (nRLU). Значения средние + S.D. (n = 3). (B) Подтверждение нокдауна XIAP на уровне белка.Клетки HEK293T трансфицировали миРНК CTRL или XIAP. Через 72 часа клетки лизировали и определяли уровни белка XIAP с помощью вестерн-блоттинга с использованием XIAP-специфического антитела. Обнаружение GAPDH служило контролем нагрузки. (C) Дифференцированные клетки THP1-blue трансфицировали миРНК CTRL, NOD1, NOD2 или XIAP. Клетки инкубировали в течение 72 ч и затем стимулировали TriDAP или MDP (по 10 мкг/мл каждого), через 16 ч активацию NF-κB определяли путем измерения активности SEAP в супернатантах. (D) Параллельно с помощью ELISA определяли секрецию IL-8.Значения представляют собой активацию NF-κB [OD 620 ] или секрецию IL-8 [пг/мл], соответственно, среднее значение +SD (CTRL, XIAP: n = 3; NOD1, NOD2: n = 2). Данные репрезентативны как минимум для трех независимых экспериментов. Связано с рис. 1.

https://doi.org/10.1371/journal.ppat.1004351.s003

(PDF)

Рисунок S4.

Эффект нокдауна SSh2 в клетках THP1. PMA-дифференцированных клеток THP1 обрабатывали в течение 72 ч нецелевым (siCTRL) или двумя SSh2-специфичными дуплексами siRNA.(A) Секреция IL-8 измерялась с помощью ELISA после 16-часовой стимуляции TriDAP (10 мкг/мл), MDP (10 мкг/мл), TNF (0,1 мкг/мл) и/или LPS (0,05 мкг/мл). стимуляция. (B) Параллельно определяли уровни мРНК SSh2 с помощью количественной ПЦР из тех же клеток. Значения средние + стандартное отклонение. (n = 3) представитель не менее трех независимых экспериментов. * р<0,05. нс: не имеет значения. (C) Высвобождение цитокинов 20 соответствующих воспалительных цитокинов клеток в (A) после стимуляции TriDAP анализировали с помощью массива мультиплексных шариков.Изменения цитокинового ответа после истощения SSh2 с помощью siRNA показаны для белков с наибольшей индукцией. Связано с рис. 2.

https://doi.org/10.1371/journal.ppat.1004351.s004

(PDF)

Рисунок S5.

Фенотип нокдауна SSh2 в HeLa и первичных кожных фибробластах человека. (A) qPCR-анализ уровней SSh2 в эксперименте, показанном на рисунке 3C. (B) Иммуноблоттинг кофилина S3-фосфорлиирования в клетках HEK293T после нокдауна SSh2.(C) Первичные кожные фибробласты человека на ранних пассажах трансфицировали указанной миРНК в течение 72 часов, а затем обрабатывали TNF, TriDAP или инфицировали S.flexneri , а высвобождение IL-8 измеряли через 6 часов с помощью ELISA (верхняя панель). ). Уровень IL-8 в процентах по сравнению с клетками, обработанными нокдауном siCTRL SSh2, показан с помощью количественной ПЦР из тех же клеток (нижняя панель). Среднее + С.Д. (n = 3) показан представитель экспериментов с клетками двух разных доноров. Связано с рис. 3.

https://doi.org/10.1371/journal.ppat.1004351.s005

(PDF)

Рисунок S6.

СШ2 совмещается с Nod1. (A) Изображения непрямой иммунофлуоресценции клеток HeLa, экспрессирующих GFP-NOD1 и myc-SSh2. Сигнал NOD1 показан зеленым цветом на изображении слияния вместе с сигналом SSh2 красным цветом и окрашиванием ДНК синим цветом. (B) HCS/HTS – точечная количественная оценка на основе PLA. Изображения показывают сегментацию клеток с окрашиванием маски клеток HCS (синий канал). Классификация клеток в EGFP-SSh2 положительный/отрицательный (зеленый канал, указанный в синем канале) и автоматическое обнаружение PLA-пятна (красный канал).Масштабная линейка 25 мкм. (C) Количественная оценка сигналов PLA в клетках, экспрессирующих Flag-NOD1 и указанную конструкцию SSh2. На графике показано среднее ± SEM двух независимых экспериментов с более чем 850 проанализированными клетками на образец и эксперимент. (D) Количественное определение IL-8 в супернатантах клеток, проанализированных на рис. 4, панель F. Среднее значение + S.D. показана тройка. Связано с рис. 4.

https://doi.org/10.1371/journal.ppat.1004351.s006

(PDF)

Рисунок S7.

СШ2 не влияет на субклеточную локализацию NOD1 и NOD2. (A) Микрофотографии непрямой иммунофлуоресценции клеток HeLa, транзиторно трансфицированных NOD1 или NOD2, меченными Flag. Клетки обрабатывали нецелевой миРНК или миРНК, специфичной для SSh2, где указано. (B) Эффективность нокдауна показана иммуноблоттингом. Зондирование тубулина служило контролем нагрузки.

https://doi.org/10.1371/journal.ppat.1004351.s007

(PDF)

Рисунок S8.

Активность фосфатазы SSh2 участвует в передаче сигналов Nod1. (A) TNF-индуцированная активность NF-kB (закрашенные столбцы), измеренная с помощью репортерных анализов люциферазы в клетках HEK293T в течение 6 часов с ингибиторами ROCK Y-27632 и Glycyl-h2152.Влияние на базальную активность NF-κB показано незаштрихованными столбиками. Значения средние + S.D. (n = 3). * p<0,05, ** p<0,005 (двусторонний t-критерий Стьюдента по сравнению с имитацией обработанных клеток «0»). (B) Сверхэкспрессия SSh2 в клетках HEK293T. Активность NF-κB, измеренная с помощью репортерных анализов люциферазы. Значения средние + S.D. (n = 3). (C) Влияние экспрессии фосфатазо-мертвого мутанта (C393S) SSh2 на NOD1-опосредованную активность NF-κB, измеренную с помощью репортерных анализов люциферазы в клетках HEK293T. Клетки, индуцированные TriDAP, показаны в виде закрашенных столбцов, необработанные клетки, экспрессирующие только Nod1, показаны в виде незакрашенных столбцов.Значения средние + S.D. (n = 3). Связано с рис. 5.

https://doi.org/10.1371/journal.ppat.1004351.s008

(PDF)

Таблица S1.

Данные экрана. (A) Основанный на генах список ингибирующих результатов скрининга миРНК HEK293T. Гены ранжируются в соответствии со значениями logP, полученными путем применения алгоритма RSA к медианным Z-показателям четырех отдельных siРНК на ген. (B) Генный список попаданий, проверенных в клетках HEK293T. Гены ранжированы в соответствии со средним Z-показателем самой сильной siRNA.Гены, специфически участвующие в TriDAP-индуцированной активации NF-κB, выделены жирным шрифтом. (C) основанный на миРНК список данных, полученных в результате проверки трех вторичных скринингов и скрининга счетчиков с использованием клеток HEK293T, а также скрининга валидации THP1.

https://doi.org/10.1371/journal.ppat.1004351.s009

(XLSX)

Благодарности

Мы благодарим Martin Krönke за постоянную поддержку, Rike Zietlow (MPI-IB, Berlin) за критическое прочтение рукописи и Anna Damm (Кёльнский университет) за помощь в проведении экспериментов.

Вклад авторов

Задумал и спроектировал эксперименты: TAK AH NM TFM. Выполнены опыты: HB KL MM CB SAE SB. Проанализированы данные: TAK AH PRB NM TFM. Предоставленные реагенты/материалы/инструменты для анализа: MA HK PJS BZ. Написал статью: TAK AH HB KL.

Каталожные номера

  1. 1. Акира С., Уэмацу С., Такеучи О. (2006) Распознавание патогенов и врожденный иммунитет. Ячейка 124: 783–801.
  2. 2. Морейра Л.О., Замбони Д.С. (2012)Передача сигналов NOD1 и NOD2 при инфекции и воспалении.Фронт Иммунол 3: 328.
  3. 3. Ting JP, Duncan JA, Lei Y (2010)Как невоспалительные NLR функционируют в системе врожденного иммунитета. Наука 327: 286–290.
  4. 4. Chamaillard M, Hashimoto M, Horie Y, Masumoto J, Qiu S, et al. (2003) Существенная роль NOD1 в распознавании хозяином бактериального пептидогликана, содержащего диаминопимелиновую кислоту. Нат Иммунол 4: 702–707.
  5. 5. Жирардин С.Е., Бонека И.Г., Карнейро Л.А., Антигнак А., Джеханно М. и соавт. (2003) Nod1 обнаруживает уникальный муропептид из пептидогликана грамотрицательных бактерий.Наука 300: 1584–1587.
  6. 6. Жирарден С.Е., Турнебиз Р., Маврис М., Пейдж А.Л., Ли Х и др. (2001) CARD4/Nod1 опосредует активацию NF-kappaB и JNK инвазивными Shigella flexneri. EMBO Реп. 2: 736–742.
  7. 7. Криг А., Корреа Р.Г., Гаррисон Дж.Б., Ле Неграт Г., Уэлш К. и др. (2009) XIAP опосредует передачу сигналов NOD посредством взаимодействия с RIP2. Proc Natl Acad Sci U S A 106: 14524–14529.
  8. 8. Бертран М.Дж., Дуарон К., Лаббе К., Корнелюк Р.Г., Баркер П.А. и соавт.(2009) Клеточные ингибиторы апоптоза cIAP1 и cIAP2 необходимы для передачи сигналов врожденного иммунитета рецепторами распознавания образов NOD1 и NOD2. Иммунитет 30: 789–801.
  9. 9. Куфер Т.А., Креммер Э., Адам А.С., Филпотт Д.Дж., Сансонетти П.Дж. (2008) Молекула распознавания образов Nod1 локализована на плазматической мембране в местах взаимодействия бактерий. Cell Microbiol 10: 477–486.
  10. 10. Keestra AM, Winter MG, Auburger JJ, Frassle SP, Xavier MN, et al. (2013) Манипулирование малыми Rho GTPases — это патоген-индуцированный процесс, обнаруженный NOD1.Природа 496: 233–237.
  11. 11. Фуказава А., Алонсо С., Курачи К., Гупта С., Лессер К.Ф. и др. (2008) GEF-h2 опосредовал контроль NOD1-зависимой активации NF-kappaB эффекторами Shigella. PLoS Pathog 4: e1000228.
  12. 12. Eitel J, Krull M, Hocke AC, N’Guessan PD, Zahlten J, et al. (2008)Beta-PIX и Rac1 GTPase опосредуют транспортировку и негативную регуляцию NOD2. Дж. Иммунол 181: 2664–2671.
  13. 13. Легран-Поэлс С., Кустерманс Г., Бекс Ф., Креммер Э., Куфер Т.А. и соавт.(2007) Модуляция Nod2-зависимой передачи сигналов NF-kappaB актиновым цитоскелетом. J Cell Sci 120: 1299–1310.
  14. 14. Липински С., Грабе Н., Джейкобс Г., Биллманн-Борн С., Тилль А. и др. (2012)Скрининг RNAi идентифицирует медиаторы передачи сигналов NOD2: последствия для пространственной специфичности распознавания MDP. Proc Natl Acad Sci U S A 109: 21426–21431.
  15. 15. Mizuno K (2013)Сигнальные механизмы и функциональные роли фосфорилирования и дефосфорилирования кофилина.Сотовый сигнал 25: 457–469.
  16. 16. Zurek B, Bielig H, Kufer TA (2011)Репортерный анализ на основе клеток для анализа активации Nod1 и Nod2. Методы Мол Биол 748: 107–119.
  17. 17. Konig R, Chiang CY, Tu BP, Yan SF, DeJesus PD, et al. (2007)Подход, основанный на вероятности, для анализа крупномасштабных экранов РНКи. Нат-методы 4: 847–849.
  18. 18. Дамгаард Р.Б., Нахбур У., Ябал М., Вонг В.В., Филил Б.К. и др. (2012)Убиквитинлигаза XIAP рекрутирует LUBAC для передачи сигналов NOD2 при воспалении и врожденном иммунитете.Мол Ячейка 46: 746–758.
  19. 19. Kim ML, Jeong HG, Kasper CA, Arrieumerlou C (2010)IKKalpha способствует канонической активации NF-kappaB после распознавания пептидогликана, опосредованного Nod1. PLoS One 5: e15371.
  20. 20. Warner N, Burberry A, Franchi L, Kim YG, McDonald C и др. (2013) Полногеномный скрининг siRNA выявляет положительные и отрицательные регуляторы сигнальных путей NOD2 и NF-kappaB. Научный сигнал 6: rs3.
  21. 21. Huang TY, DerMardirossian C, Bokoch GM (2006)Кофилинфосфатазы и регуляция динамики актина.Curr Opin Cell Biol 18: 26–31.
  22. 22. Kurita S, Watanabe Y, Gunji E, Ohashi K, Mizuno K (2008)Молекулярный анализ механизмов распознавания субстрата и опосредованной F-актином активации кофилин-фосфатазы Slingshot-1. J Biol Chem 283: 32542–32552.
  23. 23. Yamamoto M, Nagata-Ohashi K, Ohta Y, Ohashi K, Mizuno K (2006)Идентификация множественных сайтов связывания актина в кофилин-фосфатазе Slingshot-1L. FEBS Lett 580: 1789–1794.
  24. 24.Дай С., Сармьер П.Д., Вигган О., Бамбург Дж.Р., Чжоу Д. (2004)Эффективное проникновение сальмонеллы требует циклов активности хозяина ADF и кофилина. Cell Microbiol 6: 459–471.
  25. 25. Olayioye MA, Barisic S, Hausser A (2013)Многоуровневый контроль динамики актина с помощью протеинкиназы D. Cell Signal 25: 1739–1747.
  26. 26. Kustermans G, El Benna J, Piette J, Legrand-Poels S (2005)Нарушение динамики актина вызывает активацию NF-kappaB в миеломоноцитарных клетках через NADPH-оксидазозависимый путь.Биохим J 387: 531–540.
  27. 27. Кустерманс Г., Эль Мджияд Н., Хорион Дж., Джейкобс Н., Пиетт Дж. и др. (2008)Актиновый цитоскелет дифференциально модулирует NF-kappaB-опосредованную экспрессию IL-8 в миеломоноцитарных клетках. Биохим Фармакол 76: 1214–1228.
  28. 28. Abbott DW, Yang Y, Hutti JE, Madhavarapu S, Kelliher MA, et al. (2007)Координированная регуляция Toll-подобного рецептора и передачи сигналов NOD2 с помощью K63-связанных полиубиквитиновых цепей. Мол Селл Биол 27: 6012–6025.
  29. 29.Хасэгава М., Фудзимото Ю., Лукас П.С., Накано Х., Фукасе К. и др. (2008)Критическая роль полиубиквитинирования RICK/RIP2 в Nod-индуцированной активации NF-kappaB. EMBO J 27: 373–383.
  30. 30. Бьянки К., Мейер П. (2009)Запутанная паутина цепей убиквитина: последние новости в передаче сигналов TNF-R1. Мол Ячейка 36: 736–742.
  31. 31. Хайден М.С., Гош С. (2008)Общие принципы передачи сигналов NF-kappaB. Ячейка 132: 344–362.
  32. 32. Андре М., Сигер Дж. М., Шулл С., Кутель О., Вагнер-Стиппих Д. и др.(2014) BID-зависимое высвобождение митохондриального SMAC ослабляет XIAP-опосредованный иммунитет против Shigella. EMBO J. в печати.
  33. 33. Ерецян Г., Корреа Р.Г., Дойрон К., Фитцджеральд П., Диллон С.П. и др. (2011) Неапоптотическая роль BID в воспалении и врожденном иммунитете. Природа 474: 96–99.
  34. 34. Регейро В., Моранта Д., Франк К.Г., Ларрарте Э., Маргарето Дж. и др. (2011) Klebsiella pneumoniae подавляет активацию воспалительных реакций NOD1-зависимым образом.Cell Microbiol 13: 135–153.
  35. 35. Арбибе Л., Мира Дж. П., Теуш Н., Клайн Л., Гуха М. и др. (2000) Опосредованная Toll-подобным рецептором 2 активация NF-каппа B требует Rac1-зависимого пути. Нат Иммунол 1: 533–540.
  36. 36. Porter K, Shimono M, Tian M, Day B (2012) Фактор деполимеризации актина-4 арабидопсиса связывает восприятие патогена, активацию защиты и транскрипцию с динамикой цитоскелета. PLoS Патог 8: e1003006.
  37. 37. Меннинг М., Куфер Т.А. (2013)Роль анкиринового повтора, содержащего белок Ankrd17, в Nod1- и Nod2-опосредованных воспалительных реакциях.FEBS Lett 587: 2137–2142.
  38. 38. Zigrino P, Drescher C, Mauch C (2001) Коллаген-индуцированная активация proMMP-2 с помощью MT1-MMP в дермальных фибробластах человека и возможная роль интегринов альфа2бета1. Eur J Cell Biol 80: 68–77.
  39. 39. Баришич С., Нагель А.С., Франц-Вахтель М., Мацек Б., Прейсс А. и др. (2011) Фосфорилирование Ser 402 препятствует активности фосфатазы рогатки 1. EMBO Rep 12: 527–533.
  40. 40. Ишизаки Т., Наито М., Фудзисава К., Маекава М., Ватанабэ Н. и др.(1997) p160ROCK, Rho-ассоциированная протеинкиназа, образующая спиральную спираль, работает ниже Rho и индуцирует фокальные адгезии. Письмо ФЭБС 404: 118–124.
  41. 41. Куфер Т.А., Креммер Э., Бэнкс Д.Дж., Филпотт Д.Дж. (2006)Роль эрбина в бактериальной активации Nod2. Infect Immun 74: 3115–3124.
  42. 42. Бутрос М., Брас Л.П., Хубер В. (2006)Анализ клеточных экранов РНКи. Геном Биол 7: R66.

Лаборатория Канга: Новости

 

С Днем Благодарения от лаборатории Канг-Ву!

Опубликовано 26.11.21

 
 

Тереза ​​Ки получила награду за лучший стендовый доклад на 7-м ежегодном семинаре отделения патологии!

Опубликовано 06.11.21

Тереза ​​Ки была награждена за постерную презентацию на тему «Определение роли мутации CHCHD2 T61I в патогенезе телец Леви».Поздравляем Терезу!

 
 

Новости!

Опубликовано 06.08.21

Мы переехали в Университет Кейс Вестерн Резерв в Кливленде. ОЙ! Наша лаборатория наконец обустроена! Мы рады продолжать проводить высокоэффективные исследования в замечательном новом университете!

 
 

Тереза ​​Ки успешно сдала комплексный квалификационный экзамен!

Опубликовано 05.06.21

Мы очень рады, что Тереза ​​успешно сдала CQE! Поздравляем Ф.Кандидат D Тереза!

 

Новая публикация!

Опубликовано 22.04.21

Митохондриальный CHCHD2: связанные с болезнью мутации, физиологические функции и современные модели животных.

https://pubmed.ncbi.nlm.nih.gov/33967741/

 

Сара Каззаро получила стипендию Дороти Бенджамин для выпускников!

Опубликовано 11.01.21

Сара Каззаро получила стипендию Дороти Бенджамин по изучению болезни Альцгеймера благодаря ее целенаправленному изучению белка Slingshot 1 (SSh2) и его влияния на митохондрии в контексте болезни Альцгеймера.

https://health.usf.edu/medicine/byrd

 

Доктор Канг, аспирант Ценсяо Фанг и команда отметили на веб-сайте USF Health новое открытие способности фермента SSh2.

Опубликовано 12.10.20

В этой статье рассматривается открытие доктором Кангом и его командой дефекта на ранней стадии аутофагии, который может помочь в разработке ингибиторов SSh2 для лечения болезни Альцгеймера и других нейродегенеративных заболеваний.

https://hscweb3.hsc.usf.edu/blog/2020/10/12/энзим-ssh2-нарушает-удаление-накопления-клеточного-мусора-ведущего-к-смерти-клеток-мозга/

 

Доктор Дэвид Канг и доктор Алекса Ву возглавить исследовательский проект, финансируемый NIH!

Опубликовано 15.07.20

Доктор Канг является директором отдела фундаментальных исследований Института Берда и профессором молекулярной медицины. Доктор Ву, также исследователь Берда, является доцентом кафедры молекулярной фармакологии и физиологии.Новый проект R01 направлен на то, чтобы понять, как USP11, многофункциональный фермент, который, как известно, удаляет цепи убиквитина из белков, способствует патологии клубков тау при развитии болезни Альцгеймера (БА).

 

Новая публикация!

Опубликовано 05.05.20

CHCHD10-регулируемый комплекс OPA1-митофилин опосредует индуцированные TDP-43 митохондриальные фенотипы, связанные с лобно-височной деменцией.

https://pubmed.ncbi.nlm.nih.gov/32369233/

 

Сара Каззаро успешно сдала комплексный квалификационный экзамен!

Опубликовано 02.04.20

Мы очень рады, что Сара сдала комплексный квалификационный экзамен.Поздравляем кандидата наук. кандидат Сара Каззаро!

 

Следующие шаги ускорят работу нашего исследовательского центра AD.

Опубликовано 24.02.20

В этой статье рассматриваются основные задачи Центра Берда Альцгеймера и то, как они применяются для борьбы с дименцией.

https://hscweb3.hsc.usf.edu/blog/2020/02/24/next-steps-needed-to-build-a-world-class-alzheimers-disease-research-center/

 

Лаборатория Ву и Канга отмечена на веб-сайте USF Health!

Опубликовано 17.02.20

В этой статье, написанной Энн ДеЛотто Байер, обсуждается, как доктор.Алекса Ву и ее команда исследуют влияние бета-аррестина2 на накопление тау-нейротоксина и то, как он вызывает формы деменции.

https://hscweb3.hsc.usf.edu/blog/2020/02/17/beta-arrestin-2-increases-neurotoxic-tau-driving-frontotemporal-dementia/

 

Д-р Канг и Д-р. Публикация Woo Cofilin.

Опубликовано 27.12.19

Доктор Канг и доктор Ву опубликовали свою статью о кофилине и о том, как он является главным узлом, регулирующим цитоскелетный патогенез при болезни Альцгеймера.

https://www.ncbi.nlm.nih.gov/pubmed/31594228

 

Цэньсяо Фан успешно защищает кандидатскую диссертацию!

Опубликовано 03.12.19

Для нас большая честь иметь доктора Дуглас Р. Грин в качестве внешнего председателя Cenxiao, где она успешно защитила свою докторскую диссертацию. В настоящее время она учится в Университете Миннесоты для прохождения постдокторской подготовки в лаборатории доктора Майкла Ли. Поздравляем Кэтрин!

 

Ян Ян — один из двух человек, получивших стипендию Дороти Бенджамин по болезни Альцгеймера.

Опубликовано 15.11.19

Ян заявляет, что для нее большая честь получить стипендию Дороти Бенджамин по болезни Альцгеймера.

https://health.usf.edu/medicine/byrd

 

Публикация статьи о двойной роли кофилина.

Опубликовано 24.10.19

Д-р Канг, д-р Ву и их команда опубликовали статью о двойной роли кофилина в распространении АРР и клиренсе β-амилоида.

https://www.ncbi.nlm.nih.gov/pubmed/31646885

 

Лаборатория Woo отмечена в новостях USF Health!

Опубликовано 20.09.19

В этой статье, написанной Энн ДеЛотто Байер, обсуждается исследование доктора Ву и ее лаборатории B-аррестина и его влияния на болезнь Альцгеймера.

https://hscweb3.hsc.usf.edu/blog/2019/09/20/neuroscientist-targets-b-arrestins-with-the-aim-of-arresting-alzheimers-disease/

 

Лаборатория Канга отмечена на веб-сайте USF Health!

Опубликовано 21.06.19

В статье, написанной Энн ДеЛотто Байер, д-р.Дэвид Канг и его команда обсуждают основные направления своего исследования.

https://hscweb3.hsc.usf.edu/blog/2019/06/21/david-kang-probes-brain-changes-in-aging-that-tip-the-balance-toward-dementia/

 

Были изложены цели исследований и стратегии набора преподавателей в Центр Берда Альцгеймера.

Опубликовано 03.06.19

На веб-сайте USF Health была опубликована недавняя статья, в которой излагаются основные цели исследований и стратегии найма в Byrd Institude.

https://hscweb3.hsc.usf.edu/blog/2019/06/03/byrd-alzheimers-center-basic-research-objectives-and-faculty-recruitment-strategy/

 

Новая публикация в статье USF Health!

Опубликовано 13.05.19

Самая последняя публикация лаборатории Канга, в которой кофилин и тау-белки связаны с болезнью Альцгеймера, была кратко изложена в недавней статье USF Health.

https://hscweb3.hsc.usf.edu/blog/2019/05/13/cofilin-may-be-early-culprit-in-taupathia-process-leading-to-brain-cell-death/

 

Наша сводная фигура на обложке HMG!

Опубликовано 07.10.17

Обобщающий рисунок для нашей статьи под названием: Усиление тау-патологии посредством комплексов шаперонов RanBP9 и Hsp90/Hsc70 представлен на обложке текущего выпуска Human Molecular Genetics. На этом рисунке показано, как в патогенных условиях повышение уровня RanBP9 способствует ассоциации тау-белка с комплексами Hsp90/Hsc70. Это способствует олигомеризации тау за счет уменьшения деградации тау, что в конечном итоге приводит к повреждению синапсов и заболеванию.

https://academic.oup.com/hmg/issue/26/20

 

Лаборатория Канга представлена ​​в статье USF Health

Опубликовано 04.10.17

Наше исследование природы и функции мутаций CHCHD10, связанных с БАС, описано в этой статье, написанной Вьоллкой Хисенликой 29 сентября 2017 года.Статью можно прочитать здесь:

https://hscweb3.hsc.usf.edu/blog/2017/09/29/research-usf-health-reveals-als-ftd-gene-link-pathology/

 

Активный кофилин способствует апоптозу через p53

Опубликовано 14.09.17

В этом исследовании мы описываем механизм индуцированного кофилином апоптоза посредством транслокации р53 в ядро ​​и митохондрии.

Abstract
Накопление β-амилоида (Aβ) является ранним событием в патогенезе болезни Альцгеймера (БА), приводящим к митохондриальной и синаптической дисфункции, накоплению тау и возможной гибели нейронов.В то время как путь апоптоза р53 явно связан с отложениями Aβ и апоптозом нейронов, критические восходящие факторы, способствующие активации р53 при БА, недостаточно изучены. Ранее мы показали, что активация кофилина играет ключевую роль в Aβ-индуцированной митохондриальной и синаптической дисфункции. В этом исследовании мы показываем, что активированный кофилин (S3A) преимущественно образует комплекс с р53 и способствует его митохондриальной и ядерной локализации, что приводит к транскрипции р53-чувствительных генов и стимуляции апоптоза.Наоборот, снижение эндогенного кофилина путем нокдауна или генетической недостаточности ингибирует митохондриальную и ядерную транслокацию р53 в культивируемых клетках и у мышей APP/PS1. Этот проапоптотический путь кофилин-р53 подвергается негативной регуляции с помощью PLD1 посредством инактивации кофилина и ингибирования образования комплекса кофилин/р53. Наконец, активированный кофилин не способен индуцировать апоптоз в клетках, генетически лишенных p53. Эти находки, вместе взятые, указывают на то, что cofilin кооптируется и нуждается в ядерной и митохондриальной проапоптотической программе p53, чтобы индуцировать и выполнять апоптоз, в то время как PLD1 функционирует в качестве регуляторной мультитормозной способности в этом пути.

https://www.ncbi.nlm.nih.gov/pubmed/285

 

Новая публикация по молекулярной генетике человека

Опубликовано 18.07.17

В этой новой статье описывается, как каркасный белок RanBP9 передает индуцированные Aβ нейротоксические сигналы тау.

Abstract
Накопление бета-амилоида (Aβ) и тау представляет собой два основных патологических признака болезни Альцгеймера (БА). Несмотря на критическую важность накопления Aβ как раннего события в патогенезе БА, многочисленные линии доказательств указывают на то, что тау необходим для опосредования Aβ-индуцированных нейротоксических сигналов в нейронах.Ранее мы показали, что каркасный белок Ran-связывающий белок 9 (RanBP9), который сильно повышен в мозге моделей мышей с БА и БА, одновременно усиливает выработку Aβ и опосредует вызываемую Aβ нейротоксичность. Однако неизвестно, передает ли и каким образом RanBP9 нейротоксические сигналы, индуцированные Aβ, на тау. Здесь мы впервые показываем, что сверхэкспрессия или нокдаун RanBP9 напрямую увеличивает и снижает уровни тау, соответственно, in vitro и in vivo. Такие изменения уровней тау связаны со способностью RanBP9 физически взаимодействовать с комплексами тау и белка теплового шока 90/родственного белка теплового шока 70 (Hsp90/Hsc70).Между тем, уровни как RanBP9, так и тау одновременно снижаются под действием ингибиторов Hsp90 или Hsc70, тогда как избыточная экспрессия или нокдаун RanBP9 значительно снижает эффективность анти-тау ингибиторов Hsp90/Hsc70, а также вариантов Hsc70 (WT и E175S). Кроме того, RanBP9 увеличивает способность комплексов Hsp90 и Hsc70 связывать АТФ и усиливает их АТФазную активность in vitro. Эти наблюдения in vitro и клеточных линиях повторяются в первичных нейронах и in vivo, поскольку генетическая редукция RanBP9 не только улучшает таупатию у мышей Tau-P301S, но также восстанавливает дефицит синаптической целостности и пластичности.

https://doi.org/10.1093/hmg/ddx284

 

Лаборатория Канга представлена ​​в статье ALZForum

Опубликовано 26.06.17

Наше исследование природы и функции мутаций CHCHD10, связанных с БАС, недавно было описано в статье Пэта МакКэффри для Alzforum от 24 июня 2017 года. Вы можете прочитать статью здесь:

http://www.alzforum.org/ новости/исследования-новости/alsftd-genes-reveal-pathways-pathology

 

CHCHD10, TDP-43 и Synaptic Integrity

Опубликовано 06.06.17

Мы рады объявить о публикации нашей работы по CHCHD10 в цитоплазматическом накоплении TDP-43 и синаптической целостности в Nature Communications .

Abstract
Хотя множественные мутации CHCHD10 связаны со спектром семейных и спорадических лобно-височных деменций и бокового амиотрофического склероза (FTD-ALS), ни нормальная функция эндогенного CHCHD10, ни его роль в патологической среде (т.е. патология TDP-43) ЛВД/БАС. В этом исследовании мы провели серию наблюдений с использованием моделей Caenorhabditis elegans, клеточных линий млекопитающих, первичных нейронов и мозга мышей, продемонстрировав, что CHCHD10 в норме играет защитную роль в митохондриальной и синаптической целостности, а также в сохранении ядерного TDP-43. тогда как мутации, связанные с FTD/ALS (R15L и S59L), демонстрируют фенотипы потери функции у C.elegans анализы генетической комплементации и доминирующая негативная активность в системах млекопитающих, что приводит к повреждению митохондрий/синапсов и накоплению TDP-43 в цитоплазме. Таким образом, наши результаты обеспечивают патологическую связь между митохондриальной/синаптической дисфункцией, связанной с CHCHD10, и цитоплазматическими включениями TDP-43.

https://www.nature.com/articles/ncomms15558

 

Публикация нашего метода выделения экзосом

Опубликовано 17.05.17

Мы рады объявить о публикации нашего протокола выделения экзосом и микровезикул из иммортализованных клеток HT22 и первичных кортикальных нейронов для протеомного анализа в Методах молекулярной биологии .

Abstract
Экзосомы и микровезикулы представляют собой внеклеточные везикулы (ВВ), высвобождаемые большинством типов клеток. Роль EV как метода межклеточной коммуникации привела к тому, что эти везикулы стали основной областью интереса в различных научных областях, включая нейробиологию. В настоящее время появляются новые данные, свидетельствующие о том, что биомолекулярный состав электромобилей, особенно экзосом, может играть роль в прогрессировании заболеваний, включая различные нейродегенеративные заболевания и рак.В дополнение к профилям микроРНК EV эти везикулы также демонстрируют интересные изменения в профилях экспрессии белков при различных физиологических и патологических состояниях. Характеристика этих профилей может оказаться полезной как для понимания патогенеза заболевания, так и для открытия новых биомаркеров заболевания. В этой главе мы описываем протокол выделения экзосом и микровезикул из иммортализованных клеток HT22 и первичных кортикальных нейронов с достаточным выходом и низким уровнем загрязнения сывороткой, необходимыми для последующего анализа и относительного количественного определения без меток с помощью масс-спектрометрии.

https://www.ncbi.nlm.nih.gov/pubmed/28508366

 

Предстоящий CQE: Cenxiao Fang

Опубликовано 17.04.17

Обновление от 25.04.17: Поздравляем Cenxiao Fang с получением кандидатской диссертации!

«Slingshot Homolog 1 нарушает митофагию посредством SQSTM1/P62»

Вторник, 25 апреля 2017 г., 12:00. in ALZ 101

Члены комитета:
Кевин Нэш, доктор философии
Ю Чен, доктор философии
Джун Тан, доктор медицины, доктор философии

Председатель:
Паула Бикфорд, доктор философии

 

Исследовательский коллоквиум студентов USF

Опубликовано 06.04.17

Поздравляем сотрудников нашей лаборатории, представивших стендовые доклады на Коллоквиуме студентов в этом году!

«Роль кофилина в тауопатиях»
Тереза ​​ки

«Предварительное исследование мутаций CHCHD10, связанных с БАС, с использованием C.Элеганс как модель»
Тамара Мангал, Юэ Чжан и Медина Дзафери

 

Уязвимость PuTTY vuln-ssh2-short-rsa-keys

Уязвимость PuTTY vuln-ssh2-short-rsa-keys

Дом | Часто задаваемые вопросы | Обратная связь | Лицензия | Обновления | Зеркала | Ключи | Ссылки | Команда
Скачать: Стабильный · Предварительный выпуск · Снимок | Документы | Изменения | Список желаний

Сводка : Уязвимость: переполнение буфера в SSH-1, если сервер отправляет два крошечных ключа RSA
class : уязвимость: Это уязвимость системы безопасности.
сложность : удовольствие: Только нужны уроки, и их немного.
приоритет : высокий: Это должно быть исправлено в следующем выпуске.
присутствует в : 0,43 0,44 0,45 0,46 0,47 0,48 0,49 0,50 0,51 0,52 0,53 0,55 0.53b 0,56 0,54 0,57 0,58 0,59 0,60 0,61 0,62 0,63 0,64 0,65 0,66 0,67 0,68 0,69 0,70 0,71
фиксированной в : c191ff129cd3415af08143fb40c461de5730655d (0,72)

Все версии пакета PuTTY до 0.72 имеют повреждение памяти. ошибка в обмене ключами SSH-1, которая может привести к нарушению безопасности уязвимость.

Во время обмена ключами SSH-1 сервер отправляет пакет, содержащий RSA ключ хоста и ключ сервера RSA. PuTTY выделит буфер размером большего ключа, а затем записать в него случайный 32-байтовый идентификатор сеанса, перед шифрованием идентификатора сеанса с помощью обоих ключей в последовательности.

Ошибка возникает, если вредоносный сервер отправляет хост и сервер RSA ключи, которые короче 32 байт, и в этом случае выделенный буфер также будет меньше 32 байт, и первоначальная запись идентификатор сеанса переполнит буфер.

У нас нет доказательств того, что это может быть использовано для запуска удаленного кода. исполнение. Данные, записанные в слишком маленький буфер, состоят из PuTTY, а не сервером. Но, с другой стороны, мы этого не знаем. он не может разрешить выполнение кода.

Ошибка возникает до проверки ключа хоста. (PuTTY проверяет хост ключ перед выполнением шифрования с его помощью, но, к сожалению, не перед начальной записью в буфер, который он собирается зашифровать in.) Таким образом, сетевой злоумышленник, перехватывающий ваше соединение, может атаковать PuTTY через эту уязвимость, прежде чем он будет обнаружен как ненастоящий сервер.

Эта ошибка затрагивает только устаревший протокол SSH-1, который редко используется. В PuTTY 0.68 и более поздних версиях мы больше не поддерживает автоматический переход к SSH-1 из SSH-2, поэтому любой сохраненный сеанс настроенный по умолчанию SSH-2, не будет уязвим для этого проблема.

Эта уязвимость была обнаружена как часть программа поощрения ошибок работает под под эгидой проекта ЕС-ФОССА; видеть #630642 в их трекер.


Если вы хотите прокомментировать этот веб-сайт, см. Страница обратной связи.

(последняя версия этой записи об ошибке была 2020-01-11 14:47:27 +0000)

Атлас киназы

Название белка
Серин/треонин-протеинкиназа PAK 4
Имя гена
ПАК4
Организм
Хомо сапиенс
Функция
Серин/треониновая протеинкиназа, которая играет роль во множестве различных сигнальных путей, включая регуляцию цитоскелета, миграцию клеток, рост, пролиферацию или выживание клеток.Активация различными эффекторами, включая рецепторы фактора роста или активные CDC42 и RAC1, приводит к изменению конформации и последующему аутофосфорилированию нескольких остатков серина и/или треонина. Фосфорилирует и инактивирует протеинфосфатазу SSh2, что приводит к усилению ингибирующего фосфорилирования актин-связывающего/деполимеризующего фактора кофилина. Снижение активности кофилина может привести к стабилизации актиновых филаментов. Фосфорилирует LIMK1, киназу, которая также ингибирует активность кофилина.Фосфорилирует интегрин бета5/ITGB5 и таким образом регулирует подвижность клеток. Фосфорилирует ARHGEF2 и активирует расположенную ниже RHOA-мишень, которая играет роль в регуляции сборки фокальных адгезий и актиновых стрессовых волокон. Стимулирует выживание клеток путем фосфорилирования антагониста BCL2 клеточной гибели BAD. Альтернативно, ингибирует апоптоз, предотвращая связывание каспазы-8 с рецепторами домена смерти независимым от киназы образом. Играет роль в развитии клеточного цикла, контролируя уровни регуляторного белка клеточного цикла CDKN1A и фосфорилируя RAN.
Сайт Максимальная численность согласованного сайта Минимальная численность населения сайта консенсуса Медиана согласованного населения сайта
МТ3 25 1 14,0
АТП 18 2 11.0
ДЕФ 2 2 2,0
МПП 27 2 17,0
PDIG 18 2 6,0
Фунт стерлингов 11 2 3.0
ПИФ 13 13 13,0
ДРС 22 2 18,0
СМР 21 3 13,0
ДФГ 19 5 7.5
Идентификатор PDB Максимальная численность согласованного сайта
Сайт МТ3 Сайт ААС Сайт ЭОД Сайт АТФ Сайт DEF МПП сайт Сайт PDIG ПМП сайт Сайт LBP Сайт ФПИ Сайт DRS CMP сайт Сайт DFG
Всего структур, поддающихся лечению лекарствами, на объект 13 0 0 11 0 21 1 0 0 0 22 5 1
4JDI 17 0 0 18 0 19 0 0 0 0 17 12 7
4НЖД 17 0 0 16 0 19 18 0 0 0 21 0 0
2X4Z 15 0 0 15 0 21 0 0 3 0 16 12 0
4ЖДК 14 0 0 17 0 17 5 0 0 0 18 13 0
2БВА 10 0 0 16 0 27 3 0 11 13 18 13 0
4JDH 10 0 0 16 0 16 4 0 0 0 16 12 0
4FIJ 16 0 0 0 0 16 3 0 0 0 22 11 0
4ФИЭ 16 0 0 15 0 17 8 0 0 0 16 16 0
4FIH 10 0 0 3 0 16 8 0 0 0 20 0 0
2CDZ 7 0 0 10 0 0 3 0 2 0 20 17 19
4РИС 24 0 0 3 0 18 0 0 0 0 21 21 0
4ПРИЛОЖЕНИЕ 15 0 0 17 0 15 9 0 7 0 19 14 0
4O0Y 16 0 0 17 0 16 8 0 0 0 15 14 0
4Л67 25 0 0 8 0 18 14 0 0 0 16 10 0
5БМС 15 0 0 16 0 18 0 0 0 0 19 14 0
4ФИФ 18 0 0 3 2 17 0 0 0 0 19 16 8
4XBR 16 0 0 0 0 16 2 0 0 0 7 17 0
400В 19 0 0 16 0 16 13 0 0 0 19 13 0
2J0I 19 0 0 11 0 16 6 0 0 0 19 0 0
4FII 13 0 0 2 0 18 0 0 2 0 18 3 0
4JDJ 10 0 0 17 0 17 3 0 0 0 20 11 8
4XBU 19 0 0 3 0 18 4 0 0 0 18 12 0
4O0X 21 0 0 16 0 18 15 0 0 0 18 0 0
2Q0N 15 0 0 9 0 13 0 0 0 0 18 13 5

Kinase Atlas следует использовать только в некоммерческих целях

Лаборатория Вайда, Бостонский университет
и
ABC Group, Университет Стоуни-Брук

Слитый белок SSh2 Ag24579 | Proteintech

Восстановление Восстановить в 0.25 мкг/мкл в 200 мкл стерильной воды для кратковременного хранения.
Восстановление 200 мкл 50% раствора глицерина рекомендуется на более длительный срок. хранилище (дополнительную информацию см. в разделе Стабильность и хранение).
Если для ваших целей требуется другая концентрация, отрегулируйте растворение. требуемый объем (обратите внимание: концентрация ионов в конечном растворе будет различаются в зависимости от используемого объема).
Примечание. Отцентрифугируйте флакон перед открытием. При восстановлении осторожно пипетировать и промыть вниз по стенкам флакона, чтобы обеспечить полное восстановление белка в растворе.
Доставка Товар отгружается при температуре окружающей среды.После получения немедленно храните его при рекомендуемой температуре (см. ниже).
Стабильность и хранение Хранить до 12 месяцев при температуре от -20°C до -80°C в виде лиофилизированного порошка.
Хранение восстановленного белка Кратковременное хранение: Хранить при температуре 2-8°С в течение (1-2 недель).
Длительное хранение: аликвотировать и хранить при температуре от -20°C до -80°C до 3 месяцев, в буфере.

Добавить комментарий

Ваш адрес email не будет опубликован.

*

Top