Прививка бтв что это: Прививка – лучшая защита от гриппа — БТВ

Содержание

Спасет ли советская прививка от коронавируса?

Пока фармкомпании пытаются создать вакцину, врачи ищут варианты облегчения течения болезни у тех, кому не повезло. Испытываются уже существующие препараты — и противовирусные, и средства от малярии, и вакцина от туберкулеза

Фото: Дмитрий Рогулин/ТАСС

В Японии, Китае и Италии для борьбы с вирусом пытаются использовать препарат «Авиган». Это изначально противогриппозное средство, активное вещество которого избирательно ингибирует фермент РНК-полимеразу, участвующий в репликации вируса гриппа. Исследования показывают, что его применение статистически сокращает время болезни, делает ее менее тяжелой и уменьшает число осложнений — то есть снижает риск попасть в реанимацию.

Кроме того, в разных странах испытывают лечение COVID-19 при помощи антималярийных препаратов в комбинации с антибиотиками. Но однозначно говорить о том, что тот или иной метод эффективен, пока рано, уверен врач-фармаколог, доцент факультета фундаментальной медицины МГУ имени Ломоносова Николай Коробов.

Николай Коробов врач-фармаколог, доцент факультета фундаментальной медицины МГУ имени Ломоносова

История с противотуберкулезной прививкой БЦЖ вообще очень интересная. Возможно, именно ее отсутствие объясняет высокую смертность в Италии и некоторых других странах и низкую там, где она обязательна. Так, в соседней с Испанией Португалии, где использовался схожий с советским штамм противотуберкулезной вакцины, при сопоставимом уровне заболеваний на тысячу жителей число смертей в десять раз меньше. Поэтому в ближайшие дни Австралия планирует привить БЦЖ 4 тысячи своих медработников.

В том, что касается противомалярийных средств, то во Франции идут клинические испытания лечения гидроксихлорохином, в Норвегии — тоже гидроксихлорохином, в США — хлорохином, в России планируется применять для этого мефлохин. По сути, все это родственники давно известного человечеству хинина, говорит врач-иммунолог Владимир Болибок.

Владимир Болибок врач-иммунолог

Ко всем этим препаратам надо относиться исключительно осторожно и ни в коем случае не принимать их самостоятельно, предупреждает директор Института медицинской паразитологии, тропических и трансмиссивных заболеваний Сеченовского университета Александр Лукашев.

Александр Лукашев директор Института медицинской паразитологии, тропических и трансмиссивных заболеваний Сеченовского университета

В том, что касается прививки БЦЖ, — еще одна интересная деталь. В Германии, где в западной части и бывшей ГДР до объединения использовались разные штаммы вакцины, на Западе заболеваемость значительно выше, чем на востоке. Так что, возможно, нам скоро действительно придется сказать спасибо советским иммунологам.

Добавить BFM.ru в ваши источники новостей?

В Болгарии начался туристический сезон - Общество

СОФИЯ, 8 мая. /Корр. ТАСС Игорь Ленкин/. Летний туристический сезон начался в мае в Болгарии. По решению Минздрава  границы республики открыли для иностранцев, они должны иметь при себе либо справку о вакцинации от коронавируса, либо отрицательный ПЦР-тест, сделанный за 72 часа до прибытия. Несмотря на это, зарубежные туристы пока не спешат на черноморские пляжи республики, а большинство отелей на побережье в эти майские праздники остались закрытыми.

В интервью ТАСС исполняющая обязанности вице-премьера и главы Минтуризма Марияна Николова подчеркнула, что в список препаратов, одобренных болгарским министерством здравоохранения, включена и российская вакцина "Спутник V", что позволит получившим прививки россиянам наряду с туристами из других стран свободно въехать на территорию страны, предъявив документ о прохождении вакцинации. Она также отметила, что болгарские консульские службы и работающие с Болгарией визовые центры на территории России уже с 5 мая оформляют визы для российских граждан.

"Болгария - одно из ведущих направлений для семейного и детского отдыха, много спортивных команд проводят здесь свои летние тренировочные лагеря. Показателен факт, который отмечают российские туроператоры, активно предлагающие летний отдых в Болгарии, что большая часть туристов, планировавших побывать у нас еще в 2020 году, отложили поездки на нынешнее лето, а не отказались от путешествия. Это показывает, что наше направление имеет своих лояльных российских гостей, оценивающих его преимущества, гостеприимство и разнообразные возможности для отдыха и укрепления здоровья", - считает Николова.

Говоря о безопасности отдыха в Болгарии, и.о. министра туризма подчеркнула, что в стране быстрыми темпами продолжается массовая вакцинация персонала, работающего в области туризма. "Более 82 тыс. человек, непосредственно работающих с туристами, в настоящее время вакцинируются, так что к началу активного сезона будут иметь иммунитет к ковиду. Наша цель - гарантировать и спокойствие работающих в области туризма, и спокойствие для туристов, показать, что мы заботимся об их безопасности", - заверила собеседница.

По словам Николовой, в Болгарии "не заболел ни один из туристов, посетивших страну в прошлом летнем сезоне и нынешней зимой". "Моим распоряжением еще с 15 марта введены единые противоэпидемические и санитарные правила на всех туристических объектах летнего сезона 2021 года. Меры охватывают места размещения, общественного питания и развлечений, вопросы транспортных перевозок. Правила также регулируют порядок использования морских пляжей, где будет обеспечена необходимая физическая дистанция между гостями", - указала она.

Альтернатива Турции

Представители туристических компаний, которые комментировали начало туристического сезона, выражали надежду, что Болгария может стать для российских туристов реальной альтернативой Турции, авиасообщение с которой Россия приостановила до 1 июня из-за ухудшения эпидемической ситуации. Однако на данный момент полноценного авиасообщения между Россией и Болгарией нет, а восстановление его находится под вопросом.

Крупные туроператоры прямо заявили, что причиной тому - политика болгарских властей. Свою позицию они выразили в открытом письме в адрес правительства и президента республики. Туроператоры предупредили, что из-за политических игр, различных бездоказательных обвинений в адрес России, выдворения дипломатов российские туристы так и не приедут на летний отдых в Болгарию, из-за чего страна рискует понести многомиллионные убытки.

Туристические компании отмечают, что "после того, как Болгария обвинила Россию в шпионаже, все полеты в Болгарию - чартерные и регулярные - были отменены".

Они просят болгарские власти предпринять срочные меры по восстановлению нормального сотрудничества между странами.

"Власти должны немедленно отреагировать и сделать перед российской стороной определенные шаги для восстановления полетов и привлечения российских туристов еще нынешним летом, потому что это один из основных туристических рынков. В противном случае из-за действий и высказываний политиков мы не сможем рассчитывать на российских туристов, вопреки существующей золотой возможности", - указал официальный представитель Болгарской ассоциации отелей и ресторанов Валентин Налбантов.

Начало сезона

Летний сезон 2021 года открылся в Болгарии на Пасху, когда страна традиционно отдыхает. Однако большая часть отелей на болгарском Черноморье так и не начала своей работы, из-за пандемии коронавируса и введенных ограничений иностранных туристов в стране мало.

По информации телеканала bTV, один из пяти отелей на курорте "Золотые пески", который рискнул открыться на праздники, вместо 400 туристов принял лишь около 50 гостей, в основном болгарских граждан, а с началом рабочих дней там продолжила отдыхать лишь одна пожилая семейная пара из Германии.

На других курортах загрузка отелей составила около 5% возможностей.

С опасением представители болгарского туристического бизнеса ждут дальнейшего развития событий, полагая, что рассчитывать нынешним летом можно будет лишь на местных жителей. Только во второй половине лета, возможно, появятся в стране и гости из других стран.

президент Болгарии выступил против антироссийских санкций — РТ на русском

Президент Болгарии Румен Радев заявил, что готов поддержать снятие антироссийских санкций, но пояснил, что сам не может запустить этот процесс. Ограничительные меры наносят ущерб самой Болгарии, добавил он. Радев выразил уверенность в том, что рано или поздно санкции будут сняты. Болгарский президент также сообщил о намерении в ближайшее время провести разговор с российским лидером Владимиром Путиным и пригласить его на празднование 140-летия освобождения Болгарии от османского ига.

Президент Болгарии Румен Радев заявил о готовности поддержать отмену антироссийских санкций, когда этот процесс будет запущен.

По его словам, санкционные меры в отношении России наносят ущерб стране.

«С удовольствием поддержим любой акт отмены этих санкций, но давайте проясним: президент самостоятельно не может инициировать подобные действия», — цитирует Радева BTV.

По словам болгарского лидера, в Евросоюзе имеются механизмы, позволяющие даже одной стране запустить процесс отмены санкций. Радев также выразил уверенность в том, что рано или поздно это произойдёт.

Кроме того, болгарский президент сообщил, что намерен пригласить своего российского коллегу Владимира Путина на праздничные мероприятия в честь 140-й годовщины освобождения страны от османского ига.

«В ближайшее время у меня состоится разговор с президентом России Владимиром Путиным, и я приглашу его на празднование 140-летия освобождения Болгарии», — сказал Радев.

Он добавил, что не намерен «идти на компромисс с историей из-за одержимости кучки депутатов», которые недовольны этой инициативой.

140-летие освобождения Болгарии от османского ига будет отмечаться 3 марта 2018 года.

В мае российский лидер провёл телефонный разговор с премьер-министром Болгарии Бойко Борисовым, в ходе которого выразил надежду на развитие двусторонних отношений в конструктивном ключе.

Также по теме

Во имя, а не вопреки: в России и Европе предлагают создать Содружество славянских стран

Российские и европейские общественные движения предлагают создать Содружество славянских государств — международную организацию,...

«Президент России поздравил Бойко Борисова с избранием на пост главы правительства и выразил надежду, что российско-болгарские отношения будут развиваться в конструктивном ключе», — говорится в сообщении, опубликованном на сайте Кремля.

Отмечается, что в ходе беседы обсуждались перспективные направления двустороннего сотрудничества в политической, торгово-экономической, энергетической и культурно-гуманитарной областях.

«Особый акцент сделан на мероприятиях, приуроченных к исполняющемуся 4 августа 2017 года 25-летию подписания российско-болгарского договора о дружественных отношениях и сотрудничестве и 140-летию освобождения Болгарии от османского ига, которое будет отмечаться в 2018 году», — сообщили в Кремле.

Лидер партии «Граждане за европейское развитие Болгарии» Бойко Борисов возглавил болгарское правительство 4 мая после победы своей партии на досрочных парламентских выборах.

В начале июня в ходе пленарного заседания Петербургского международного экономического форума Владимир Путин заявил, что российская экономика справилась с санкциями, введёнными странами Запада.

«Конечно, ничего хорошего нет, но сказать, что это смертельно... Это как вот канцлер Австрии говорил, припоминая Марка Твена: «Слухи о моей смерти сильно преувеличены». Так вот и по поводу санкций можно сказать. Но лучше бы, конечно, этого не было, и нужно с этим заканчивать», — сказал Путин.

Ранее в ходе саммита G7 в итальянской Таормине лидеры стран «Большой семёрки» заявили о готовности ужесточить антироссийские санкции, «если того потребует ситуация». В резолюции, принятой по итогам встречи, отмечается, что продолжительность антироссийских санкций будет прямо связана с «полной реализацией Россией своих обязательств в рамках Минских соглашений и уважением к суверенитету Украины».

Также по теме

«Если потребуется»: лидеры G7 заявили о готовности ужесточить антироссийские санкции

Страны «Большой семёрки» готовы ужесточить антироссийские санкции, если этого потребует ситуация. Такое заявление содержится в...

«Санкции могут быть сняты, когда Россия выполнит свои обязательства. Однако мы также готовы ввести дальнейшие ограничительные меры, чтобы увеличить давление на Россию, если её действия того потребуют», — говорится в документе.

Вместе с тем лидеры «семёрки» заявили о готовности сотрудничать с Россией.

«Несмотря на наши разногласия с Россией, мы готовы взаимодействовать с ней по урегулированию региональных кризисов и общих проблем, когда это находится в сфере наших интересов», — говорится в сообщении.

При этом политолог и доцент МГИМО Кирилл Коктыш в беседе с RT предположил, что разговоры о возможном продлении или ужесточении антироссийских санкций — не что иное, как подготовка президента США Дональда Трампа к переговорам со своим российским коллегой Владимиром Путиным.

«Трамп ведёт себя скорее как бизнесмен, чем как политик. То есть готовит переговорную позицию для встречи с Путиным на саммите G20, и он готовит те вещи, которые можно будет превратить потом в предмет торга», — заявил эксперт.

Политолог добавил, что позиции стран G7 по некоторым вопросам могут различаться, но «у Штатов всегда было достаточно инструментов, чтобы убедить союзников продемонстрировать солидарность». Коктыш обратил внимание на то, что принятый документ составлен достаточно обтекаемо, и его можно рассматривать с точки зрения как ужесточения санкций, так и их отмены.

Напомним, что первая личная встреча Путина и Трампа ожидается на полях саммита G20, который пройдёт в Гамбурге 7—8 июля.

37% болгар не хотят делать прививку от коронавируса

Дождь с громом
мин. 14 | макс. 26 Солнце, тучи, дождь и гром
мин. 15 | макс. 23 Переменная облачность, возможны дожди
мин. 20 | макс. 23 Переменная облачность, возможны дожди
мин. 12 | макс. 28 Солнце, тучи, дождь и гром
мин. 16 | макс. 25 Солнце, тучи, дождь и гром
мин. 13 | макс. 27 Солнце, тучи, дождь и гром
мин. 13 | макс. 26 Переменная облачность, возможны дожди
мин. 8 | макс. 27 Солнце, тучи, дождь и гром
мин. 16 | макс. 26 Дождь с громом
мин. 14 | макс. 23 Солнце, тучи, дождь и гром
мин. 14 | макс. 26 Солнце, тучи, дождь и гром
мин. 15 | макс. 27 Дождь с громом
мин. 16 | макс. 26 Дождь с громом
мин. 11 | макс. 22 Солнце, тучи, дождь и гром
мин. 14 | макс. 27 Дождь с громом
мин. 17 | макс. 26 Солнце, тучи, дождь и гром
мин. 13 | макс. 26 Переменная облачность, возможны дожди
мин. 15 | макс. 29 Переменная облачность, возможны дожди
мин. 14 | макс. 28 Солнце, тучи, дождь и гром
мин. 15 | макс. 26 Дождь с громом
мин. 7 | макс. 22 Дождь с громом
мин. 16 | макс. 23 Дождь с громом
мин. 16 | макс. 26 Солнце, тучи, дождь и гром
мин. 13 | макс. 26 Солнце, тучи, дождь и гром
мин. 17 | макс. 26 Солнце, тучи, дождь и гром
мин. 10 | макс. 26 Солнце, тучи, дождь и гром
мин. 13 | макс. 28

Переболевшие коронавирусом могут вакцинироваться одной дозой

Дождь с громом
мин. 14 | макс. 26 Солнце, тучи, дождь и гром
мин. 15 | макс. 23 Переменная облачность, возможны дожди
мин. 20 | макс. 23 Переменная облачность, возможны дожди
мин. 12 | макс. 28 Солнце, тучи, дождь и гром
мин. 16 | макс. 25 Солнце, тучи, дождь и гром
мин. 13 | макс. 27 Солнце, тучи, дождь и гром
мин. 13 | макс. 26 Переменная облачность, возможны дожди
мин. 8 | макс. 27 Солнце, тучи, дождь и гром
мин. 16 | макс. 26 Дождь с громом
мин. 14 | макс. 23 Солнце, тучи, дождь и гром
мин. 14 | макс. 26 Солнце, тучи, дождь и гром
мин. 15 | макс. 27 Дождь с громом
мин. 16 | макс. 26 Дождь с громом
мин. 11 | макс. 22 Солнце, тучи, дождь и гром
мин. 14 | макс. 27 Дождь с громом
мин. 17 | макс. 26 Солнце, тучи, дождь и гром
мин. 13 | макс. 26 Переменная облачность, возможны дожди
мин. 15 | макс. 29 Переменная облачность, возможны дожди
мин. 14 | макс. 28 Солнце, тучи, дождь и гром
мин. 15 | макс. 26 Дождь с громом
мин. 7 | макс. 22 Дождь с громом
мин. 16 | макс. 23 Дождь с громом
мин. 16 | макс. 26 Солнце, тучи, дождь и гром
мин. 13 | макс. 26 Солнце, тучи, дождь и гром
мин. 17 | макс. 26 Солнце, тучи, дождь и гром
мин. 10 | макс. 26 Солнце, тучи, дождь и гром
мин. 13 | макс. 28

В Болгарии заявили, что «Газпром» остановит транзит газа через Украину в Турцию в 2020 году | Громадское телевидение

Болгария получила официальное письмо от компании «Газпром экспорт» о прекращении в 2020 году транзита газа через Украину в Турцию.

Об этом сообщила министр энергетики Болгарии Теменужка Петкова в интервью телеканалу bTV.

По ее словам, «Газпром» планирует прекратить транзит по трансбалканскому коридору из Украины в Турцию с января 2020 года.

В то же время в «Газпроме» заявили РБК, что никаких официальных писем в Болгарию не посылали.

Также министр отметила, что София подаст в суд на Россию, если вторая ветка газопровода «Турецкий поток» пройдет не через территорию Болгарии. Петкова уточнила, что Болгария потребует от «Газпрома» возместить транзитные платежи, которые, согласно контракту, страна должна получать до 2030 года.

Как сообщалось, в Нафтогазе считают, что Россия прекратит транзит газа через Украину после 2020 года.

Напомним, 13 февраля в ЕС согласовали новые правила, которые упрощают строительство «Северного потока-2».

ЧИТАЙТЕ ТАКЖЕ:«Газпром» переміг? Як Франція поставила під ризик існування української газотранспортної системи

Напомним, что 8 февраля стало известно, что Франция и Германия достигли компромисса относительно изменений энергетического законодательства ЕС. В частности, страны сняли препятствия для строительства российского газопровода в обход Украины.

Отметим, что речь шла о принятии решения Европарламента о распространении действия Третьего энергопакета ЕС на российские газопроводы. Эта директива предусматривает отделение функций поставки газа от его добычи.

То есть, в случае его принятия, Россия должна была бы разрешить поставлять газ через свои морские газопроводы другим поставщикам и потеряла бы контроль над ними. В случае отказа проводить такую реформу, европейским странам запретили бы покупать российский газ, поставляемый российскими газопроводам.

Ранее сообщалось, что Газпром построил уже 600 километров «Северного потока-2» и завершил работы в территориальных водах Германии.

Сейчас Газпром получил разрешение на строительство «Северного потока-2» во многих странах, через воды и территорию которых планируется прокладывать трубопровод, в частности в России, Финляндии, Швеции и Германии. В то же время, единственной страной, которая пока не предоставила Газпрому разрешение на строительство газопровода является Дания.

Накануне стало известно, что Франция и Германия согласовали вариант изменений в энергетической директиве ЕС. Принятие этого варианта должно позволить России беспрепятственно достроить «Северный поток-2».

Накануне сообщалось, что из-за несогласованности относительно «Северного потока-2» президент Франции Эммануэль Макрон отменил совместное выступление с канцлером Германии Ангелой Меркель.

Также немецкие СМИ сообщали, что Франция собирается поддержать внесенную Румынией резолюцию, усложняющую строительство российского газопровода «Северный поток-2».

12 декабря Европарламент принял резолюцию, осуждающую строительство «Северного потока-2». Также 12 декабря в Конгрессе США приняли резолюцию против завершения строительства «Северного потока-2».

ЧИТАЙТЕ ТАКЖЕ: Почему «Северный поток-2» опасен — интервью с экспертом Михаилом Гончаром

Северный поток-2, или Nord Stream-2 является второй ветвью проекта «Северный поток», нацеленного на поставку российского газа в ЕС в обход Украины и восточных государств-членов Евросоюза. Первая ветвь (Nord Stream-1) функционирует с 2011 — 2012 годов. Вторая ветвь должна позволить Газпрому поставлять российский газ в ЕС без использования украинской газотранспортной системы.

Напомним, Германия разрешила проложить «Северный поток-2» на своей территории. США предупредили Германию о санкциях через газопровод «Северный поток-2».

Отметим, что транзит российского газа через газотранспортную систему Украины является одной из крупнейших статей экспорта украинских услуг, которая приносит Украине ежегодно около $3 млрд.

Потеря Украиной транзита будет означать потерю значительной части валютной выручки.

Коронавирус в мире: Турция сохраняет комендантский час, а Англия и Чехия смягчают карантин

В Англии новый этап снятия антиковидных ограничений

В Британии с понедельника, как и было запланировано правительством, отменяются некоторые правила, введенные на время карантина.

В помещениях можно будет собираться компаниями до шести человек (или из двух домохозяйств). Кафе, бары и рестораны смогут принимать посетителей уже не только на открытых летних верандах, но и внутри.

На улице будут разрешены встречи групп до 30 человек. Постепенно начнут возобновлять работу музеи, кинотеатры, стадионы. С понедельника можно будет заниматься в спортзалах. Жители Англии смогут отправиться в страны из «зеленого» списка (с низким уровнем заболеваемости Covid-19) и после возвращения им не придется соблюдать карантин.

В Шотландии с понедельника будут разрешены встречи групп до шести человек (или трех домохозяйств). Ресторанам и пабам будет разрешено подавать алкогольные напитки в помещении до 22:30. Жителям Шотландии также разрешат поездки без последующего карантина в страны из «зеленого списка».

Аналогичные смягчения ограничений ожидают и жителей Уэльса. 

Болгария продлевает чрезвычайный режим до конца июня

Власти Болгарии намерены продлить режим чрезвычайной эпидемиологической ситуации (ЧЭС) до конца июня. Об этом в воскресенье в интервью телеканалу bTV заявил главный санитарный врач страны Ангел Кунчев.

Ожидается, что соответствующее решение будет принято на предстоящей неделе. Также будет продлена работа зеленых коридоров по вакцинации населения, каждый желающий в настоящее время может сделать прививку без предварительной записи.

На данный момент в стране вакцинировано более 1 113 000 человек, в том числе более 413 тыс получили вторую дозу. 

Полный локдаун завершился в Турции 

Полный локдаун, введенный 29 апреля властями Турции в рамках борьбы с распространением коронавируса, завершился в понедельник. 

Теперь гражданам разрешат междугородние поездки на общественном транспорте в нерабочее время при заполняемости автобусов и поездов на 50%. Исключением станут несовершеннолетние и пожилые люди старше 65 лет.

Кроме того, разрешат работать торговым центрам, хозяйственным и галантерейным магазинам с 10:00 до 20:00 в будние дни. Продуктовые магазины и рынки смогут работать и по выходным, но только с 10:00 до 17:00.

В то же время, комендантский час с 21:00 до 05:00 по будням и круглосуточный комендантский час по выходным сохраняется до 1 июня.

По данным Министерства здравоохранения Турции, на сегодняшний день в республике привились от коронавируса более 25 млн человек, из них первый компонент вакцины получили почти 15 млн. 

Чехия открывает рестораны на открытом воздухе 

Рестораны, кафе и бары в Чехии с понедельника после почти полугодового вынужденного перерыва из-за коронавируса возобновят обслуживание гостей на своих террасах. Администрация и обслуживающий персонал должны обеспечить максимальное соблюдение норм санитарно-эпидемиологической безопасности. Контроль за этим будет осуществлять полиция.

У ресторанных столиков на террасах, согласно требованию властей, одновременно смогут сидеть не более 4 гостей. Исключение сделано для совместно проживающих членов одной семьи, на которых это правило не распространяется.

Необходимым условием для гостей ресторанов и кафе является наличие справки об отрицательном результате теста на коронавирус. Это не касается граждан, прошедших полный цикл вакцинации. Им будет достаточно предъявить обсуживающему персоналу, если это потребуется, документ о получении прививки. Доступ на террасы также возможен переболевшим ковидом.

Одновременно открываются школьные столовые, рестораны и буфеты в гостиницах, столовые в учреждениях и на предприятиях. Им строжайше запрещено обсуживать посторонних посетителей.

С понедельника в республике возобновятся также концерты и другие культурные мероприятий, проводимые под открытым небом. Число участников, которые должны соблюдать социальную дистанцию и защищать органы дыхания медицинскими респираторами, ограничено 700. Внутренние помещения театров, концертных комплексов и кинотеатров пока останутся закрытыми.

В Чехии, население которой составляют 10,702 млн жителей, за время пандемии общее число инфицированных коронавирусом составило 1 652 840, из них вылечились 1 592 263, умер 29 901 человек.

В Китае сделали почти 400 млн прививок от коронавируса

Китайские власти ускорили процесс вакцинации населения от коронавируса нового типа на фоне новой вспышки эпидемии в восточной и северо-восточной частях страны; в стране сделано уже почти 393 млн прививок. Об этом свидетельствуют данные, опубликованные в воскресенье Госкомитетом по вопросам гигиены и здравоохранения КНР.

По его данным, только за последние сутки в Китае сделано более 12 млн прививок. Ровно месяц назад данный показатель был в три раза ниже и составлял около 4 млн инъекций.

По мнению ведущего эпидемиолога Китая Чжун Наньшаня, к июню правительство сможет привить около 40% жителей страны, то есть примерно 560 млн из свыше 1,4 млрд человек.

Вакцина против вируса синего языка - обзор

5 Пути интродукции

арбовирусов, передаваемых Culicoides , в Европу

Пути, по которым арбовирусы, передаваемые Culicoides , могут быть занесены в новые экосистемы, были подробно рассмотрены, в частности, со ссылкой на вспышка ВКЛО-8 в северной Европе (Carpenter et al., 2009; Mintiens et al., 2008; Napp et al., 2013). Чаще всего вторжения возникают в результате ветрового перемещения инфекционных мошек Culicoides (Burgin et al., 2013; Меллор и Виттманн, 2002; Sellers, 1992) или импортированный домашний скот, зараженный вирусом (Sellers and Taylor, 1980), и, следовательно, они предсказуемы в более широком смысле, если мониторинг случаев осуществляется и эффективно регистрируется в регионах передачи. Нелицензированное использование частично аттенуированных вакцинных штаммов BTV также относительно просто отследить с помощью молекулярной филогенетики и, как известно, привело к временному появлению BTV-6 (van Rijn et al., 2012) и BTV-11 (De Clercq et al. al., 2009) в Европе. Хотя этими путями можно объяснить большинство вторжений арбовирусов, передаваемых Culicoides , в Европу, методы перемещения BTV-8, BTV-25 и SBV в этот регион остаются неизвестными (Carpenter et al., 2009; Maan и др., 2008).

На начальных этапах вспышки BTV-8 существовало общее предположение, что вторжение было спровоцировано увеличением глобальных перевозок грузов, домашнего скота, диких животных и людей - факторов, которые часто использовались для объяснения появления других переносчиков инфекции. болезней, передаваемых через кишечник (Kilpatrick and Randolph, 2012).Косвенное свидетельство того, что эти пути проникновения могли быть задействованы, было первоначально предоставлено выявлением случаев, связанных с индексом ВКЛО-8 в Маастрихтском регионе Нидерландов, международном транспортном узле для растений, животных и людей, хотя более поздние исследования, по-видимому, предполагали раннее возникновение инфекции. вирус у жвачных животных на фермах недалеко от национальных парков в Бельгии (Saegerman et al., 2010). Эпидемиологическая значимость этого заключения для способа введения подробно не исследовалась.

Внедрение арбовирусов, таких как BTV-8, могло происходить посредством перемещения инфицированных векторов Culicoides , связанных с транспортом животных или людей, или посредством случайного включения с другими грузами, такими как срезанные цветы. Хотя было проведено лишь несколько прямых исследований присутствия Culicoides на судах (и ни одно из них не базировалось в Европе), отдельные мошки были собраны на 10 из 70 судов, инспектированных на шельфе из порта Циньхуандао в Китае в помещениях для экипажа (Nie и другие., 2005). Понимание выживаемости Culicoides в условиях, налагаемых транспортировкой в ​​стандартных грузовых контейнерах (Reiter, 2010), не было количественно оценено, и нет никаких оценок частоты таких вторжений. Отправка яиц Culicoides через торговлю по ремонту шин, как было продемонстрировано на комарах (Eads, 1972), представляется маловероятной, поскольку яйца всех видов Culicoides , исследованных на сегодняшний день, очень подвержены высыханию (Mellor et al., 2000).

Альтернативный путь проникновения арбовируса может включать законное или незаконное перемещение виремических экзотических животных через торговлю домашними животными и зоологические коллекции. Потенциал репликации подавляющего большинства арбовирусов до уровней трансмиссии в таких хозяевах не исследовался, а точное отслеживание импорта экзотических домашних животных, как известно, затруднительно даже для законных поставок (Blundell and Mascia, 2005). В случае OROV риск интродукции, связанный с этим маршрутом, неизвестен из-за текущей неопределенности в отношении потенциальных резервуарных хозяев и текущего статуса Бразилии как крупного центра сбора дикой природы (Magalhaes and Sao-Pedro, 2012).Во всем мире домашние и дикие собаки также были инфицированы BTV в результате использования живых вирусных вакцин, содержащих зараженную эмбриональную телячью сыворотку (Akita et al., 1994), а также вирусом африканской чумы лошадей при употреблении зараженного мяса (Alexander et al., 1995). Потенциал дальнейшей передачи арбовируса в этих случаях не исследовался ни в исследованиях виремии, ни в связи с Culicoides , но устойчивое распространение этим путем считается маловероятным (Alexander et al., 1995). Более широкий вопрос о том, как проводить скрининг биологических лекарственных препаратов, используемых как для человека, так и для ветеринарии, вместе с клеточными субстратами, используемыми для их производства, может стать важным вопросом в будущем, учитывая растущую глобализацию торговли (Marcus-Sekura et al., 2011; Paty, 2013).

Глобальное перемещение людей с виремией можно также рассматривать как представляющее теоретический риск для интродукции OROV или новых арбовирусов, передающихся от человека к человеку Culicoides .Случаи передаваемой комарами инфекции арбовируса как у туристов, так и у возвращающихся за границу рабочих обычно регистрируются в Европе (Eisenhut et al., 1999; Harvala et al., 2009; Jelinek et al., 2002), но редко приводят к дальнейшей передаче, поскольку только ограниченные районы проживания людей поддерживают большие популяции переносчиков. Однако очевидно, что даже люди, демонстрирующие неспецифические клинические симптомы инфекции OROV, вряд ли будут обнаружены во время транзита или на границах.

Филогенетические исследования показали, что штамм BTV-8 произошел от Африки к югу от Сахары (Maan et al., 2008), хотя отсутствие доступных для сравнения штаммов сделало невозможным точное определение происхождения (и также затрудняет географическое отслеживание происхождения SBV). В случае арбовирусов, передаваемых от человека к человеку Culicoides в Африке к югу от Сахары, эпидемии лихорадочного заболевания у людей в масштабе вспышек OROV в Бразилии будут заметны даже на фоне высокой распространенности малярии или денге. Однако нелегко сбрасывать со счетов распространение необнаруженной эндемичной передачи OROV или OROV-подобных арбовирусов в Африке на низком уровне.Кроме того, этот регион поддерживает значительное производство бананов и подорожников и имеет видов Culicoides , занимающих экологическую нишу, аналогичную C. paraensis , как в среде обитания личинок, так и в привычках кусания человека, наиболее очевидно, C. fulvithorax (Agbolade et al., 2006). ; Глик, 1990). Африка к югу от Сахары также предоставила множество изолятов зоонозных арбовирусов из Culicoides , зарегистрированных на сегодняшний день (таблица 2), и они могут быть импортированы непосредственно в Европу через людей или животных с трансмиссивными инфекциями.

Вакцины против синего языка: прошлое, настоящее и будущее

Голубой язык (BT) - это незаразное и арбовирусное заболевание как домашних, так и диких жвачных. Заболевание является энзоотическим в районах, где существуют резервуары (крупный рогатый скот и дикие жвачные животные) и переносчики вируса BT (BTV). Всего во всем мире признано 24 серотипа ВКЛО. Основные меры контроля включают ограничение передвижения животных, борьбу с переносчиками инфекции с применением инсектицидов, убой инфицированных животных и вакцинацию.Профилактическая иммунизация овец против БТ - наиболее практичная и эффективная мера борьбы с инфекцией БТ. В настоящее время аттенуированные вакцины используются в ЮАР, США и других странах. Однако страны ЕС использовали аттенуированные вакцины, только недавно перейдя на инактивированные вакцины из-за их безопасности и эффективности. В Индии инактивированные вакцины находятся на экспериментальной стадии и, как ожидается, вскоре появятся на рынке. Инактивированные вакцины после двух инъекций вырабатывают устойчивый к серотипу устойчивый защитный иммунитет и могут помочь в борьбе с эпидемиями.Дифференциация инфицированных животных от вакцинированных (DIVA) теоретически возможна с помощью инактивированных вакцин, но еще не разработана, тогда как аттенуированные живые вакцины не являются кандидатами для DIVA. Ослабленные живые вакцины эффективны, но вопросы безопасности вызывают большую озабоченность. Для DIVA можно использовать вакцины нового поколения (субъединичные, вирусоподобные частицы, сердцевинные частицы и векторные). Рекомбинантные вакцины, которые создают перекрестную защиту против нескольких серотипов BTV, имеют большой потенциал в схемах вакцинации против BT.Кроме того, вакцины нового поколения безопасны и эффективны экспериментально, но необходимы широкомасштабные полевые испытания. Альтернативные области, такие как противовирусные препараты, миРНК, интерферон и нанотехнологии, могут быть в будущем использованы для борьбы с БТ. Мы даем обзор вакцин против BT, начиная с традиционных и заканчивая недавними разработками, и их возможности в борьбе с инфекцией BT.

Сравнительная оценка Т-клеточного иммунного ответа на инфекцию BTV у овец, вакцинированных пятивалентной вакциной BTV, по сравнению с невакцинированными животными

Недавняя инвазия нескольких серотипов вируса блютанга (BTV) в различных регионах мира требует срочной разработки эффективной вакцины который направлен против нескольких серотипов BTV.В этом экспериментальном исследовании клеточно-опосредованный иммунный ответ и защитная эффективность инактивированной бинарным этиленимином (BEI) пентавалентной вакцины Montanide ISA 206 с адъювантом (BTV-1, 2, 10, 16 и 23), инактивированной бинарным этиленимином, оценивали на овцах и проводили прямое заражение гомологичной вакциной. Серотипы ВКЛО в соответствующей группе. Значительное () повышение регуляции транскриптов мРНК IFN- α , IL-2, IL-6, IL-12, IFN- γ и TNF- α в PBMC вакцинированных животных по сравнению с контролем (un -вакцинированных) животных в определенные моменты времени.С другой стороны, наблюдалось значительное увеличение среднего ± стандартное отклонение процента Т-клеток CD8 + через 7 дней после заражения (DPC), но среднее ± стандартное отклонение процента популяции Т-клеток CD4 + несколько снизилось через 7 дней после заражения. DPC и улучшенный после 14 DPC. Значительные различия () в популяции CD8 + и CD4 + Т-клеток также наблюдались между вакцинированными и невакцинированными овцами. Вакцина также значительно () снижает нагрузку РНК BTV в PBMC вакцинированных животных по сравнению с невакцинированными животными после заражения.Не было значительных различий () в индукции цитокинов, нагрузке РНК BTV и количестве клеток CD8 + и CD4 + среди заражений BTV-1, 2, 10, 16 и 23 серотипов, за исключением значительного увеличения среднего ± SD процент CD8. + в группе БТВ-2. Эти данные свидетельствуют о том, что пятивалентная вакцина против блютанга, инактивированная бинарным этиленимином, монтанидным адъювантом, стимулировала клеточно-опосредованный иммунный ответ и, что наиболее важно, снижала тяжесть инфекций BTV-1, 2, 10, 16 и 23 после заражения в соответствующей группе.

1. Введение

Голубой язык (BT) - геморрагическая болезнь диких и домашних жвачных, передаваемая членистоногими. БТ является болезнью списка А и эндемичен почти для всех стран, кроме Антарктиды, что соответствует географическому распространению, сезонной активности компетентных насекомых-переносчиков Culicoides и соответствующим климатическим условиям [1, 2]. Заболевание вызывается вирусом синего языка (BTV), который является прототипом вида Orbivirus в семействе Reoviridae [3, 4].В настоящее время известно 27 признанных серотипов (от ВКЛО-1 до -27) с добавлением 25 серотипов («Toggenburg orbivirus») из Швейцарии у коз и 26 th из Кувейта у овец [2, 5–7] с недавней идентификацией 27 th из Корсики, Франция, у козла [8]. Индия эндемична по БТ с первого сообщения в 1968 году, и в настоящее время в стране преобладают 23 из 27 серотипов [9].

Из-за широкой антигенной гетерогенности среди серотипов единственный штамм BTV в вакцине не обеспечивает перекрестной защиты.Как и другие арбовирусные заболевания, БТ трудно контролировать с помощью обычных мер биобезопасности. Следовательно, систематическая вакцинация - единственный эффективный инструмент для предотвращения клинических проявлений болезни и распространения вируса. Обычно модифицированный живой вирус (MLV) и инактивированные вакцины использовались для ограничения вспышек BTV в мире, в том числе в Индии.

Живые аттенуированные вакцины использовались для контроля распространения болезни в Европе до 2003 года [10], однако из-за связанных рисков с живыми аттенуированными вакцинами, таких как тератогенность, возврат к вирулентности, иммуносупрессия и генетическая перегруппировка, впоследствии использование инактивированных вакцин были предпочтительны [10–12].Инактивированные моновалентные или поливалентные вакцины оценивались на предмет их эффективности в борьбе с распространением болезней в Индии и других странах [10, 12–20].

Хотя инактивированные вакцины обеспечивают защиту в основном за счет индукции нейтрализующих антител, исследования показали, что подходящий адъювант (ы) и бустерная доза также могут вызывать клеточно-опосредованный иммунный ответ (CMI) [21–23, 42]. Даже есть сообщения о том, что инактивированные вакцины обеспечивают защиту БТ без нейтрализации антител, в основном за счет цитотоксических Т-лимфоцитов (CTL) [23].Индукция как гуморального, так и CMI ответа инактивированными вакцинами может быть очень полезной, поскольку обеспечивает более длительную защиту как гомологичных, так и гетерологичных серотипов [18, 23, 42].

Сообщается, что специфический адъювант, такой как Montanide ISA 206 VG, индуцирует как В, так и Т-клеточный иммунный ответ. Следовательно, рекомендуется оценивать ответ CMI с использованием подходящих адъювантов при оценке эффективности вакцины. Уровень и потенциальная роль защиты от CMI после вакцинации вакциной на основе инактивированного пентавалентного вируса BTV до сих пор не оценивалась, поэтому следующее исследование было предпринято для сравнительной оценки ответа CMI на экспериментальную инфекцию BTV у вакцинированных и невакцинированных овец.

2. Методы
2.1. Дизайн праймеров и оптимизация условий RT-qPCR

Смысловые и антисмысловые пары праймеров, специфичных для генов, для специфической амплификации цитокинов овцы IL-2, IL-6, IL-12, IFN- α , IFN- γ , TNF- α и ген домашнего хозяйства β -актин были разработаны с использованием программы Primer Quest Program of Integrated DNA Technologies (IDT, Коралвилл, США) (https://eu.idtdna.com/PrimerQuest/Home/Index) с использованием NCBI Информация о последовательности GenBank (http: // www.ncbi.nlm.nih.gov/BLAST). При конструировании праймеров соблюдали все критерии, необходимые для количественной ПЦР SYBR / EVA Green. Праймеры были индивидуально синтезированы компанией M / s Eurofins Genomics Private Ltd. (Бангалор, Индия). Все наборы праймеров были протестированы с помощью ПЦР на основе геля для определения оптимальной температуры отжига для каждого набора праймеров, который будет использоваться в ПЦР в реальном времени на основе EVA / SYBER green. Подробная информация о праймерах, ожидаемом размере ампликона и циклических условиях представлена ​​в таблице 1.

.0 28 305–328 9011 9011 9011 9011 9018 9011 9018 Seg5 (NS1) RP

Набор Название праймера Последовательность праймера (5'-3 ') a Размер продукта (основа) Длина праймера (основа) Аннелирование T ° (° C) Положение связывания праймера Номер доступа

1 IFN- FP ACCTTCCAGCTCTTCAGCACAGA 187 23 60.0 190–212 AY802984
IFN- α RP TGTGGAAGTGTTTCCTCACAGCCA 24 60,4 353123–376
353123–376
353123–376 353123–376 91 24 59,0 367–390 X52640
IFN- γ RP ATTGATGGCTTTGCGCTGGATCTG 24 60123 24 60123 434–457
3 IL-2 FP CAAACTTCTAGAGGAAGTGCTAGAT 76 25 59,7 192–216 RPCCT 192–216 X6011AT 24 57,2 244-267
4 ИЛ-6 FP ACTGCTGGTCTTCTGGAGTA 100 20 57,3 364 RP11 ТТСТГАТАКТГЦТСТГКААКТС 22 58.4 442–463
5 IL-12 FP TCTTCACAGACCAAACCTCAGCCA 111 24 60.0 863–886 863–886 123 9015AT 24 60,0 950–973
6 TNF α FP TGGGCCAACTCCCTCTGTTTATGT 163 24 5911 24 5911 595 TNF AGTTTGTGTCTCCCAGGACACCTT 24 59.9 2291–2314
7 β -актин FP TGAAGATCCTCACGGAACGTGGTT 84 24 59.9 305–328 9011 59.9 AGCAGAGCTTCTCCTTGATGTCAC 24 58,5 365–388
8 Seg5 (NS1) FP GCAGCATTTTGAG3AG3AGC8 CCCGATCATACATTGCTTCCT 21 58 249–269

последовательностей генов cy

2.2. Вирус для заражения и состав вакцины

Пятивалентная инактивированная вакцина была получена, как описано ранее [18, 24]. Вкратце, серотипы BTV BTV-1 (изолят TANUVAS), BTV-2 (изолят TANUVAS), BTV-10 (изолят Хайдарабад), BTV-16 (изолят Hisar) и BTV-23 (изолят TANUVAS), используемые в производстве пятивалентных инактивированная вакцина и для контрольного заражения были получены в институте и возрождены в культуре клеток BHK-21.

Изоляты вируса собирали с проявлением полного цитопатического эффекта, как правило, между 4 и 5 днями после заражения.Серотипы были повторно подтверждены с помощью нацеливания на сегмент 2 ОТ-ПЦР с использованием серотип-специфичных праймеров, как описано ранее [2]. Вирус в супернатанте клеточной культуры концентрировали с использованием 8% (мас. / Об.) ПЭГ-6000 по стандартной методике [24, 25]. Собранный вирус титровали по методу Рида и Мунка, как описано ранее [26], а затем инактивировали 0,02 M BEI при 37 ° C в течение 48 часов, как описано ранее [24]. После завершения инактивации инактивированные вирусные серотипы BTV 1, 2, 10, 16 и 23 объединяли с равным TCID 50 .Объединенные серотипы вируса тестировали на стерильность и безвредность в соответствии со стандартными процедурами [24, 41], 208 мл этого объединенного инактивированного BTV смешивали с 242 мл адъюванта Montanide ISA 206 VG (SEPPIC, Франция) (вода масляная водная эмульсия по весу) в мерном цилиндре объемом 500 мл и гомогенизировали с помощью гомогенизатора.

2.3. Эксперименты на животных

Исследование было одобрено этическим комитетом Индийского института ветеринарных исследований (IVRI).Для оценки количества животных в каждой группе был проведен анализ мощности. В общей сложности 27 практически здоровых аборигенных пород овец в возрасте 1,5–2 лет, полученных с фермы IVRI, были подтверждены на отсутствие антител против BTV с помощью c-ELISA (набор Pourquier c-ELISA (IDEXX, Великобритания)). Животных подвергали дегельминтизации и содержали в стойлах, защищенных от насекомых. Животных случайным образом разделили на три группы (i) вакцинированные, зараженные () (ii) невакцинированные, зараженные () и (iii) невакцинированные, незараженные () (Таблица 2).

128

Группа вакцины Привитые / зараженные Невакцинированные / зараженные Невакцинированные / незараженные 2 БТВ-1
2 3 2 БТВ-2
3 3 2 БТВ-10 411 BTV-16
5 3 2 BTV-23

Всего 15 10 2

Состав пятивалентной вакцины, содержащий серотипы ВКЛО 1, 2, 10, 16 и 23, полученный выше, был инокулирован. доза 2 мл в каждой подгруппе () животных вакцинированной инфицированной группы подкожным (S / C) путем на двух участках шеи и задней части бедра с последующей бустерной дозой на 21 день после вакцинации (DPV).Животных из невакцинированных групп () инокулировали 2 мл физиологического раствора на 0DPV и 21DPV.

На 49 DPV животных вакцинированных и невакцинированных групп заражали внутрикожной инокуляцией 4 мл осветленной вирусной суспензии серотипов BTV-1, 2, 10, 16 и 23, пассированных 3 раза в клетках BHK21 (клон 13), имеющих титр ≥10 6 TCID 50 / мл для соответствующих групп животных на нескольких участках в области шеи и под бедром. В конце эксперимента животных утилизировали в соответствии с рекомендованными инструкциями.

2.4. Ректальная температура и клинический признак

Регистрировали клинические симптомы и температуру тела и рассчитывали средний балл, как описано ранее [20]. Записи были сделаны для 49DPV (0 DPC) (до введения инокулята), 50 DPV (1 DPC), 52DPV (3 DPC), 54DPV (7DPC), 57DPV (8DPC), 59DPV (10DPC), 62DPV (13DPC), 64DPV. (15 DPC), 67DPV (18DPC) и 70DPV (21DPC).

2,5. Гуморальный иммунный ответ

Образцы крови без антикоагулянтов были собраны в асептических условиях на 0, 3, 7, 10, 14, 21, 28, 38, 52, 56, 63, 70, 120, 180 и 270 DPV через пункцию яремной вены.Образцы сыворотки разделяли и тестировали коммерчески доступным cELISA, и значения OD преобразовывали в значения процентного ингибирования (PI), как описано ранее [20].

2.6. Количественная оценка транскриптов цитокинов с помощью qRT PCR

Образцы крови собирали с использованием гепарина (10 МЕ / мл) в качестве антикоагулянта на 0, 3, 7, 14 и 21 DPC. Фракции мононуклеарных клеток в собранных образцах крови разделяли с использованием Histopaque1077 (Sigma Aldrich) в соответствии со стандартными процедурами.Клетки суспендировали в 1 мл RPMI и использовали для экстракции общей РНК. Осадок РВМС ресуспендировали в 300, мкл, мкл DEPC-PBS и переносили в 2 мл обработанную DEPC микроцентрифужную пробирку. Тотальную клеточную РНК экстрагировали методом Tri Reagent RT – 4-броманизола (Molecular Research Center, Inc., США) по рекомендованной методике. РНК растворяли в воде, свободной от нуклеаз. Чистоту РНК подтверждали коэффициентом поглощения оптической плотности (OD) OD 260 нм / OD 280 нм с использованием спектрофотометра Nanodrop.

Суммарная РНК (~ 1 мкМ г) была обратно транскрибирована в кДНК с помощью праймеров Oligo dT 18 с использованием RevertAid (обратная транскриптаза) (200 единиц / мкл мкл) (Fermentas, Литва) в соответствии с рекомендациями производитель. Обратную транскрипцию проводили при 42 ° C в течение 1 ч с последующей инактивацией фермента при 70 ° C в течение 10 мин, и кДНК проверяли с помощью ПЦР на основе геля с использованием праймеров, специфичных для гена β -актина.

RT-qPCR выполняли с помощью набора Kappa SYBR ® Fast qPCR (Kappa Biosystems, Массачусетс, США) с использованием термоциклера Mx3005P Real Time (Stratagene, Agilent Technologies, США) [27].Каждую реакцию RT-qPCR помещали в дубликаты в общий объем 20 µ л, который содержал 10 µ l 2x Kappa SYBR ® Fast RT-qPCR master mix, 0,25 µ мкл каждого из 10 пмоль. прямой и обратный праймеры, 1 мкл мкл матрицы кДНК и остальная вода, свободная от нуклеаз. Сорок циклов денатурации при 95 ° C в течение 15 секунд, отжиг при различных температурах в зависимости от Tm праймеров в течение 30 секунд и удлинение при 72 ° C в течение 30 секунд были выполнены после начальной денатурации при 95 ° C в течение 15 минут и в последний раз. цикл при 95 ° C в течение 30 секунд и при 65 ° C в течение 30 секунд.Значения порога цикла (Ct) и график амплификации для всех определенных факторов были получены с использованием метода «SYBR / EVA зеленый (с кривой диссоциации)».

Относительную экспрессию продукта ПЦР количественно оценивали с помощью уравнения, рекомендованного Пфаффлом [28], с использованием программного обеспечения REST 2009 (http://rest-2009.gene-quantification.info/). Контрольная смесь матрицы без какой-либо кДНК не сохранялась, чтобы исключить загрязнение реагентов. Значения 0 DPC (49 DPV) использовали в качестве калибратора для тестирования относительной экспрессии мРНК шести транскриптов цитокинов в PBMC, принимая β -актин в качестве гена домашнего хозяйства.

2.7. Количественное определение вирусной нуклеиновой кислоты

Присутствие РНК BTV в образцах крови количественно определяли с использованием RT-qPCR, нацеленной на сегмент 5 BTV (NS1) [2], который является высококонсервативным геном среди серотипов BTV при 0 DPC (49 DPV) и Через 3, 7, 14 и 21 день после заражения. Тотальную РНК экстрагировали из гепаринизированной крови с помощью реагента Trizol-LS (Life Technologies, США) с последующим осаждением и удалением клеточной оцРНК 2 М LiCl с получением чистой дцРНК [29, 30, 42].1 мкл г очищенной РНК BTV превращали в кДНК и использовали для построения стандартной кривой. Плазмида, содержащая целевой ген, была сконструирована для определения начальной концентрации кДНК, а затем для определения эффективности ПЦР. Кривая стандартного логарифма разведения 10 была построена с использованием десятикратного серийного разведения известных копий кДНК с соответствующими значениями C t . Было установлено, что эффективность грунтовки составила 100%. Регрессионный анализ значений t для каждого разведения привел к коэффициенту регрессии ( 2 ), равному 0.99. Все другие процедуры реакции RT-qPCR и термические профили были аналогичны описанным выше, за исключением температуры отжига (таблица 1).

2,8. Анализ CD4
+ и CD8 + Т-клеточных ответов с помощью проточной цитометрии

100 µ мкл крови в EDTA было собрано у иммунизированной и неиммунизированной группы овец за 0 дней до заражения (49 DPV) и на 3DPC ( 52 DPV), 7 DPC (56 DPV), 14 DPC (63 DPV) и 21 DPC (70 DPV). 10 µ мкл конъюгированных антител, мышиных антител против овечьих CD4: ALEXA FLUOR ® 647 (Neat-1/10) разведение) и мышиных антител против овечьих CD8: RPE (Serotec, Immunological Excellence, США) смешивали и инкубировали. при комнатной температуре в течение 30 мин.Клетки промывали PBS, лизировали буфером для лизиса эритроцитов и фиксировали конъюгированными антителами. Осадки фиксированных клеток анализировали на сканирующем цитометре FACS (Becton Dickinson, США). Соответствующие изотипические контроли, отрицательный контроль мышиного IgG2a: RPE (для CD8) и отрицательный контроль мышиного IgG2a: ALEXA FLUOR ® 647 (для CD4) (Serotec, Immunological Excellence, США) использовали для преодоления фоновой флуоресценции, если таковая имеется. Окрашенные клетки собирали в сканирующем цитометре FACS и анализировали с использованием программного обеспечения CELLQuest версии 3.1 (Becton Dickinson, США) после вычитания соответствующего изотипического контроля. От каждой выборки было записано десять тысяч событий. Среднее процентное изменение в периферической крови анализировали для субпопуляции лимфоцитов по флуоресценции RPE в (FL-2) и флуоресценции ALEXA FLUOR ® 647 в (FL-4).

2.9. Статистический анализ

Все статистические анализы были выполнены с использованием программы SPSS версии 20 (SPSS Inc. Чикаго, Иллинойс, США). Статистически значимая разница в экспрессии транскриптов цитокинов, разница между средним процентом популяций PBMC, меченных антителами против CD4 + и CD8 + , разница между средним процентом популяций PBMC, меченных антителами против CD4 + и CD8 + , основанный на различии серотипа контрольного заражения и вирусного генома. t Значение вакцинированных и невакцинированных групп овец после контрольного заражения анализировали с использованием непараметрического метода Шайрера – Рэя – Хейра для двустороннего дизайна с репликацией.-значение ≤ 0,05 считалось значимым.

3. Результаты

Пентавалентный вакцинный состав BTV серотипов 1, 2, 10, 16 и 23 был подтвержден тестом на стерильность на отсутствие бактерий, вирусов, грибков или микоплазм. Эффективность, особенно Т-клеточный ответ на состав инактивированной пентавалентной вакцины, приготовленный в рекомендованном адъюванте, оценивали в экспериментах in vivo. Отобранные овцы оказались серо-отрицательными в отношении антигена VP7, специфичного для группы BTV.

3.1. Эксперименты на животных

Ни одна из вакцинированных овец не показала клинических признаков после заражения в течение периода наблюдения. Повышенный уровень ректальной температуры (среднее значение = 40,8 ° C) и клинические признаки были очевидны между 5 и 13 днями после заражения (54–62 DPV) у контрольных животных. Наблюдалась значительная разница () между вакцинированными и невакцинированными животными по среднему значению ± стандартное отклонение PI, среднему значению log10 ± стандартное отклонение нейтрализующего антитела, средней ректальной температуре и развитию клинических признаков после заражения гомологами вируса.Однако не было существенной разницы () по всем вышеперечисленным параметрам из-за вариабельности серотипов контрольного вируса [20].

3.2. Гуморальный иммунный ответ

Все овцы были серо-отрицательными со средним значением ± SD процент ингибирования (PI) 117,02 ± 25 в cELISA. После первой вакцинации пентавалентной вакциной BT с монтанидным адъювантом, инактивированной BEI, среднее значение PI постепенно снижалось у всех вакцинированных овец, что указывало на повышение титров антител. Картина сероконверсии была по существу аналогична нашему предыдущему исследованию [20] с максимальным титром, полученным при 28DPV.

3.3. Количественная оценка транскриптов цитокинов

Эффективность праймеров была определена последовательным десятикратным разведением кДНК матрицы в двух экземплярах в ПЦР в реальном времени, и она составила 99% для IFN- γ , 99,8% для IFN- α , 99,3% для IL-2, 100,2% для IL-6, 100% для IL-12, 101% для TNF- α и 102,4% для β -актина.

В этом исследовании было обнаружено, что как вакцинированные, так и невакцинированные овцы демонстрировали повышенную экспрессию IFN- α , IL-2, IL-6, IL-12, IFN- γ и TNF- α транскрипта мРНК после вызов с отдельными серотипами ВКЛО.Однако по сравнению с невакцинированными овцами вакцинированные овцы показали значительную () повышающую регуляцию этих цитокинов (Рисунки 1 (a) –1 (f)).

IFN- α и IL-2 показали значительную () повышающую регуляцию при 3DPC, которая постепенно снижалась на 14 и 21 день после заражения (Фигуры 1 (a) и 1 (b)). С другой стороны, наблюдалась значительная повышающая регуляция экспрессии IL-6 и IL-12, которая достигала пика на 7 DPC и постепенно снижалась на 14 и 21 DPC у вакцинированных животных по сравнению с невакцинированными овцами.Однако наиболее глубокая регуляция экспрессии транскриптов IFN- γ и TNF- α была на 14 DPC у вакцинированных животных, которая постепенно снижалась на 21 день по сравнению с фигурами 1 (c) –1 (f)). В отличие от невакцинированных овец, вакцинированные овцы четко продемонстрировали значительную () повышающую регуляцию IFN- γ , IL-6, IL-12 и TNF- α в PBMC на 14 DPC и в случае IFN- α , IL. -2 при 3 DPC. Не было значительных различий () в индукции цитокинов между тестами BTV-1, 2, 10, 16 и 23 серотипов (данные не показаны).

3.4. Количественное определение вирусных нуклеиновых кислот

Нагрузку РНК BTV контролировали в гепаринизированной крови как вакцинированных, так и невакцинированных групп, чтобы измерить эффективность вакцины в снижении вирусной нагрузки в крови овец после заражения. В отличие от вакцинированных овец, у всех невакцинированных овец копии вирусного генома были обнаружены с использованием анализов RT-PCR в реальном времени, по крайней мере, один или несколько раз между 3 и 21 DPC (таблица 3). На 7 th DPC у 4 вакцинированных овец, зараженных BTV-1, 2, 10 и 23, были обнаружены копии вирусного генома с более высокими значениями t , равными 38, 36, 34 и 35 соответственно, по сравнению с невакцинированными овцами, что указывает на временную виремию. низкого титра (таблица 3).

9011 9011 Нет т 9011 9011 9011 9011 901 18 43 9032 9011 3 т

Серийный номер Код овцы Группа вакцины Дней после заражения (DPC) Серотип заражения BTV
14 21

1 4 VC Нет т Нет т 38.17 Нет т Нет т 1
2 14 VC Нет т Нет т 36,5 2
3 24 VC Нет т Нет т Нет т 9011 9011 т 10
4 34 VC Нет t Нет t Нет t t 9011 9011 9011 9011 9011 9011 9011 44 VC Нет t Нет t Нет t Нет t Нет t 9 0123 23
6 3 VC Нет т Нет т Нет т Нет т 7 13 VC Нет т Нет т Нет т Нет т Нет т 2 VC Нет t Нет t Нет t Нет t Нет t 10
t Нет t Нет t Нет t Нет t 16
10 VC Нет t Нет t Нет t Нет t Нет t 23
Нет t Нет t Нет t Нет t Нет t 1
12 9011 90C Нет т Нет т Нет т Нет т 2
13 51 VC т т т 10
14 35 VC т 9043 3 Нет т Нет т Нет т Нет т 16
15 45 VC
т т т 23
16 9 UVC 94 Нет т Нет т 1
17 17 UVC Нет т Нет т 248 2
18 29 UVC Нет t 22,3 28,27 35,42 26,5
Нет т 24.55 26,55 28,01 16
20 48 UVC Нет t Нет t 25,63
23

Было обнаружено существенное различие () между вакцинированными и невакцинированными животными в их обнаружении РНК BTV, проанализированном методом Шайрера-Рей-Хейра.Сокращения: VC = вакцинированный зараженный (), UVC = невакцинированный зараженный ().
3.5. Анализ CD4
+ и CD8 + Т-лимфоцитов

Для оценки защитной эффективности клеточного иммунного ответа, соотношение количества CD4 + и CD8 + Т-лимфоцитов в PBMC вакцинированных и невакцинированных овец в разное время интервалы были протестированы (Рисунки 2 (а) и 2 (б)).

Среднее значение ± стандартное отклонение Т-лимфоцитов CD8 + при 0 DPC (49 DPV) составило 9.83 ± 3 и 7,23 ± 1,3 для вакцинированных и невакцинированных овец соответственно (рис. 2 (а)). Он постепенно увеличивался с 3 дней после заражения с пиком на 7 DPC и постепенно снижался на 21 DPC. Наблюдалась значительная разница () между вакцинированными и невакцинированными животными в среднем значении ± стандартное отклонение Т-клеток CD8 + во фракции PBMC, которое было очень высоким при 7 и 14 DPC (рис. 2 (а)).

Среднее ± стандартное отклонение процент CD4 + Т-лимфоцитов составил 11,68 ± 2,2 и 10,85 ± 1.2 PBMC при 0 DPC для вакцинированных и невакцинированных животных соответственно (рис. 2 (b)). После 3 ДПК уровень снизился и достиг 10,57 ± 2,2 и 9,08 ± 1,8 на 7 день для вакцинированных и невакцинированных животных соответственно. Затем уровень показал прирост до конца исследования. Наблюдалась значительная разница () между вакцинированными и невакцинированными животными в их доле CD4 + Т-лимфоцитов во фракции PBMC (рис. 2 (b)).

Средний процент популяции PBMC, помеченный антителами против CD8 + и CD4 + вакцинированных и зараженных вирусом овец с различными серотипами, был протестирован непараметрическим методом Шайрера – Рэя – Хейра и обнаружил, что существенной разницы не было () в среднем процентном соотношении PBMC, меченных антителами против CD8 + и CD4 + между различными заражениями BTV серотипа (BTV-1, 2, 10, 16 и 23), за исключением BTV2, показывающего значительно () высокий средний процент PBMC, меченных антитела против CD8 + (Фигуры 3 (а) и 3 (б)).

4. Обсуждение

Голубой язык - это инфекционное незаразное вирусное заболевание диких и домашних жвачных, переносимое членистоногими. Он передается мошками culicoides и преобладает в субтропическом, тропическом и умеренном климате между 53 ° северной широты и 35 ° южной широты (ссылка для ссылки). Существует 27 серотипов ВКЛО (ссылка для ссылки). Множественность серотипов, обладающих антигенным и перекрестно-защитным потенциалом от низкого до умеренного, делает задачу защиты овец от БТ довольно сложной.Существует острая необходимость в определении серотипа, поскольку серотипы, относящиеся к определенному нуклеотипу, будут обеспечивать защиту не только от гомологичных серотипов, но и от гетерологичных серотипов [18, 19]. Было показано, что инактивированная BEI пентавалентная вакцина с адъювантом Montanide обеспечивает защитный иммунный ответ против заражения гомологами BTV серотипов 1, 2, 10, 16 и 23 (ссылка для цитирования). Адъювант монтанида также был способен повышать эффективность вакцины с точки зрения титра и периода иммунного ответа.Было показано, что это предпочтительный адъювант для стимулирования как гуморальных, так и клеточных ответов (ссылка будет цитироваться).

В этом исследовании вакцинированные и невакцинированные овцы демонстрировали значительную экспрессию транскриптов IFN- α , IL-2, IL-6, IL-12, IFN- γ и TNF- α после контрольного заражения. Однако PBMC вакцинированных овец продемонстрировали значительную повышающую регуляцию этих цитокинов по сравнению с невакцинированными, что указывает на роль этих цитокинов в минимизации виремии и предотвращении развития клинических признаков.Этот результат согласуется с выводами разных авторов. Umeshappa et al. [18] сообщили об экспрессии IL-2, IL-12, IFN- α и IFN- γ у аборигенных индийских овец после вакцинации моновалентной вакциной BTV-1, инактивированной бинарным этиленимином (BEI), и заражения гетерологичным серотипом BTV-23. . Рускану и др. [31] (2012) также сообщили о значительной экспрессии IFN- α / β и других провоспалительных цитокинов, включая TNF- α , IL-6 и IL-12p40, при заражении BTV2 и BTV8 на 6 DPC.Не было значительных различий в индукции IFN- α / β между двумя серотипами BTV (). Channappanavar et al. [32] сообщили о низкой индукции мРНК цитокинов IL-12, IFN- γ и TNF- α в лимфатических узлах (DLN), селезенке и PBMC в течение 8 DPI и постепенно увеличивались примерно до 15 DPI.

В этом исследовании IFN- α и IL-2 были значительно повышены на 3 DPC и постепенно снижались на 14 и 21 день после заражения. Это связано с тем, что экспрессия IL-2 и IFN- α была связана с Т-клеточными ответами CD4 и CD8 как у вакцинированных, так и у невакцинированных овец.IFN- α секретируется лейкоцитами и другими клетками, обладающими противовирусной способностью и способностью индуцировать лихорадку, тогда как IL-2 секретируется лимфоцитами Th2 и важен для пролиферации и дифференцировки Т-лимфоцитов. Следовательно, вакцинация вызвала повышенную секрецию этих цитокинов в PBMC вакцинированных животных по сравнению с невакцинированными животными после заражения [18]. Напротив, IL-12, IL-6, IFN- γ и TNF- α экспрессировались в PBMC как вакцинированных, так и невакцинированных животных после 7 DPC.В отличие от невакцинированных овец, иммунизированные овцы продемонстрировали значительную повышающую регуляцию IFN- γ , IL-6, IL-12 и TNF- α в PBMC. IL-6 секретируется клетками Th3, макрофагами и дендритными клетками нацелены на пролиферирующие В-клетки и плазматические клетки, чтобы способствовать дифференцировке в плазматические клетки. IL-12 представляет собой провоспалительный цитокин, который играет решающую роль в индукции адаптивных Т-клеточных ответов CD4 + и CD8 + за счет увеличения продукции IFN- γ [33].Как и при других вирусных инфекциях, IL-12 также продуцируется BTV-инфицированными дендритными клетками [34]. IFN- γ представляет собой плейотрофный провоспалительный цитокин, продуцируемый в основном NK-клетками, цитотоксическими T-клетками (CTL), а также Th2-клетками в ответ на антигенный стимул [35]. IFN- γ , как известно, играет важную роль в регуляции адаптивного иммунного ответа против вирусных антигенов [32, 36]. Первоначальное снижение уровней IFN- γ могло быть связано с потерей CD4 + и CD8 + Т-клеток, связанной с высокими уровнями IFN-α на начальной стадии инфекции ВКЛО [18, 32].Но нельзя исключать возможность раннего увеличения IFN- α , сенсибилизирующего CD8 + Т-клеток для продуцирования IFN- γ на более поздних стадиях инфекции [32, 37, 38]. TNF- α является известно, что они секретируются макрофагами, Th1-клетками, тучными клетками и антиген-специфическими CTL при встрече с вирусными антигенами, которые помогают в пролиферации и дифференцировке Т-клеток, В-клеток, макрофагов, NK-клеток и фибробластов [32]. В настоящее время активность TNF- α у инфицированных животных положительно коррелирует с частотой CD8 + Т-клеток.Возможно, Т-клетки CD8 + могли предпринять производство TNF- α на более поздних стадиях инфекции.

В настоящем исследовании у 4 вакцинированных овец, зараженных BTV-1, 2, 10 и 23, были обнаружены копии вирусного генома с высоким значением t на 7 DPC по сравнению с невакцинированными овцами, что указывает на временную виремию с низким титром и отсутствие явные клинические признаки. Невакцинированные животные были способны отображать детектируемую амплификацию генома BTV-РНК с помощью специфической к BTV кПЦР, начиная с 3DPC.Наблюдалась значительная разница () между вакцинированными и невакцинированными овцами в уровне генома BTV-РНК, обнаруженном с помощью анализа qPCR. Мониторинг уровня виремии у вакцинированных животных после контрольного заражения считается наиболее эффективным способом оценки эффективности вакцины [12, 14, 18, 19]. Однако в свете небольшого количества вирусного генома, обнаруженного только на 7 th DPC, и отсутствия клинического заболевания, потенциальная эпидемиологическая значимость этого открытия очень важна.При таком низком уровне циркулирующего вирусного генома присутствие инфекционного вируса не будет продемонстрировано, и маловероятно, что насекомые-переносчики заразятся [14, 19, 39]. Эти данные свидетельствуют о том, что эта вакцина может предотвращать как распространение вируса, так и распространение болезни от вакцинированных чувствительных животных. Следовательно, в присутствии трансмиссивных вирусов BTV серотипов 1, 2, 10, 16 и 23 инактивированная вакцина не только предотвращает репликацию вируса, но также эффективно индуцирует защитный иммунный ответ.Выводы этого исследования согласуются с работами Eschbaumer et al. [14], которые наблюдали одно вакцинированное животное, имеющее геном ВКЛО с C t из 36 в высокочувствительной BTV-8-специфической ОТ-ПЦР в реальном времени на 10 день, но это животное было отрицательным в последующих выборках. Umeshappa et al. [19] также сообщили о вирусной нагрузке 1,32 log 10 у вакцинированных овец при 7 DPC, что было ниже, чем у невакцинированных овец. Напротив, Umeshappa et al. [19] не обнаружили вирусной нагрузки у вакцинированных овец в любой другой момент времени, и это, вероятно, объясняет временную виремию и значительное снижение клинических и патологических показателей, наблюдаемых у вакцинированных овец по сравнению с невакцинированными.Напротив, де Диего и др. [40] не обнаружили генома BTV-RNA с помощью BTV-специфической КПЦР в крови после заражения вакцинированных животных BTV серотипом 1 [40].

CTL, важный компонент CMI, незаменим для защиты от вирусов и часто является промежуточным звеном перекрестного защитного иммунитета [21]. CTL анти-BTV, демонстрирующие серотипную перекрестную реактивность, были обнаружены у мышей и овец, причем пик CTL-ответа наблюдался между 7 и 21 DPC [19, 40]. В настоящем исследовании повышенная активность CMI наблюдалась на 7 DPC, что соответствует высокому значению Ct вирусной нагрузки у вакцинированных овец.CD8 + Т-клеточный ответ также значительно отличался у вакцинированных и невакцинированных животных. Однако вирусная нагрузка, обнаруженная у вакцинированных овец, была ниже, чем у невакцинированных, и это могло быть связано с повышенной активностью CD8 Т-лимфоцитов в уничтожении инфицированных клеток у вакцинированных овец. Кроме того, это, вероятно, объясняет временную виремию и значительное снижение значений средней клинической оценки (ACS), наблюдаемое у вакцинированных овец, по сравнению с невакцинированными (данные не показаны).

В настоящем исследовании средний процент ± стандартное отклонение CD4 + Т-лимфоцитов представлял 11,68 ± 2,2 и 10,85 ± 1,2 PBMC при 0 DPC для вакцинированных и невакцинированных животных соответственно. После заражения уровень значительно снизился между 3 и 7 днями, а затем повысился до конца испытания. Наблюдалась значительная разница () между вакцинированными и невакцинированными животными в соотношении CD4 + T. Этот результат согласуется с данными de Diego et al. [40] и Umeshappa et al.[19], которые обнаружили низкий уровень CD4 + Т-клеток после заражения. Все приведенные выше данные свидетельствуют о развитии усиленного CMI при вакцинации овец пентавалентной блютанга с монтанидным адъювантом, инактивированной BEI.

Доступность данных

Данные доступны и могут быть предоставлены по запросу.

Конфликт интересов

Авторы заявляют, что у них нет конкурирующих интересов.

Выражение признательности

Эта рукопись является частью докторской диссертации автора MB в ICAR-Indian Veterinary Research Institute, Deemed University, а ее тезисы были представлены на 4 -й Международной конференции по вакцинам и вакцинации.Авторы благодарны директору Индийского научно-исследовательского института ветеринарии за предоставление необходимых условий для проведения исследования, профессору Б. Шарме и доктору Мите, Отдел ветеринарной биохимии, за их отличную помощь в анализе данных проточной цитометрии, доктору А.К. Паттанаику. , Nutrition Division, за предоставление мышиных антител против овечьих CD4 + и CD8 + , а также д-ра М. Саркара для установки RT-qPCR.

Оценка перекрестной защиты, индуцированной вакциной против вируса блютанга (BTV) серотипа 8, по отношению к другим серотипам BTV в экспериментальных условиях | Ветеринарные исследования

  • 1.

    Maclachlan NJ, Drew CP, Darpel KE, Worwa G (2009) Патология и патогенез блютанга. J Comp Pathol 141: 1–16

    Статья PubMed CAS Google Scholar

  • 2.

    Mertens P, Maan S, Samuel A, Attoui H (2005) Orbivirus, reoviridae. Таксономия вирусов. В: Fauquet CM, Mayo MA, Maniloff J, Desselberger U, Ball LA (ред.). VIII-й отчет ICTV, Лондон; 2005. Elsevier / Academic Press, Нью-Йорк. С. 466–483

  • 3.

    Batten C, Darpel K, Henstock M, Fay P, Veronesi E, Gubbins S, Graves S, Frost L, Oura C (2014) Доказательства передачи серотипа 26 вируса блютанга при прямом контакте. PLoS One 9: e96049

    Артикул PubMed PubMed Central CAS Google Scholar

  • 4.

    Zientara S, Sanchez-Vizcaino JM (2013) Борьба с блютантом в Европе. Vet Microbiol 165: 33–37

    Статья PubMed Google Scholar

  • 5.

    Meiswinkel R, Baldet T., de Deken R, Takken W., Delecolle JC, Mellor PS (2008) Вспышка блютанга 2006 г. в северной Европе - энтомологическая перспектива. Prev Vet Med 87: 55–63

    Статья PubMed CAS Google Scholar

  • 6.

    Уилсон А.Дж., Меллор П.С. (2009) Голубой язык в Европе: прошлое, настоящее и будущее. Philos Trans R Soc Lond B Biol Sci 364: 2669–2681

    Статья PubMed PubMed Central Google Scholar

  • 7.

    BLUETONGUE — EUROPE (02): ФРАНЦИЯ, BTV-8, BTV-1, решено, oie. http://www.promedmail.org/. По состоянию на 30 января 2014 г.

  • 8.

    BLUETONGUE — EUROPE (03): БЕЛЬГИЯ, BTV-8, разрешено, oie. http://www.promedmail.org/. По состоянию на 29 января 2014 г.

  • 9.

    Coetzee P, Van Vuuren M, Stokstad M, Myrmel M, Venter EH (2012) Генетическое и фенотипическое разнообразие вируса синего языка: к выявлению молекулярных детерминант, которые влияют на вирулентность и потенциал передачи. Vet Microbiol 161: 1–12

    Статья PubMed CAS Google Scholar

  • 10.

    Kirkland PD, Hawkes RA (2004) Сравнение лабораторных и «диких» штаммов вируса блютанга - есть ли разница и имеет ли это значение? Vet Ital 40: 448–485

    PubMed CAS Google Scholar

  • 11.

    Erasmus BJ (1990) Вирус синего языка. В: Dinter Z, Morein B (eds) Вирусные инфекции жвачных животных. Elsevier Biomedical Press, Амстердам, стр. 227–237.

    Глава Google Scholar

  • 12.

    Jenckel M, Breard E, Schulz C, Sailleau C, Viarouge C, Hoffmann B, Hoper D, Beer M, Zientara S (2015) Полная кодирующая последовательность генома предполагаемого нового серотипа 27 вируса блютанга. Объявление генома 3: e00016-15

    Статья PubMed PubMed Central Google Scholar

  • 13.

    Maan S, Maan NS, Belaganahalli MN, Potgieter AC, Kumar V, Batra K, Wright IM, Kirkland PD, Mertens PP (2016) Разработка и оценка анализов ОТ-ПЦР в реальном времени для обнаружения и типирования вирус блютанга.PLoS One 11: e0163014

    Артикул PubMed PubMed Central CAS Google Scholar

  • 14.

    Umeshappa CS, Singh KP, Pandey AB, Singh RP, Nanjundappa RH (2010) Клеточно-опосредованный иммунный ответ и эффективность перекрестной защиты бинарной вакцины серотипа-1 вируса блютанга, инактивированного этиленамином, у овец. Вакцина 28: 2522–2531

    Статья PubMed CAS Google Scholar

  • 15.

    Hund A, Gollnick N, Sauter-Louis C, Neubauer-Juric A, Lahm H, Buttner M (2012) Двухлетнее наблюдение за вакцинацией BTV-8: молекулярная диагностика и оценка гуморальных и клеточных иммунных реакций. Vet Microbiol 154: 247–256

    Статья PubMed CAS Google Scholar

  • 16.

    Breard E, Belbis G, Viarouge C, Nomikou K, Haegeman A, De Clercq K, Hudelet P, Hamers C, Moreau F, Lilin T., Durand B, Mertens P, Vitour D, Sailleau C, Zientara S (2015) Оценка адаптивных иммунных ответов и гетерологичной защиты, индуцированных вакцинами против инактивированного вируса блютанга.Вакцина 33: 512–518

    Статья PubMed CAS Google Scholar

  • 17.

    РНК и белки дцРНК вирусов. http://www.reoviridae.org/dsRNA_virus_proteins/btv-collection.htm. По состоянию на 29 июня 2015 г.

  • 18.

    Saegerman C, Mauroy A, Guyot H (2008) Голубой язык у жвачных животных: стандартизованная форма клинического отчета для использования у различных видов. В: Saegerman C, Reviriego-Gordejo F, Pastoret PP (eds) Bluetongue в Северной Европе.Публикация МЭБ, Париж, стр. 82–87

    Google Scholar

  • 19.

    Vandenbussche F, Vanbinst T, Verheyden B, Van Dessel W, Demeestere L, Houdart P, Bertels G, Praet N, Berkvens D, Mintiens K, Goris N, De Clercq K (2008) Оценка антител - ИФА и ОТ-ПЦР в реальном времени для диагностики и профилирования вируса блютанга серотипа 8 во время эпидемии в Бельгии в 2006 г. Vet Microbiol 129: 15–27

    Статья PubMed CAS Google Scholar

  • 20.

    Martinelle L, Dal Pozzo F, Sarradin P, De Leeuw I, De Clercq K, Thys C, Ziant D, Thiry E, Saegerman C (2011) Два альтернативных инокулята для воспроизведения болезни вируса блютанга серотипа 8 у телят. Вакцина 29: 3600–3609

    Статья PubMed Google Scholar

  • 21.

    Biteau-Coroller F, Gerbier G, Stark KD, Grillet C, Albina E, Zientara S, Roger F (2006) Оценка эффективности конкурентного теста ELISA, используемого для обнаружения антител к блютангу во Франции, недавно зараженной области .Vet Microbiol 118: 57–66

    Статья PubMed CAS Google Scholar

  • 22.

    Martinelle L, Dal Pozzo F, Sarradin P, De Leeuw I, De Clercq K, Thys C, Thiry E, Saegerman C (2013) Кровоизлияние в легочную артерию у новорожденных телят после экспериментального инфицирования беременных вирусом блютанга 8 серотипа телки. Vet Microbiol 167: 250–259

    Статья PubMed Google Scholar

  • 23.

    Dal Pozzo F, Martinelle L, Thys C, Sarradin P, De Leeuw I, Van Campe W, De Clercq K, Thiry E, Saegerman C (2013) Экспериментальные коинфекции телят вирусами блютанга серотипов 1 и 8. Vet Microbiol 165: 167–172

    Статья CAS Google Scholar

  • 24.

    Reed LJ, Muench H (1938) Простой метод оценки пятидесятипроцентных конечных точек. Am J Hyg 27: 493–497

    Google Scholar

  • 25.

    Дунгу Б., Гердес Т., Смит Т. (2004) Использование вакцинации для борьбы с блютангистом на юге Африки. Vet Ital 40: 616–622

    PubMed CAS Google Scholar

  • 26.

    Eschbaumer M, Schulz C, Wackerlin R, Gauly M, Beer M, Hoffmann B (2011) Ограничения сэндвич-ELISA для обнаружения антител к вирусу блютанга. Vet Rec 168: 643

    Статья PubMed CAS Google Scholar

  • 27.

    Darpel KE, Batten CA, Veronesi E, Shaw AE, Anthony S, Bachanek-Bankowska K, Kgosana L, Bin-Tarif A, Carpenter S, Muller-Doblies UU, Takamatsu HH, Mellor PS, Mertens PP, Oura CA (2007 г. ) Клинические признаки и патология у британских овец и крупного рогатого скота, инфицированных вирусом блютанга серотипа 8, полученного в результате вспышки 2006 года в Северной Европе. Vet Rec 161: 253–261

    Статья PubMed CAS Google Scholar

  • 28.

    Eschbaumer M, Wackerlin R, Rudolf M, Keller M, Konig P, Zemke J, Hoffmann B, Beer M (2010) Инфекционная кровь или вирус, выращенный в культуре: сравнение моделей заражения вирусом блютанга.Vet Microbiol 146: 150–154

    Статья PubMed Google Scholar

  • 29.

    Caporale M, Wash R, Pini A, Savini G, Franchi P, Golder M, Patterson-Kane J, Mertens P, Di Gialleonardo L, Armillotta G, Lelli R, Kellam P, Palmarini M (2011) Детерминанты вирулентности вируса блютанга на мышиных моделях болезни. J Virol 85: 11479–11489

    Артикул PubMed PubMed Central CAS Google Scholar

  • 30.

    Erra EO, Korhonen EM, Voutilainen L, Huhtamo E, Vapalahti O, Kantele A (2013) Денге у путешественников: кинетика виремии и антигенемии NS1 и их связи с клиническими параметрами. PLoS One 8: e65900

    Артикул PubMed PubMed Central CAS Google Scholar

  • 31.

    Walz PH, Bell TG, Wells JL, Grooms DL, Kaiser L, Maes RK, Baker JC (2001) Взаимосвязь между степенью виремии и проявлением болезни у телят с экспериментально индуцированной вирусной инфекцией вирусной диареи крупного рогатого скота.Am J Vet Res 62: 1095–1103

    Статья PubMed CAS Google Scholar

  • 32.

    Tse H, To KK, Wen X, Chen H, Chan KH, Tsoi HW, Li IW, Yuen KY (2011) Клинические и вирусологические факторы, связанные с виремией при пандемической инфекции вируса гриппа A / h2N1 / 2009. PLoS One 6: e22534

    Артикул PubMed PubMed Central CAS Google Scholar

  • 33.

    Barratt-Boyes SM, MacLachlan NJ (1995) Патогенез заражения крупного рогатого скота вирусом блютанга.J Am Vet Med Assoc 206: 1322–1329

    PubMed CAS Google Scholar

  • 34.

    Eschbaumer M, Wackerlin R, Savini G, Zientara S, Sailleau C, Breard E, Beer M, Hoffmann B (2011) Загрязнение в экспериментах по заражению вирусом блютанга. Вакцина 29: 4299–4301

    Статья PubMed Google Scholar

  • 35.

    Caporale M, Di Gialleonorado L, Janowicz A, Wilkie G, Shaw A, Savini G, Van Rijn PA, Mertens P, Di Ventura M, Palmarini M (2014) Вирус и факторы хозяина, влияющие на клинический исход инфекция вирусом блютанга.J Virol 88: 10399–10411

    Статья PubMed PubMed Central CAS Google Scholar

  • 36.

    Samal SK, Livingston CW Jr, McConnell S, Ramig RF (1987) Анализ смешанной инфекции овец серотипами 10 и 17 вируса блютанга: доказательства генетической реассортации у позвоночного-хозяина. J Virol 61: 1086–1091

    PubMed PubMed Central CAS Google Scholar

  • 37.

    Modumo J, Venter EH (2012) Определение минимальной защитной дозы вакцин против вируса блютанга серотипа 2 и 8 для овец. J S Afr Vet Assoc 83:17

    Статья PubMed Google Scholar

  • 38.

    Maan S, Maan NS, Samuel AR, O'Hara R, Meyer AJ, Rao S, Mertens PP (2004) Завершение анализа последовательности и сравнения сегмента 2 генома (кодирующего белок внешнего капсида VP2) из репрезентативные изоляты 24 серотипов вируса блютанга.Vet Ital 40: 484–488

    PubMed CAS Google Scholar

  • 39.

    Эндрю М., Уайтли П., Джанардхана В., Лобато З., Гулд А., Купар В (1995) Антигенная специфичность ответа цитотоксических Т-лимфоцитов овцы на вирус блютанга. Vet Immunol Immunopathol 47: 311–322

    Статья PubMed CAS Google Scholar

  • 40.

    Jones LD, Chuma T, Hails R, Williams T, Roy P (1996) Неструктурные белки вируса блютанга являются доминирующим источником цитотоксических Т-клеточных пептидных детерминант.J Gen Virol 77: 997–1003

    Статья PubMed CAS Google Scholar

  • 41.

    Belbis G, Zientara S, Bahuon C, Sailleau C, Relmy A, Millemann Y, Breard E (2009) Подходы к DIVA ELISA для диагностики блютанга с использованием неструктурных белков вируса блютанга. В: H. MRN (ed) European Buiatric Forum, Марсель, 1–3 декабря 2009 г. Сен-Пьер, Société Française de Buiatrie, стр. 40

    Google Scholar

  • 42.

    Rojas JM, Rodriguez-Calvo T, Pena L, Sevilla N (2011) Т-клеточные ответы на вирус блютанга направлены против множества идентичных Т-клеточных эпитопов CD4 + и CD8 + из корового белка VP7 у мышей и овец. Vaccine 29: 6848–6857

    Статья PubMed CAS Google Scholar

  • 43.

    Drew CP, Heller MC, Mayo C, Watson JL, Maclachlan NJ (2010) Инфекция вируса синего языка активирует макрофаги, полученные из моноцитов крупного рогатого скота, и эндотелиальные клетки легочной артерии.Vet Immunol Immunopathol 136: 292–296

    Статья PubMed PubMed Central CAS Google Scholar

  • 44.

    DeMaula CD, Leutenegger CM, Bonneau KR, MacLachlan NJ (2002) Роль воспалительных и вазоактивных медиаторов, происходящих из эндотелиальных клеток, в патогенезе блютанга. Вирусология 296: 330–337

    Статья PubMed CAS Google Scholar

  • 45.

    Venter GJ, Mellor PS, Wright I, Paweska JT (2007) Репликация живых ослабленных вакцинных штаммов вируса блютанга у орально инфицированных южноафриканских видов Culicoides. Med Vet Entomol 21: 239–247

    Статья PubMed CAS Google Scholar

  • 46.

    Vazeille-Falcoz M, Mousson L, Rodhain F, Chungue E, Failloux AB (1999) Вариация оральной восприимчивости к вирусу денге 2 типа среди популяций Aedes aegypti с островов Таити и Муреа, Франция Полинезия.Am J Trop Med Hyg 60: 292–299

    Статья PubMed CAS Google Scholar

  • 47.

    Vazeille M, Moutailler S, Coudrier D, Rousseaux C, Khun H, Huerre M, Thiria J, Dehecq JS, Fontenille D, Schuffenecker I, Despres P, Failloux AB (2007) Два изолята чикунгуньи из вспышки Реюньон (Индийский океан) демонстрируют различные модели заражения комаров, Aedes albopictus . PLoS One 2: e1168

    Артикул PubMed PubMed Central CAS Google Scholar

  • 48.

    Savini G, MacLachlan NJ, Sanchez-Vizcaino JM, Zientara S (2008) Вакцины против блютанга в Европе. Comp Immunol Microbiol Infect Dis 31: 101–120

    Статья PubMed Google Scholar

  • 49.

    Monaco F, De Luca N, Morelli D, Pisciella M, Palmarini S, Di Giandomenico M, Savini G (2004) Полевая вакцинация крупного рогатого скота с использованием бивалентной модифицированной живой вакцины против серотипов 2 и 9 вируса блютанга: влияние на молочную продуктивность.Vet Ital 40: 661–663

    PubMed CAS Google Scholar

  • 50.

    Ferrari G, De Liberato C, Scavia G, Lorenzetti R, Zini M, Farina F, Magliano A, Cardeti G, Scholl F, Guidoni M, Scicluna MT, Amaddeo D, Scaramozzino P, Autorino GL (2005 ) Активная циркуляция вакцинного вируса блютанга серотипа-2 среди невакцинированного крупного рогатого скота в центральной Италии. Prev Vet Med 68: 103–113

    Статья PubMed CAS Google Scholar

  • 51.

    Bonneau KR, DeMaula CD, Mullens BA, MacLachlan NJ (2002) Продолжительность виремии, инфекционной для Culicoides sonorensis, у крупного рогатого скота и овец, инфицированных вирусом блютанга. Vet Microbiol 88: 115–125

    Статья PubMed CAS Google Scholar

  • 52.

    Бейлис М., О’Коннелл Л., Меллор П.С. (2008) Скорость передачи вируса блютанга между Culicoides sonorensis и овцами. Med Vet Entomol 22: 228–237

    Статья PubMed CAS Google Scholar

  • 53.

    Carpenter S, Lunt HL, Arav D, Venter GJ, Mellor PS (2006) Устная восприимчивость к вирусу блютанга Culicoides (Diptera: Ceratopogonidae) из Соединенного Королевства. J Med Entomol 43: 73–78

    Статья PubMed Google Scholar

  • 54.

    Coetzee P, Van Vuuren M, Stokstad M, Myrmel M, van Gennip RG, van Rijn PA, Venter EH (2014) Кинетика репликации вируса и цитопатогенность in vitro родительских и реассортантных штаммов вируса блютанга серотипа 1, 6 и 8.Vet Microbiol 171: 53–65

    Статья PubMed CAS Google Scholar

  • 55.

    Del Amo J, Llorente F, Figuerola J, Soriguer RC, Moreno AM, Cordioli P, Weissenbock H, Jimenez-Clavero MA (2014) Экспериментальное заражение домашних воробьев ( Passer domesticus ) вирусом Западного Нила. изоляты евро-средиземноморского и североамериканского происхождения. Vet Res 45:33

    Статья PubMed PubMed Central Google Scholar

  • Специальный выпуск: Вирус синего языка: патогенез и вакцины

    Доктор.Ноэми Севилья
    Электронная почта
    Гостевой редактор

    Centro de Investigación en Sanidad Animal (CISA), Instituto Nacional de Investigacion y Tecnologia Agraria y Alimentaria, Мадрид, Испания
    Интересы: вирусов жвачных животных; вирусная иммунология; вакцины на основе аденовируса

    Д-р Вероника Мартин
    Электронная почта
    Гостевой редактор

    Centro de Investigación en Sanidad Animal (CISA), Instituto Nacional de Investigacion y Tecnologia Agraria y Alimentaria, Мадрид, Испания

    Доктор.Хосе М. Рохас
    Электронная почта
    Гостевой редактор

    Centro de Investigación en Sanidad Animal (CISA), Instituto Nacional de Investigacion y Tecnologia Agraria y Alimentaria, Мадрид, Испания

    Уважаемые коллеги!

    Вирус синего языка (BTV) - это вирус дцРНК (семейство Reoviridae, , род Orbivirus ), передаваемый насекомыми-переносчиками ( Culicoides spp.). ВКЛО поражает домашних и диких жвачных и вызывает высокую заболеваемость и смертность, в основном овец.Болезнь синего языка внесена в список Всемирной организации здравоохранения животных (МЭБ) из-за огромных социально-экономических потерь, которые она наносит. Присутствие BTV было задокументировано на всех континентах, кроме Антарктиды, что отражает географическое распространение переносчиков Culicoides . Существует по крайней мере 29 серотипов BTV, которые основаны на специфической гуморальной реакции, вызванной против белка VP2. Было показано, что перегруппировка сегментов РНК BTV ответственна за появление новых штаммов вируса.

    Более глубокое понимание ключевых факторов, влияющих на тропизм хозяина, иммунный ответ и эффективность вакцины, необходимо для разработки безопасных и эффективных вакцин против BTV нового поколения, которые обладают потенциалом DIVA и применимы ко всем серотипам (из-за частого появления новых BTV серотипы). Поэтому в этом специальном выпуске приветствуются все типы рукописей (например, обзоры, исследовательские статьи и короткие сообщения), посвященные молекулярным механизмам, взаимодействиям хозяина и вируса, патогенности и стратегиям вакцинации.

    Доктор Ноэми Севилья
    Доктор Вероника Мартин
    Доктор Хосе М. Рохас
    Приглашенные редакторы

    Информация для подачи рукописей

    Рукописи должны быть представлены онлайн по адресу www.mdpi.com, зарегистрировавшись и войдя на этот сайт. После регистрации щелкните здесь, чтобы перейти к форме отправки. Рукописи можно подавать до указанного срока. Все статьи будут рецензироваться. Принятые статьи будут постоянно публиковаться в журнале (как только они будут приняты) и будут перечислены вместе на веб-сайте специального выпуска.Приглашаются исследовательские статьи, обзорные статьи, а также короткие сообщения. Для запланированных статей название и краткое резюме (около 100 слов) можно отправить в редакцию для объявления на этом сайте.

    Представленные рукописи не должны были публиковаться ранее или рассматриваться для публикации в другом месте (за исключением трудов конференции). Все рукописи тщательно рецензируются в рамках процесса одинарного слепого рецензирования. Руководство для авторов и другая важная информация для подачи рукописей доступна на странице Инструкции для авторов. Вирусы - это международный рецензируемый ежемесячный журнал открытого доступа, публикуемый MDPI.

    Пожалуйста, посетите страницу Инструкции для авторов перед отправкой рукописи. Плата за обработку статьи (APC) для публикации в этом журнале с открытым доступом составляет 2200 швейцарских франков. Представленные документы должны быть хорошо отформатированы и написаны на хорошем английском языке. Авторы могут использовать MDPI Услуги редактирования на английском языке перед публикацией или во время редактирования автора.

    Национальная информационная служба по болезням животных

    Редакционная информация

    Автор: Эмили Симкок Бакалавр (с отличием), BVSc (с отличием) MRCVS PGcert (Питание для жвачных животных) 2019.Изображения любезно предоставлены Филом Скоттом DVM & S DipECBHM CertCHP DSHP FRCVS

    Отзывов:

    Опубликован: 2019

    Голубой язык - вирусное заболевание, поражающее овец, крупный рогатый скот, оленей, коз и верблюдов (верблюдов, лам, альпаков, гуанако и викунью). Хотя овцы наиболее сильно поражены, крупный рогатый скот является основным резервуаром вируса среди млекопитающих и играет очень важную роль в эпидемиологии болезни.Блютанг является заболеванием, подлежащим уведомлению в Великобритании, и о подозреваемых случаях следует немедленно сообщать ветеринарному руководителю отделения в местном отделении здоровья животных.

    Существует множество различных штаммов (серотипов) синего языка, каждому из которых присвоен номер (в настоящее время до 27). Животные, выздоравливающие после заражения одним серотипом, будут невосприимчивы к этому штамму, но не к другим.

    Вирус передается через мокрецов рода Culicoides , а не обычно при прямом контакте с инфицированными животными.Пик популяций мошек в Европе приходится на конец лета и осень, поэтому именно в это время чаще всего встречается синюшный язык. Мошки могут переноситься ветром на очень большие расстояния (более 200 км), и это был основной способ проникновения серотипов голубого языка в новые районы.

    Исторически синий язык был ограничен тропическими и субтропическими зонами (Центральная Африка, Юго-Восточная Азия), но в последние годы в связи с изменением климата и моделями торговли увеличивались вспышки в регионах с умеренным климатом (включая Северную Европу), при этом возникали вспышки до 9 различных серотипов. в Европе за последние 10 лет.Самым значительным из них была вспышка ВКЛО-8 в Северной Европе в 2006–2008 годах. Голубой язык (любого серотипа) в настоящее время отсутствует в Великобритании, но существует значительный риск его повторной интродукции с мошками, перенесенными через Ла-Манш из континентальной Европы во время европейских вспышек. В частности, текущая циркуляция BTV-8 на юге Франции (по состоянию на осень 2017 года) представляет собой серьезный риск для Великобритании.

    Рис. 1: Ранний клинический случай ВКЛО с угнетенным внешним видом.


    Рис. 2. Наблюдается опухоль лица и ушей, овца часто кажется окоченевшей и не хочет двигаться.

    Рис. 3. Отек лица, выделения из носа и экскориация у овец, инфицированных BTV.

    Рис. 4: Типичное поражение стопы, обнаруженное у овец, инфицированных BTV, включая коронит и воспаление всей области копыта, но без образования волдырей
    .

    Рис.5: У крупного рогатого скота лихорадка (до 40.0 ° C) и кажутся жесткими из-за набухания коронарной перевязи в верхней части копыт

    Рис. 6: Выделения из носа от серозных до слизисто-гнойных

    Экономическое значение

    Инфекция вируса синего языка оказывает огромное влияние на овцеводство во многих странах африканского континента и в других местах. Потери в основном связаны со смертностью, снижением продуктивности во время длительного выздоровления, включая плохой рост шерсти, и снижением репродуктивной способности, включая временное бесплодие барана.Смертность может быть высокой: в среднем 5% во время вспышки BTV-8 в Нидерландах в 2006 г., хотя в некоторых стадах она превышала 70%.

    Клинические признаки

    Для синего языка характерны изменения слизистых оболочек рта и носа, а также венечной связки стопы. Клинические признаки обычно более выражены у овец, но у крупного рогатого скота могут быть признаки болезни. Фермер должен связаться с ветеринаром, если у большого количества овец или крупного рогатого скота наблюдается хромота, высокая ректальная температура, слюноотделение, слезотечение и выделения из глаз и носа.Синтетический язык - это заболевание, подлежащее регистрации в Великобритании.

    Овца

    Клинические признаки синего языка, которые различаются в зависимости от штамма вируса и породы овец, следуют за инкубационным периодом от четырех до 12 дней. Обычно клинические признаки развиваются только у небольшого процента овец, однако смертность в некоторых отарах может достигать 70%. В тщательно контролируемых стадах необъяснимая внезапная смерть может быть первым признаком болезни. Животные, пережившие болезнь, могут потерять форму из-за сокращения производства мяса и шерсти.

    У заболевших овец жар (до 42,0 ° C), они окоченели и не хотят двигаться. Они часто принимают позицию изогнутой спины с вытянутой шеей и опущенной головой. Наблюдается отек лица и ушей, а также отек легких, который может вызвать затруднение дыхания. На губах могут появиться эрозии, переходящие в язвы. Часто наблюдается обильное слюноотделение и выделения из носа от серозных до слизисто-гнойных. Может появиться покраснение коронарной перевязи, вокруг морды и рта.Язык может опухать, а из-за недостатка кислорода язык и слизистые оболочки становятся синими (отсюда и название болезни). Хотя так бывает не всегда. Голубой язык также может вызвать прерывание беременности у овец, а инфекция в период размножения может привести к большому проценту ранних потерь эмбрионов, когда овцы возвращаются к эструсу через нерегулярные промежутки времени. Иногда также могут возникать деформации плода, подобные тем, которые наблюдаются при вирусе Шмалленберга.

    Ключевые моменты
    • Высокая ректальная температура
    • Выделения из глаз и носа
    • Слюнотечение вследствие изъязвлений во рту
    • Отек рта, головы и шеи.
    • Хромота с воспалением на стыке кожи и коронарной перевязи
    • Затрудненное дыхание
    • Аборт

    Дифференциальная диагностика включает ящур. Орф может вызвать язвы на слизистых оболочках, но обычно не является причиной высокой температуры или смертности. Клостридиальное заболевание может вызвать внезапную смерть и повышение температуры / отек, но обычно это бывает спорадически и у невакцинированных овец.

    Рис. 7: Есть слезотечение, но нет явных поражений глаз.

    Рис. 8: Отек (припухлость) лица

    Рис. 9: У некоторых видов крупного рогатого скота может развиться обширная эрозия сосков.

    Крупный рогатый скот

    Пораженный крупный рогатый скот имеет лихорадку (до 40,0 ° C), кажется жестким из-за набухания коронарной перевязи в верхней части копыт (коронарной перевязи) и очень неохотно двигается. Наблюдаются серозные или слизисто-гнойные выделения из носа и эрозии на морде с шелушением слизистой оболочки. Есть слезотечение, но явных поражений глаз нет.Смертность крупного рогатого скота обычно намного ниже, чем у овец.

    Ключевые моменты
    • Температура до (40,0ºC)
    • Выделения из носа
    • Отек головы и шеи
    • Конъюнктивит (насморк)
    • Отек и изъязвление во рту
    • Набухшие соски
    • Слюна, истекающая изо рта
    • Аборт

    Еще раз, самый важный дифференциальный диагноз - ящур, при котором наблюдается обильное слюноотделение, хромота и высокая ректальная температура, которые быстро распространяются и поражают весь скот в хозяйстве.Другими дифференциальными диагнозами являются инфекционный ринотрахеит крупного рогатого скота (групповой или стадный) и злокачественная катаральная лихорадка у отдельных особей крупного рогатого скота.

    Диагностика и лечение

    Диагноз основывается на клинических признаках, обнаружении вируса с помощью ПЦР и / или сероконверсии в вирус блютанга. Лечение ограничивается антибактериальной терапией для контроля вторичных бактериальных инфекций.

    Контроль и профилактика

    Бороться с блютангом очень сложно из-за большого количества потенциальных хозяев и серотипов вируса.Хотя контроль направлен на удержание восприимчивых животных от переносчика, это не всегда практично. Бороться с мошками можно с помощью поливных инсектицидов, но это дорого и не позволяет полностью избавиться от мошек. Ограничение передвижения пораженных животных может помочь в сокращении распространения в свободные от болезней районы, но, учитывая, насколько далеко могут уйти мошки, ограничение передвижения поголовья имеет ограниченное применение при вспышках.

    Основная профилактика ВКЛО - вакцинация. Вакцины BTV-8, доступные в Великобритании, являются убитыми вакцинами.Важно понимать, что здесь нет перекрестной защиты между серотипами; вакцинация против BTV-8 не защитит от других серотипов BTV. Вакцины также не действуют сразу на крупный рогатый скот, для защиты которого требуется две дозы вакцины (и не менее 6 недель после первой вакцинации). Импорт нелицензионных вакцин не рекомендуется, поскольку было несколько вспышек заболеваний из-за использования живых вирусных вакцин, незаконно ввезенных из Южной Африки в Северную Европу, это также может быть неправильным серотипом.

    Во многих странах время вакцинации будет зависеть от местных факторов, в частности от периодов заражения от инфицированных мошек. Широкомасштабные усилия по вакцинации были важны для борьбы со вспышкой BTV-8 в 2006-8 гг., Однако вирус, вероятно, продолжал циркулировать на низких уровнях (как среди домашних, так и среди диких жвачных) и вновь появился в 2016-17 гг. снова присутствовали в европейских стадах и отарах. Недавние исследования показали, что для полной ликвидации вируса в Северной Европе потребуется вакцинация> 95% всех восприимчивых животных в течение более 5 лет.Поскольку это вряд ли будет достигнуто, мониторинг текущей ситуации с заболеванием и выбор вакцинации до наступления периодов повышенного риска - единственное практическое решение для предотвращения ВКЛО в настоящее время.

    Самую свежую информацию о Bluetongue в Великобритании и Европе можно найти по телефону

    .

    https://www.gov.uk/government/publications/bluetongue-virus-btv-8-in-france

    https://www.efsa.europa.eu/en/topics/topic/bluetongue

    https://www.gov.uk/government/news/bluetongue-virus-detected-and-dealt-with-in-imported-cattle

    Болезнь синего языка у собак, связанная с зараженной вакциной.

    Абстрактный

    Аннотация

    В середине 1993 года два брата и сестры австралийских овчарок в возрасте 4 и 5 лет, которые были вакцинированы во время беременности коммерческим поливалентным модифицированным живым вирусом чумы собак, аденовирусом и парвовирусной вакциной, прервались через 7-9 дней после вакцинации и умерли через 48 дней после вакцинации. 72 ч спустя с признаками сердечной недостаточности и респираторной недостаточности.Гистопатологическое исследование выявило отек легких и застойные явления, возможно, вторичные по причине сердечной недостаточности. Дозу от той же партии вакцины, полученную этими собаками, дозу от другой партии той же вакцины и залитую парафином селезенку от одной из этих собак анализировали с помощью специфической полимеразной цепной реакции (ПЦР) вируса блютанга (ВКЛО). Обе дозы вакцины и залитой парафином селезенки от пораженной собаки были положительными на BTV с помощью ПЦР, тогда как залитая парафином селезенка нормальной собаки была отрицательной.Остальные обе дозы вакцины тестировали путем выделения BTV на овцах. Обе овцы, вакцинированные двумя вакцинами, были положительными на антитела к BTV с помощью cELISA через 9 и 11 дней после инокуляции. BTV серотипа 11 (BTV-11 vac) был выделен в куриных яйцах с эмбрионами из крови обеих овец. BTV-11 vac и прототип BTV серотипа 11 не были цитопатическими для линии клеток почек собаки (MDCK), но размножение обоих вирусов было показано путем пассажа супернатантов MDCK на чувствительных клетках HmL-1 (легкое хомяка).Это первое сообщение об инфекции ВКЛО у собак. Эти результаты показывают, что строгие методы скрининга фетальной телячьей сыворотки (FBS), телячьей сыворотки и клеточных линий, используемых для производства вакцины, теперь должны включать BTV. Способность контаминанта вакцины, BTV-11 vac, расширять круг хозяев диктует, что скрининг не должен ограничиваться собачьими вакцинами, поскольку FBS включается в качестве среды для обогащения для многих систем клеточных культур, используемых при размножении вакцинного вируса.

    .

    Добавить комментарий

    Ваш адрес email не будет опубликован. Обязательные поля помечены *

    *