Бифидумбактерин для новорожденных при коликах: Рекомендации по профилактике кишечных колик у детей первого месяца жизни

Содержание

Рекомендации по профилактике кишечных колик у детей первого месяца жизни

Кишечные колики у детей раннего возраста связаны с интенсивным газообразованием, которое обусловлено процессами брожения в кишечнике. Процессы брожения в свою очередь усиливаются на фоне дефицита бифидобактерий у ребёнка и при увеличении в рационе кормящей матери растительной клетчатки, белка коровьего молока. Исходя из этого мы рекомендуем следующее.

  1. Со второго - третьего дня жизни начинать давать ребёнку концентрат бифидобактерина. Этот препарат можно приобрести в аптеках города или в родильном доме на третьем этаже в конце коридора послеродового отделения. Следует приобрести шесть флаконов, хранятся они на нижней полке холодильника. Даётся бифидумбактерин по пол миллилитра два раза в день перед едой. Из флакона бифидум набирается двух миллилитровым шприцом через иглу, которой прокалывают крышку флакона. Перед тем как набирать препарат в шприц флакон нужно хорошо встряхнуть т. к. в нём быстро образуется осадок. После того как бифидум набрали, шприц следует на несколько минут зажать в руке, для того чтобы препарат согрелся. Далее шприц без иглы аккуратно вставляют в угол рта ребёнка и медленно, в несколько приёмов содержимое выливают в рот. Иглу можно оставить в крышке и флакон ставят в холодильник.. Одним флаконом можно пользоваться пять дней, затем используют следующий, а остатки из первого допивает, мама, При необходимости дежурная акушерка, может показать Вам как даётся бифидобактерий.
  2. С 4-5 дня после родов на месяц следует ввести ряд ограничений в диету кормящей мамы. Из рациона исключаются все - фрукты, ягоды, соки, морсы и т.п., все сырые овощи, любые травы и все молочные продукты. Мы рекомендуем для кормящей мамы супы на некрепких бульонах, отварную говядину, индейку, кролика, тресковые рыбы. Хорошо тушеные овощи без капусты. Подсолнечное и оливковое масло. Любые виды макаронных изделий. Любые каши на воде или с небольшим добавлением молока. Чёрный и белый хлеб. Чай с молоком. Эта диета не отличается вкусовым разнообразием, но она высококалорийна, хорошо поддерживает лактацию и силы матери.

Препарат "Бифидумбактерин" для новорожденных при коликах: отзывы :: SYL.ru

Когда ребенок появляется на свет, его пищеварительная система начинает адаптироваться к самостоятельной работе. В этот период возникает множество проблем, одна из которых – колики и боли в желудке малыша. Существуют лекарственные препараты, которые помогают младенцу справиться с этим состоянием. По отзывам, "Бифидумбактерин" для новорожденных при коликах избавит ребенка от болевых ощущений.

Что это за препарат?

У новорожденных очень часто возникают неприятные ощущения в животе в виде колик. Педиатры рекомендуют мамам для устранения этих проблем использовать различные препараты. По отзывам, "Бифидумбактерин" от коликов у новорожденных уменьшает неприятные симптомы, которые беспокоят малыша в течение первых месяцев жизни.

Выбирая это лекарственное средство, необходимо знать о правильном его применении и о том, когда это действительно необходимо. Обычно "Бифидумбактерин" назначают при некорректном заселении ЖКТ бактериями. Это бывает необходимо, если ребенок рождается с небольшой массой тела после кесарева сечения, раньше поставленного срока и при возникновении других проблем.

Нарушения в работе ЖКТ негативно сказываются на развитии детского организма. Хорошо функционирующий кишечник - залог здоровья малыша. Главными жителями его в первое время являются бифидобактерии. Поэтому для улучшения работы кишечника и выписываются препараты, содержащие полезные микроорганизмы.

Из чего состоит препарат?

По отзывам, "Бифидумбактерин" для новорожденных при коликах положительно влияет на микрофлору кишечника. В состав препарата входят бифидобактерии и лактоза, которые способствуют увеличению количества полезных микроорганизмов.

После приема препарата в течение недели происходит нормализация работы органов ЖКТ. У ребенка налаживается стул, сокращается количество газов и устраняется вздутие живота. Младенец перестает страдать от болезненных колик.

Обязательное условие – регулярный прием препарата. "Бифидумбактерин" относят к комплексным препаратам, которые улучшают состояние кишечной флоры ребенка. Благодаря своему составу, он наладит процесс пищеварения и устранит неприятные симптомы.

Лекарственные формы препарата

По отзывам, "Бифидумбактерин" против колик новорожденных помогает справиться с неприятными ощущениями (вздутие, боль в животе и др.), беспокоящими младенца. Препарат выпускается в виде таблеток, порошка и ампул. Грудничкам могут назначать все виды препарата, кроме таблетированного.

Чаще всего для малышей применяют препарат в сухом виде.

Показания к применению

"Бифидумбактерин" против колик новорожденных лечит нарушения кишечной флоры, а также вздутие и другие неприятные симптомы. Средство назначают детям до года, находящимся на искусственном вскармливании. Очень часто педиатр выписывает препарат грудничкам.

Основные показания к применению:

  • Дисбиоз, возникающий под влиянием антибиотиков.
  • Кишечные инфекции.
  • Ранний перевод ребенка на искусственные смеси.
  • Хронические запоры.
  • Профилактика рахита.
  • Диатез у новорожденных.
  • Аллергия, которая протекает с дисбиозом.

Согласно данным статистики, "Бифидумбактерин" назначают грудничкам, которые появились на свет ослабленными в результате кесарева сечения и не получили природной защиты. Чаще всего с такими проблемами сталкиваются родители недоношенных младенцев, которые родились с недостаточным весом.

С какого возраста назначают препарат?

"Бифидумбактерин" против колик новорожденных используют с первых месяцев жизни ребенка. После применения препарата в течение недели происходит улучшение работы кишечника. У новорожденных налаживается стул, устраняется вздутие, повышенное газообразование и колики. Положительный эффект от использования препарата может наступить и ранее, если заболевание не находится в запущенной форме. Средство прекрасно подходит новорожденным и почти не обладает побочным действием.

Как правильно применять препарат?

Согласно отзывам, при коликах у новорождённых "Бифидумбактерин" хорошо помогает, как и при запорах, вздутии и других неприятных симптомах у грудничков. Средство необходимо принимать только по назначению врача.

Препарат младенцам дают во время кормления. Его добавляют в смесь или грудное молоко.

По инструкции препарат назначают следующим образом:

  1. Младенцам до 6 месяцев дают по одному пакетику каждые 8-12 часов в первые 2-3 дня терапии. Далее интервал уменьшают и используют его каждые 4-6 часов.
  2. Начиная с полугода и до 3-хлетнего возраста препарат дают по 1 пакету 3-5 раз в день.

Средство нужно использовать в течение 21-28 дней для достижения положительного результата. При острых кишечных инфекциях терапия "Бифидумбактерином" составляет 7-10 дней.

Наибольший эффект можно получить, если применять препарат тремя курсами с перерывом в месяц.

При кишечных инфекция детям назначают лекарственное средство в виде суппозиториев. Малышу вводят свечу каждые 8 часов. Если обнаружены хронические заболевания, то длительность лечения "Бифидумбактерином" составляет 14-28 дней.

Способ приготовления зависит от формы, в которой был приобретен препарат. Если применять его в пакетиках, то разводить нужно следующим образом:

  • Содержимое пакетика (количество порошка рассчитывается исходя из возраста маленького пациента) развести водой. Она может быть кипяченной или дистиллированной. Готовить смесь лучше всего перед приемом и не хранить длительное время.
  • Готовый раствор добавить в смесь или грудное молоко.

Для разведения лекарства использовать горячую воду не рекомендуется, потому что это может привести к гибели бифидобактерий.

Препарат, независимо от формы, необходимо хранить в холодильнике, а готовый раствор применять сразу.

При лечении следует придерживаться схемы, указанной в инструкции.

Побочные действия препарата

По отзывам, "Бифидумбактерин" против колик у новорожденных не обладает побочными эффектами, кроме аллергии у небольшого количества младенцев. Это является непереносимостью отдельных компонентов препарата в капсулах или ампулах. У грудничков не имеется или присутствует в небольших количествах лактоза, которая перерабатывает молочный сахар. В результате приема у малыша начинается вздутие живота и другие неприятные симптомы. Лучше всего маленьким пациентам давать препарат в порошкообразной форме.

Родители должны знать, что лактоза, крахмал и стеарат кальция в составе лекарства могут стать причиной аллергии.

Отзывы о препарате

"Бифидумбактерин" при коликах и запорах является отличным средством. Об этом говорят многие родители. Препарат не является лекарством мгновенного действия, поэтому однократное его применение не вылечит ребенка. Только продолжительный курс использования пробиотика в соответствии с инструкцией и рекомендациями врача приведет к нормализации работы ЖКТ.

Препарат приносит пользу в том случае, если массаж животика новорожденного, пересмотр рациона питания кормящей мамы и другие методы не дают положительных результатов.

"Бифидумбактерин" против колик у новорожденных обладает некоторыми преимуществами перед другими препаратами:

  1. Стоимость лекарства.
  2. Быстрое восстановление нарушенной микрофлоры.
  3. Сфера применения пробиотика значительно шире, чем других препаратов.
  4. Минимальное количество противопоказаний (лактозная непереносимость и аллергия на компоненты).

Во многих случаях препарат помогает ребенку избавиться от колик, запоров и вздутия живота.

Формирование нормальной микрофлоры у новорожденного

Помощь, которую оказывает "Бифидумбактерин" для младенцев, велика. Входящие в его состав микроорганизмы очень важны для нормальной деятельности кишечника.

Новорожденный знакомится с микрофлорой сразу после рождения. Уже в процессе родов, если это не кесарево сечение, стерильный кишечник младенца заселяется маминой микрофлорой. В следующие 6 месяцев количество микроорганизмов растет, а их деятельность совершенствуется.

Нарушение баланса микрофлоры маленького кишечника может произойти по многим причинам. Главное - вовремя восполнить дефицит бифидобактерий. В таком случае на помощь приходят пробиотики.

"Бифидумбактерин" – препарат, который восполняет кишечник новорожденного полезными микроорганизмами. В результате приема налаживается работа органов ЖКТ, нормализуется стул, устраняется вздутие и проходят болезненные колики в животике грудничка. Препарат, однако, не дает мгновенного результата, только продолжительный курс способен полностью избавить новорожденного от этих проблем.

Препарат "Бифидумбактерин" для новорожденных при коликах: отзывы :: SYL.ru


Препаратов от коликов на рынке много, но одним из самых известных является «Бифидумбактерин».

Это лекарство на основе лакто- и бифидобактерий прописывается не только детям, но и взрослым, поскольку борьба с коликами не является единственным действием препарата.

Изготавливается в России.

Перед применением этого лекарства нужно проконсультироваться с доктором, а назначают его также при:

  • Инфекциях кишечника, в том числе дисбактериозе,
  • Воспалительных процессах в кишечнике,
  • Расстройстве стула и пищеварения – диарея, запор,
  • Диспепсии,
  • Слабом иммунитете у ребенка, «Бифидумбактерин» способен оказать помощь детскому организму в развитии иммунитета,
  • Приеме антибиотиков.

Кроме того, он весьма полезен для недоношенных или маловесных младенцев, а также детей, перенесших родовую травму.

Так что, кишечные колики – это лишь один из вариантов, когда можно давать ребенку «Бифидумбактерин».

Надо сказать, что препарат не рассчитан на мгновенный эффект, нужно принимать его примерно неделю

, прежде чем будет заметен какой-то эффект и при борьбе с коликами в том числе.

Что это за препарат?

У новорожденных очень часто возникают неприятные ощущения в животе в виде колик. Педиатры рекомендуют мамам для устранения этих проблем использовать различные препараты. По отзывам, «Бифидумбактерин» от коликов у новорожденных уменьшает неприятные симптомы, которые беспокоят малыша в течение первых месяцев жизни.

Выбирая это лекарственное средство, необходимо знать о правильном его применении и о том, когда это действительно необходимо. Обычно «Бифидумбактерин» назначают при некорректном заселении ЖКТ бактериями. Это бывает необходимо, если ребенок рождается с небольшой массой тела после кесарева сечения, раньше поставленного срока и при возникновении других проблем.

Нарушения в работе ЖКТ негативно сказываются на развитии детского организма. Хорошо функционирующий кишечник — залог здоровья малыша. Главными жителями его в первое время являются бифидобактерии. Поэтому для улучшения работы кишечника и выписываются препараты, содержащие полезные микроорганизмы.

Аналоги

В случае невозможности применения средства «Бифидумбактерин» у новорожденного, рекомендуется заменить медикамент на аналогичный по терапевтическому действию. К числу таких лекарств можно отнести:

  1. «Бифиформ» — лекарственное средство из категории эубиотиков. Оно содержит живые молочнокислые бактерии Enterococcus faecium и Bifidobacterium longum, которые представляют нормальную микрофлору кишечника и обитают на его слизистом покрове, оказывая ряд биологических эффектов. Например, синтез лактозы, регуляция кислотного равновесия в кишечнике у новорожденного, подавление болезнетворных и условно-патогенных микробов при синтезе молочной кислоты, увеличение активности окислительных и восстановительных процессов, стимуляция функциональности иммунитета, улучшение полостного и пристеночного пищеварения, образование витаминов и незаменимых аминокислот, детоксикационное воздействие за счет всасывания колониями молочнокислых бактерий эндогенных и экзогенных токсинов.
  2. «Пробифор» — пробиотик, медикамент биологического происхождения, который регулирует баланс кишечной микрофлоры. Обладает противодиарейным действием, которое обусловлено высоким уровнем бифидобактерий, сорбированных на активированном угле, являющихся антагонистами патогенных микроорганизмов. Кроме того, данное лекарственное средство обладает противоинфекционным, антитоксическим воздействием.

Из чего состоит препарат?

По отзывам, «Бифидумбактерин» для новорожденных при коликах положительно влияет на микрофлору кишечника. В состав препарата входят бифидобактерии и лактоза, которые способствуют увеличению количества полезных микроорганизмов.

После приема препарата в течение недели происходит нормализация работы органов ЖКТ. У ребенка налаживается стул, сокращается количество газов и устраняется вздутие живота. Младенец перестает страдать от болезненных колик.

Обязательное условие – регулярный прием препарата. «Бифидумбактерин» относят к комплексным препаратам, которые улучшают состояние кишечной флоры ребенка. Благодаря своему составу, он наладит процесс пищеварения и устранит неприятные симптомы.

Группы пробиотиков

Препараты, нормализующие микрофлору кишечника, пробиотики для детей и взрослых подразделяются на несколько поколений:

  1. Монокомпонентные препараты, содержащие в своем составе какой-либо один из штаммов полезных бактерий.
  2. Самоэлиминирующиеся антогонисты.
  3. Препараты поликомпонентного типа.
  4. Пробиотики сорбированные бифидосодержащие. Такие препараты относятся к четвертому поколению и содержат живые полезные бактерии, иммобилизованные на сорбенте.

Кроме этого, пробиотики для детей до года и старше классифицируются и по роду бактерий, содержащихся в них. Производителем практически всех препаратов является Россия, за исключением некоторых зарубежных средств, например, Энтерола, Линекса и Бифиформа.

Бифидосодержащие
  • Порошковый Бифидумбактерин
  • Бифиформ
  • Пробифор
  • Бифилиз
  • Бификол
Лактосодержащие
  • Линекс
  • Ацилакт
  • Гатрофарм
  • Аципол
  • Биобактон
  • Лактобактерин
Колисодержащие
  • Биофлор
  • Колибактерин
  • Бификол
Энтерококки
Дрожжеподобные грибки
  • Биоспорин
  • Споробактерин
  • Бактисуптил
  • Бактиспори
  • Энтерол

Пробиотики для младенцев часто входят в состав специализированных детских молочных смесей одновременно с пребиотиками, использующимися в качестве дополнительной терапии при коррекции нарушений работы кишечника. К пребиотикам относят Лизоцим, пантотеновую кислоту, Лактулозу и ее аналоги, а также хорошо известный Хилак Форте.

Существуют и БАДы с пробиотиками, не являющиеся лекарственными препаратами и использующимися для проведения коррекции состояния кишечной микрофлоры и общего оздоровления организма. Часто такие пробиотики используют для восстановления после приема антибиотиков.

Среди российских препаратов для детей старшего возраста наиболее известны:

  • Эуфлорин.
  • Нормофлорин Л и В.
  • Полибактерин.
  • Йогулакт.
  • Бифацил.
  • Биовестин и Биовестин лакто.
  • Жидкие концентраты полезных бифидобактерий.
  • Ламинолакт.

Среди импортных БАДов с пробиотиками можно выделить:

  • Нормобакт.
  • Рела лайф.
  • Примадофилюс.
  • Флора дофилюс.
  • Пробионикс.
  • Риофлора баланс.
  • Айидофилус.
  • Экофемин Баланс.
  • Симбиолакт.

Пробиотики для новорожденных и малышей в форме БАДов имеют особую специальную формулу. Среди российских препаратов наиболее популярен Бифидумбактерин-мульти, производимый в нескольких вариантах для детей 3 возрастных групп. Кроме этого, для грудничков нередко используют Бифидус и Прималофилюс-джуниор.

Показания к применению

«Бифидумбактерин» против колик новорожденных лечит нарушения кишечной флоры, а также вздутие и другие неприятные симптомы. Средство назначают детям до года, находящимся на искусственном вскармливании. Очень часто педиатр выписывает препарат грудничкам.

Основные показания к применению:

  • Дисбиоз, возникающий под влиянием антибиотиков.
  • Кишечные инфекции.
  • Ранний перевод ребенка на искусственные смеси.
  • Хронические запоры.
  • Профилактика рахита.
  • Диатез у новорожденных.
  • Аллергия, которая протекает с дисбиозом.

Согласно данным статистики, «Бифидумбактерин» назначают грудничкам, которые появились на свет ослабленными в результате кесарева сечения и не получили природной защиты. Чаще всего с такими проблемами сталкиваются родители недоношенных младенцев, которые родились с недостаточным весом.

Бифидобактерии

Эти микроорганизмы впервые были выделены в 1899 году. На сегодня известно боле 30 видов бифидобактерий. Эти грамположительные изогнутые палочковидные микробы имеют размер до 5 мкм, и заселяют толстый кишечник. Располагаясь на стенках кишки, они играют роль щита и препятствуют контакту с ней патогенной микрофлоры. Общая численность этих бактерий в норме может достигать 108 – 1011 на 1 г кала.

Являясь доминирующей микрофлорой у здорового человека, они обеспечивают процессы обмена белков и жиров, участвуют в регуляции минерального обмена, синтезе витаминов групп В и К.

Кроме своих основных обязанностей эти микроорганизмы проявляют активность против патогенных штаммов, вырабатывая специфические органические кислоты антимикробного действия. Пониженное количество бифидобактерий может вызвать ферментативную, метаболическую и антитоксическую дисфункцию, а также нарушение колонизационной резистентности и иммунного ответа на патогенную микрофлору. Бифидобактерии улучшают ферментацию пищи, усиливая белковый гидролиз, участвуют в омылении жиров, сбраживании углеводов, рассасывании клетчатки. Их заслуга в нормальной перистальтике кишечника, а это своевременная и стабильная эвакуация продуктов пищеварения.

Как правильно применять препарат?

Согласно отзывам, при коликах у новорождённых «Бифидумбактерин» хорошо помогает, как и при запорах, вздутии и других неприятных симптомах у грудничков. Средство необходимо принимать только по назначению врача.

Препарат младенцам дают во время кормления. Его добавляют в смесь или грудное молоко.

По инструкции препарат назначают следующим образом:

  1. Младенцам до 6 месяцев дают по одному пакетику каждые 8-12 часов в первые 2-3 дня терапии. Далее интервал уменьшают и используют его каждые 4-6 часов.
  2. Начиная с полугода и до 3-хлетнего возраста препарат дают по 1 пакету 3-5 раз в день.

Средство нужно использовать в течение 21-28 дней для достижения положительного результата. При острых кишечных инфекциях терапия «Бифидумбактерином» составляет 7-10 дней.

Наибольший эффект можно получить, если применять препарат тремя курсами с перерывом в месяц.

При кишечных инфекция детям назначают лекарственное средство в виде суппозиториев. Малышу вводят свечу каждые 8 часов. Если обнаружены хронические заболевания, то длительность лечения «Бифидумбактерином» составляет 14-28 дней.

Способ приготовления зависит от формы, в которой был приобретен препарат. Если применять его в пакетиках, то разводить нужно следующим образом:

  • Содержимое пакетика (количество порошка рассчитывается исходя из возраста маленького пациента) развести водой. Она может быть кипяченной или дистиллированной. Готовить смесь лучше всего перед приемом и не хранить длительное время.
  • Готовый раствор добавить в смесь или грудное молоко.

Для разведения лекарства использовать горячую воду не рекомендуется, потому что это может привести к гибели бифидобактерий.

Препарат, независимо от формы, необходимо хранить в холодильнике, а готовый раствор применять сразу.

При лечении следует придерживаться схемы, указанной в инструкции.

Формы выпуска лекарства Бифидумбактерин

Грудничкам подойдет бифидумбактерин форте:

  1. в ампулах
  2. во флаконах
  3. в виде порошка
  4. таблетированный

Для ампул и флаконов биомасса живых бактерий высушивается в специальной среде. Одна доза содержит 10*7 микробных клеток, а во флаконе находится 5 таких доз. Для порошкообразного препарата биомасса бактерий очищается от среды взращивания, и одна доза также содержит 5 доз. Перед тем, как давать младенцу Бифидумбактерин форте, требуется консультация врача, чтобы он определил, сколько должен продлиться курс лечения.

Побочные действия препарата

По отзывам, «Бифидумбактерин» против колик у новорожденных не обладает побочными эффектами, кроме аллергии у небольшого количества младенцев. Это является непереносимостью отдельных компонентов препарата в капсулах или ампулах. У грудничков не имеется или присутствует в небольших количествах лактоза, которая перерабатывает молочный сахар. В результате приема у малыша начинается вздутие живота и другие неприятные симптомы. Лучше всего маленьким пациентам давать препарат в порошкообразной форме.

Родители должны знать, что лактоза, крахмал и стеарат кальция в составе лекарства могут стать причиной аллергии.

Меры предосторожности, противопоказания

В большинстве случаев дети переносят данный пробиотик хорошо, и побочные реакции отсутствуют. Как указывается в инструкции по применению, лекарство «Бифидумбактерин» противопоказан новорожденным только при повышенной чувствительности к лактозе, крахмалу, стеариновокислому кальцию.

При гиполактазии принимать пробиотик во флаконах и ампулах не рекомендуется, поскольку они содержат молочный сахар, а при отсутствии или недостатке лактазы (фермент, расщепляющий лактозу) повышается риск избыточного газообразования у ребенка или возникновения колик.

Не рекомендуется сопутствующее применение данного медикаментозного средства с антибиотиками, его растворение в горячей воде (более 40°), а также хранение в растворенном виде.

Отзывы о препарате

«Бифидумбактерин» при коликах и запорах является отличным средством. Об этом говорят многие родители. Препарат не является лекарством мгновенного действия, поэтому однократное его применение не вылечит ребенка. Только продолжительный курс использования пробиотика в соответствии с инструкцией и рекомендациями врача приведет к нормализации работы ЖКТ.

Препарат приносит пользу в том случае, если массаж животика новорожденного, пересмотр рациона питания кормящей мамы и другие методы не дают положительных результатов.

«Бифидумбактерин» против колик у новорожденных обладает некоторыми преимуществами перед другими препаратами:

  1. Стоимость лекарства.
  2. Быстрое восстановление нарушенной микрофлоры.
  3. Сфера применения пробиотика значительно шире, чем других препаратов.
  4. Минимальное количество противопоказаний (лактозная непереносимость и аллергия на компоненты).

Во многих случаях препарат помогает ребенку избавиться от колик, запоров и вздутия живота.

Помогает ли средство при коликах, поносе и запорах?

Действие препарата «Бифидумбактерин форте» направлено на восстановление нормальной микрофлоры в пищеварительной системе. При заселении желудочно-кишечного тракта полезными бактериями происходит уменьшение газообразования, колик, нормализуется стул (останавливается диарея, прекращаются запоры) и аппетит. Улучшения становятся заметны после недели использования.

Однако пробиотик не уменьшает болезненные ощущения при дисбактериозе и коликах. Как только в кишечнике создастся баланс бифидобактерий, лактобактерий и вредных микроорганизмов, проблема перестанет беспокоить малыша. Если дискомфорт связан с аллергией на мамино питание или непереносимостью смеси, то для его устранения необходимо использовать дополнительные препараты.

Формирование нормальной микрофлоры у новорожденного

Помощь, которую оказывает «Бифидумбактерин» для младенцев, велика. Входящие в его состав микроорганизмы очень важны для нормальной деятельности кишечника.

Новорожденный знакомится с микрофлорой сразу после рождения. Уже в процессе родов, если это не кесарево сечение, стерильный кишечник младенца заселяется маминой микрофлорой. В следующие 6 месяцев количество микроорганизмов растет, а их деятельность совершенствуется.

Нарушение баланса микрофлоры маленького кишечника может произойти по многим причинам. Главное — вовремя восполнить дефицит бифидобактерий. В таком случае на помощь приходят пробиотики.

«Бифидумбактерин» – препарат, который восполняет кишечник новорожденного полезными микроорганизмами. В результате приема налаживается работа органов ЖКТ, нормализуется стул, устраняется вздутие и проходят болезненные колики в животике грудничка. Препарат, однако, не дает мгновенного результата, только продолжительный курс способен полностью избавить новорожденного от этих проблем.

Пробиотики и молочная смесь

Для грудных детей лучшим вариантом пищи является молоко матери. С его помощью в организм крохи поступает достаточное количество полезных компонентов. При кормлении смесью работа кишечника может быть затруднена. Палочка нарушает работу и тонус мышечных масс, поэтому у грудничка увеличивается риск развития опасных болезней.

Бифидум БАГ и Трилакт – одни из самых популярных препаратов, которые используются для улучшения микробиоценоза кишечника. Они идеально дополняют искусственное кормление. В них нет вредных и опасных модифицированных штаммов. Для их создания производители также не используют молочный белок, лактозу, красители и консерванты. При регулярном использовании данных препаратов удается создать питательную среду, которая практически полностью соответствует материнскому молоку.

Педиатры советуют использовать смесь с пробиотиками еще в первые дни жизни крохи. Благодаря этому удается добиться лечебного воздействия, которое служит профилактикой серьезных заболеваний. Дополнительно укрепляется иммунитет и достигается оптимизация процесса пищеварения. При выборе такой смеси необходимо ориентироваться на индивидуальные особенности организма крохи.

Дисбактериоз

Эта патология возникает, когда не просто бифидобактерии понижены, а есть тенденция к тому, что патогенная микрофлора начинает преобладать над нормальной. Такой дисбактериоз называют истинным. Он не возникает спонтанно.

Начальным этапом, характеризующим наличие прогрессирующего дисбиоза может служить стойкое увеличение количества балластовых бактерий (кишечная палочка со слабой ферментативной активностью, энтерококки). Они начинают развиваться ввиду того, что основная культура исчезает. Кроме инфекций в кишечнике, причина может быть в частых приемах антибиотиков без последующей коррекции или неправильное (нерациональное) питание.

Дисбактериоз у новорожденных может быть транзиторным (временным), когда по причине различных факторов (недоношенность младенцев, ослабление организма после тяжелых родов) возникает нарушение нормального цикла или развития. После стабилизации состояния, как правило, к концу второй недели, нормофлора восстанавливается.

Анализ

Пониженное содержание бифидобактерий в кале чаще всего определяется исследованием микрофлоры кишечника при подозрении на дисбактериоз. Этот анализ не имеет широкого распространения в обычной медицинской практике ввиду длительности и сложности его проведения на базе поликлинических отделений.

Чтобы получить точные результаты анализа, необходимо обеспечить быструю доставку кала (не более 3 часов) в стерильном контейнере в лабораторию. Собранный биоматериал (10 г) желательно охладить, но нельзя замораживать. Клизмы и препараты с барием использовать нельзя. Прием антибиотиков следует прекратить за 12 часов до сбора. Также за несколько дней до анализа прекращают использовать слабительные препараты и ректальные свечи.

Обычно для подсчета количества микробов требуется около недели. За это время содержимое контейнера, посеянное на питательной среде в условиях термостата, прорастает, и специалист подсчитывает колонии бактерий.

Бифидумбактерин для Новорожденных (и Грудничков!)

Опытные мамы и папы уверяют, что Бифидумбактерин для новорожденных и грудничков является эффективным и проверенным средством в борьбе с коликами и вздутием живота. Безопасно ли это средство, и как давать Бифидумбактерин грудничку?


  

Содержание:

 

Работа желудочно-кишечного тракта у младенца

Чем полезен Бифидумбактерин детям

В какой форме давать Бифидумбактерин грудничкам

Бифидумбактерин или Бифидумбактерин Форте для новорожденных — что лучше?

Бифидумбактерин: инструкция для новорожденных

Сухой Бифидумбактерин - как разводить?

Противопоказания

 


Кишечник едва родившегося младенца – это воплощение чистоты, совершенная медицинская стерильность. В нем пока не содержатся ни «плохие», ни «хорошие» бактерии, помогающие переваривать пищу. Первые микроорганизмы ребенок получает только с материнским молоком, но зачастую их оказывается недостаточно.

 

Когда бактерий в организме слишком мало, организм не успевает справляться с поступающей в него пищей, и у малыша начинаются проблемы с работой ЖКТ, появляются колики и дисбактериоз.

 

В этом случае бифидобактерии для новорожденных становятся средством спасения. Это микроскопические живые организмы, идентичные бактериям, которые содержатся в кишечнике человека – попадая в организм младенца, они налаживают работу желудочно-кишечного тракта. Давайте разберемся, как они работают и зачем нужны?

 

 

 

 

Работа желудочно-кишечного тракта у младенца

 

Значимость правильной работы пищеварительной системы в целом и кишечника в частности невозможно переоценить. Большинство питательных веществ усваивается именно там – поэтому, когда кишечник работает неправильно, и организму не хватает энергии, плохое настроение, слабость и недомогания обеспечены.

Не обошло это стороной и новорожденных – для едва родившихся малышей правильная работа ЖКТ важна ничуть не меньше, чем для взрослых! При малейших сбоях в его работе у младенца появятся вздутия и колики, что доставляет много беспокойства и ему, и его родителям.

 

Работа желудочно-кишечного тракта строится на взаимодействии бактерий. Поступая в организм с молоком матери, полезные бактерии формируют колонии и защищают место своего обитания от незваных гостей: они обволакивают кишечник защитной пленкой, способствующей правильной работе кишечника, и помогают формировать нервные окончания для приема иной пищи, кроме молока или детской смеси.

 

Однако, когда полезных бактерий в организме оказывается недостаточно, у малыша начинаются спазматические колики. Поступившая в организм пища не успевает перерабатываться целиком, начинает бродить и выделять газовые пузырьки, вызывая болезненную реакцию.

 

Важно, чтобы бактерий в кишечнике ребенка было достаточно: малейшая их нехватка приведет к спазмам, авитаминозу, дисбактериозу и другим неприятным состояниям, которые придется лечить.

 

Деятельность желудочно-кишечного тракта отражается на всем организме маленького человека, поэтому правильная его работа – залог здоровья вашего малыша. И, когда полезных бактерий в нем оказывается недостаточно, Бифидумбактерин для новорожденных и грудничков – первый помощник. В качестве активного компонента препарата выступает бифидобактерия бифидум.

 

 

 

 

 

Чем полезен Бифидумбактерин детям

 

Этот замечательный препарат с бифидобактериями в основе станет настоящим спасением для малыша, имеющего проблемы с пищеварительной системой. Живые микроорганизмы в его составе, идентичны полезным бактериям в кишечнике человека, при попадании в организм начнут выполнять их функцию: застилать кишечник защитной пленкой, развивать нервные окончания для усваивания полезных веществ, бороться с болезнетворными микроорганизмами.

 

Препарат Бифидумбактерин быстро устранит большинство проблем, возникающих в ЖКТ малютки: дисбактериоз, колики, нехватку питательных веществ, способную даже привести к рахиту. Не менее полезно будет назначение такого препарата малышам с анемией и диатезом, а также детям, переходящим на новое питание: к примеру, с грудного молока на детскую смесь.

 

Однако важно отметить, что бактерии бифидум для новорожденных и грудничков не стоит использовать в качестве профилактики: препарат назначает исключительно педиатр при серьезных отклонениях в работе желудочно-кишечного тракта, когда неправильная работа микроорганизмов становится причиной болезней и недомогания.

 

Назначать Бифидумбактерин для детей самостоятельно нельзя!

 

Если у вашего малыша все в порядке с полезными бактериями, а вы станете давать ему препарат, то это может спровоцировать дисбактериоз именно их перенасыщением.

Бифидумбактерин, помимо бифидобактерий в составе, может также оказывать антибактериальное воздействие на болезнетворные бактерии. Таким образом, этот препарат не только нормализует работу желудочно-кишечного тракта, а еще и восстанавливает иммунитет.

 

 

 

 

В какой форме давать Бифидумбактерин грудничкам

 

Препарат выпускается в нескольких разных формах:

 

  • сухой Бифидумбактерин – порошок во флаконах и фольгированных пакетиках;
  • жидкий Бифидумбактерин в ампулах;
  • в капсулах;
  • в таблетках;
  • свечи Бифидумбактерин.

 

Для новорожденных и грудных детей рекомендуется использовать препарат Бифидумбактерин детский, произведенный в жидком виде, а так же в виде порошков или свечей.

 

 

 

Бифидумбактерин или Бифидумбактерин Форте для новорожденных — что лучше?

 

Бифидумбактерин Форте считается улучшенным лекарственным препаратом.

 

Он отличается биомассой живых бифидобактерий, адсорбированных на косточковом активированном угле. Это позволяет препарату, попав в кишечник, действовать быстрее.

 

Поэтому, несомненно, при серьезных заболеваниях лучше использовать Бифидумбактерин форте.

 

 

 

 

Бифидумбактерин: инструкция для новорожденных

 

Конечно же, Бифидумбактерин новорожденным и грудничкам должен назначаться сугубо индивидуально, в зависимости от того, в каком состоянии сейчас находится пищеварительная система младенца: за этим должен следить педиатр. Его же задача назначать подходящую схему приема.

В зависимости от состояния ребенка врач может назначить от 2 до 5 доз 1-3 раза в сутки. Длительность курса – до 21 дня, возможен повтор через 1 месяц.

 

Родителям следует знать, что в таблетке и свече содержится по 1 дозе препарата, остальные формы препарата содержат по 5 доз.

 

Желательно принимать лекарство за полчаса до еды, либо спустя 1 час после. То есть препарат для достижения максимальной эффективности нужно пить на пустой желудок. В случае с младенцами добиться этого достаточно сложно. Поэтому допустимо разводить Бифидумбактерин для новорожденных молоком. Грудничкам, находящимся на искусственном вскармливании, порошок Бифидумбактерин можно добавлять и разводить вместе с порошковыми смесями.

 

 

 

Сухой Бифидумбактерин - как разводить?

 

Порошок следует высыпать в небольшую емкость, затем добавить кипяченую воду из расчета 5 мл на 1 дозу (один пакетик содержит 5 доз). Средство необходимо тщательно перемешать, выждать около 10 минут для максимального растворения (препарат полностью не растворяется).

 

Приготовленный раствор хранению не подлежит (бифидобактерии в нем быстро погибают), а вот оставшуюся нерастворенной часть порошка можно хранить, но не более суток.

 

 

 

 

Противопоказания

 

Бифидумбактерин для грудничков и новорожденных в допустимых инструкциях дозах совершенно не опасен, поскольку не имеет никаких побочных действий и противопоказаний. Но есть оно «НО!». Возможна аллергическая реакция на один из компонентов препарата.

 

Если у вашего малыша есть непереносимость какого-либо из следующих веществ, воздержитесь от приема и проконсультируйтесь о замене препарата с педиатром:

 

  • лактоза;
  • крахмал высушенный;
  • стеарат кальция.

 

Если вы не знали об аллергии у своего малыша на указанные компоненты, но обнаружили у него усиленное вздутие или колики после приема, иные проявления аллергической реакции, прекратите применение Бифидумбактерина немедленно. Существуют аналоги этого препарата, не содержащие в составе этих веществ – можете попробовать принимать их.

 

Правильная работа желудочно-кишечного тракта младенца – это очень важно. Если не помогать ребенку вовремя, страдания в младенческом возрасте могут обратиться проблемами с пищеварением во взрослом: поэтому, если вашему ребенку не хватает полезных бактерий, смело применяйте Бифидумбактерин, но предварительно проконсультируйтесь со специалистом.


 

Как принимать Бифидумбактерин

 

отзывы, инструкция по применению для детей при коликах, как разводить и давать Бифидумбактерин грудничку при поносе

Бифидумбактерин для новорожденных представляет собой лекарство, которое включает множество микроорганизмов, улучшающих функции органов пищеварения.

С помощью препарата удается восстановить микрофлору, улучшить обмен веществ, повысить неспецифическую резистентность детского организма. Данное средство помогает предотвратить размножение вредных микроорганизмов в кишечнике. Потому его нередко назначают в детском возрасте.

Формы выпуска и состав

Существует несколько форм выпуска данного лекарства:

  • Ампулы;
  • таблетки;
  • суппозитории;
  • пакетики-саше.

В каждой из лекарственных форм присутствует довольно много живых бактерий, которые помогают справиться с патогенной микрофлорой. В каждой ампуле присутствует питательная среда и около 107 живых и активных бифидобактерий, а порошок включает 108 бактерий, которые выделены из искусственно выращенной флоры.

На заметку. Иммобилизация Бифидумбактерина ускоряется, если принимать его в сочетании с активированным углем. Это помогает воздействовать на дрожжеподобные грибки, кишечную палочку и стафилококки.

Механизм действия

Данное лекарство направлено на оптимизацию кишечного баланса. Показанием к применению средства является ситуация, когда в организме не хватает полезных бактерий.

Инструкция по применению препарата БифидумбактеринБифидумбактерин для детей назначают для улучшения работы кишечника и восстановления его микрофлоры. Помимо этого, средство обладает иммуномодулирующими свойствами.

В составе лекарства присутствуют живые бифидобактерии. Когда ребенок находится в материнской утробе, его кишечник является стерильным. После рождения в орган заселяется микрофлора, похожая на материнскую. Давать Бифидумбактерин новорожденному рекомендуется для того, чтобы помочь развиться требуемому количеству полезных бактерий.

Нарушения функций кишечника ребенка связаны с дефицитом нужных микроорганизмов. За счет применения препарата удается добиться мягкого и естественного воздействия на детский организм. Потому прием средства допускается уже с первого дня жизни.

Показания

Перед тем как давать Бифидумбактерин грудничку, нужно ознакомиться с основными показаниями к применению лекарства. К ним относят следующее:

  1. Кишечный дисбактериоз. Препарат нужно давать при коликах, метеоризме, нарушении стула.
  2. Отдельные инфекционные патологии. Чаще всего применение средства требуется при заражении кишечника стафилококками, сальмонеллой, шигеллами. Бифидумбактерин отлично помогает от поноса, который сопровождает данные нарушения.
  3. Применение некоторых медикаментозных средств – в частности, антибиотиков. Такие препараты приводят к нарушению микрофлоры пищеварительных органов.
  4. Длительные запоры. Лекарство помогает справиться с нарушениями стула, которые присутствуют больше суток. Особенно часто такое средство выписывают детям, которые появились на свет раньше срока или в результате кесарева сечения.
  5. Пищевые отравления. Грудничкам нередко дают Бифидумбактерин после введения новых продуктов, от которых у них появляется диарея.

На заметку. Препарат нередко приходится назначать детям, которые питаются адаптированными смесями. В данном случае нарушения работы кишечника встречаются намного чаще, чем при грудном вскармливании.

Способ применения

Чтобы получить требуемый эффект, нужно знать, как разводить Бифидумбактерин. Как правило, дозировка препарата подбирается врачом. Однако перед началом использования непременно нужно изучить инструкцию по применению Бифидумбактерина для новорожденных.

На способ применения лекарства влияет форма выпуска:

  1. Светлый кал у детей: причины и возможные заболеванияЧаще всего новорожденным детям дают порошок. Сухое лекарство необходимо смешать с 50 мл смеси, грудного молока или кипяченой воды. Полученный раствор нужно сразу же давать ребенку. Как правило, малышам первого года жизни выписывают по 1 пакетику трижды в сутки. Применение Бифидумбактерина для грудничков можно осуществлять при помощи бутылочки, чистого шприца без иглы или чайной ложки.
  2. Иногда для лечения новорожденных малышей применяют средство в ампулах. Делать это нужно примерно так: сухое содержимое емкости следует смешать с молоком или кипяченой водой, после чего сразу дать ребенку. Схема применения обычно совпадает с особенностями использования средства в пакетиках: по 1 флакону трижды в день.
  3. Капсулы и таблетки новорожденным детям не выписывают, поскольку возникают сложности с их применением. Такие средства можно использовать только после 12 лет. В редких случаях допустимо применять таблетированные формы. Однако в этом случае средство нужно измельчить и смешать с жидкостью.

Неправильное разведение препарата может принести детскому организму серьезный вред. Потому так важно четко выполнять все врачебные рекомендации. Это поможет наладить стул ребенка, улучшить функции органов пищеварения, справиться с метеоризмом.

Отзывы свидетельствуют, что лекарство нужно в среднем принимать в течение 17-20 суток. Затем рекомендуется сделать перерыв. При необходимости терапию можно повторить.

Противопоказания

Если правильно использовать Бифидумбактерин при поносе у ребенка, лекарство не причинит здоровью вреда. Препарат не имеет противопоказаний или возрастных ограничений. Единственным исключением может стать аллергия на ингредиенты лекарства. Детям, которые имеют склонность к иммунным реакциям, препарат следует давать с осторожностью.

Побочные эффекты

Лекарство абсолютно безвредно и не приносит вреда организму малыша. Однако в отдельных ситуациях у ребенка может появиться аллергия на компоненты средства. К потенциально опасным составляющим относят лактозу и крахмал. Данные реакции чаще всего проявляются в виде высыпаний на коже, ринита, кашля. Также может появиться рвота или диарея.

Нарушения пищеварительного процесса могут наблюдаться и в случае неправильного приготовления раствора. Потому так важно соблюдать следующие рекомендации:

  1. Во время приема средства важно следить, чтобы ребенок не подавился. Потому необходимо подобрать подходящий метод введения лекарства. Стоит учитывать, что малыш не должен плакать или вертеться.
  2. Препарат нужно давать младенцу сразу после разведения. Категорически запрещено хранить готовый раствор в холодильнике. Это может принести серьезный вред детскому здоровью.
  3. После применения лекарства нужно контролировать общее состояние малыша. При появлении высыпаний на коже, нарушении дыхания, метеоризме, диарее или других признаках стоит немедленно обратиться к врачу.

Аналоги

В отдельных ситуациях требуется подобрать аналоги Бифидумбактерина для детей. Сегодня известно немало лекарств, которые обладают похожим принципом действия, что позволяет выбрать оптимальное средство.

Итак, основные аналоги препарата включают следующее:

Аналоги Бифидумбактерина: список эффективных лекарств
  • Бифиформ бэби;
  • Линекс;
  • Профибор;
  • Бификол;
  • Лактобактерин.

В составе данных препаратов присутствуют полезные бактерии, которые требуются для нормальной работы кишечника. Основное отличие кроется в дополнительных компонентах. Важно учитывать, что аналогичные лекарства имеют другие дозировки и схемы применения. Поэтому так важно получить консультацию педиатра.

Бифидумбактерин – эффективное лекарственное средство, которое позволяет восстановить кишечную микрофлору и улучшить состояние новорожденного малыша. Чтобы добиться желаемых результатов и избежать побочных реакций, важно четко следовать врачебным рекомендациям.

Если вам понравилась статья, предлагаем обсудить ее в отзывах!

противопоказания, побочное действие, дозировки, состав – в справочнике лекарственных средств

Бифидумбактерин сухой при кишечных заболеваниях применяют перорально, а в акушерско-гинекологической практике интравагинально.

С флакона удаляют металлический колпачок и резиновую пробку. Содержимое флакона растворяют кипяченой водой комнатной температуры из расчета 1 чайная ложка на 1 дозу лекарственного средства.

Способ растворения:

  • в стакан наливают требуемое количество чайных ложек воды (в соответствии с числом доз, указанных на этикетке тары), затем из стакана переносят во флакон небольшое количество воды для растворения сухой массы. После растворения содержимое флакона переносят в тот же стакан и перемешивают.

Одна чайная ложка растворенного таким образом лекарственного средства составляет одну дозу. Необходимое количество доз (соответственно чайных ложек) выпивают за 20-30 мин до еды. Грудным детям лекарственное средство можно давать непосредственно перед кормлением.

При кишечных заболеваниях длительность курса лечения бифидумбактерином определяется тяжестью клинических проявлений, возрастом больного и составляет 2-4 недели, а в отдельных случаях до 3-х месяцев. С профилактической целью назначают по 5 доз 1-2 раза/сут в течение 1-2 недель.

Новорожденным группы «риска» целесообразно начинать применение лекарственного средства в родильном отделении с первых суток жизни до выписки по 1-2 дозы на прием 3 раза/сут.

При кишечных заболеваниях детям первого полугодия жизни лекарственное средство назначают по 3 дозы на прием 3 раза/сут. Детям второго полугодия и старше - по 5 доз 2 раза/сут.

При возникновении у детей нарушений функций ЖКТ и угрозы язвенно-некротического энтероколита назначают до 10 доз в сут.

При острых хронических воспалительных заболеваниях тонкого и толстого кишечника, колитах и энтероколитах у взрослых рекомендуется по 5 доз 2-3 раза/сут.

В комплексной терапии с антибиотиками и другими антибактериальными препаратами рекомендуется:

  • детям до 1 года по 5 доз 2-3 раза/сут, детям старше 1 года по 5 доз 3-4 раза/сут, взрослым по 10 доз 2-3 раза/сут.

Для интравагинального введения бифидумбактерин растворяют выше указанным способом. Полученной взвесью лекарственного средства пропитывают стерильный тампон, который вводят интравагинально и оставляют на 2-3 ч.

При воспалительных гинекологических заболеваниях и предродовой подготовке беременных группы «риска» бифидумбактерин назначают по 5-10 доз 1 раз/сут в течение 5-8 дней под контролем восстановления чистоты вагинального секрета до I-II степени и исчезновения клинических симптомов воспаления. При необходимости курс лечения бифидумбактерином можно повторить.

Бифидумбактерин в ампулах для новорожденных — нужно ли и инструкция по применению

Бифидум для новорожденных — это препарат, который назначают, чтобы помочь желудочно-кишечному тракту малыша заселиться «правильной» микрофлорой и начать самостоятельно работать. Когда показан Бифидумбактерин, и как его применять?

Показания к применению

Кишечник малыша, который только что появился на свет, абсолютно стерильный. Постепенно он заселяется микрофлорой, и полезной, которая помогает переваривать пищу, и опасной.

Полезные бифидобактерии подавляют действие «непрошенных гостей» — болезнетворных микроорганизмов и улучшают состояние желудочно-кишечного тракта новорожденного.

Бифидумбактерин — препарат из категории пробиотиков, лекарств, которые стимулируют рост полезных бактерий в кишечнике и подавляют вредные (в отличие от пребиотиков — препаратов, содержащих готовые бактерии).

Педиатры назначают лекарство в следующих случаях:

  • искусственное вскармливание, переход с грудного молока на смесь; обычно при кормлении грудью пробиотики не нужны — все необходимое уже есть в мамином молоке;
  • кишечные колики, вздутие;
  • проблемы со стулом — запоры, частые поносы и т. д.;
  • недостаточная прибавка в весе;
  • у мамы сахарный диабет, инфекционные болезни, тяжелые осложненные роды, гестоз при беременности.

Бифидумбактерин налаживает работу желудочно-кишечного тракта, улучшает иммунитет.

Состав Бифидумбактерина

В состав препарата входят живые бифидобактерии, идентичные собственным микроорганизмам кишечника, активированный уголь и компоненты среды, в которой производится препарат, — молоко обезжиренное, сахароза и желатин.

Побочные эффекты и противопоказания

Препарат хорошо переносится, и инструкция по применению Бифидумбактерина для новорожденных не содержит противопоказаний, кроме аллергии на компоненты препарата, и при непереносимости лактозы. В этих случаях препарат запрещен.

Аллергическая реакция на компоненты проявляется в виде сыпи, кашля, насморка, рвоты.

Отмечены случаи расстройства пищеварения, но они обычно происходят из-за неправильного приготовления раствора.

Форма выпуска Бифидумбактерина

Бифидумбактерин выпускается в нескольких формах:

  • порошок (в стеклянных ампулах или пакетиках из фольги) для приготовления раствора;
  • капсулы;
  • свечи;
  • жидкость (в ампулах и флаконах).

Условия хранения

Бифидумбактерин хранят в темном прохладном месте (не выше +10 °С), при этих условиях препарат остается пригодным к применению в течение года с даты выпуска.

При комнатной температуре срок хранения — не более 10 суток.

Хранится только неразведенный препарат.

Правила приема Бифидумбактерина

Грудничкам Бифидумбактерин прописывают в виде жидкости или раствора из порошка.

Препарат дают малышу перед кормлением из бутылочки, шприца без иглы или с ложки.

Курс лечения — от двух недель до 2-3 месяцев, определяет педиатр.

Порошок для раствора

Самая удобная для применения форма препарата — порошок для приготовления раствора в пакетиках или флаконах. Его удобнее дозировать и давать ребенку.

В каждой упаковке есть инструкция к Бифидумбактерину для новорожденных в ампулах (флаконах) и пакетиках с общей информацией.

Пакетик из фольги содержит 5 доз препарата, флакон — 3 или 5.

Необходимое количество препарата разводят в чайной ложке кипяченой воды. Следите, чтобы температура воды не была выше 40 °С, иначе бифидобактерии сварятся, и толку от них не будет.

Кроме воды, порошок разводят в грудном молоке или детской смеси.

Хранить готовый раствор нельзя, поэтому, если в ампуле 3 дозы препарата, то необходимо отложить третью часть и развести в другой посуде.

Жидкий препарат

Реже, чем раствор из порошка, педиатры рекомендуют жидкое лекарство в стеклянных ампулах.

Такой Бифидумбактерин в ампулах для новорожденных — концентрат живых бифидобактерий, препарат, готовый к использованию. Перед применением раствор необходимо хорошо встряхнуть.

Подводим итоги

Бифидумбактерин — безопасный, простой в применении препарат. В аптеках его продают без рецепта.

Но это не значит, что допустима самодеятельность: назначает препарат, расписывает дозировку и схему приема врач-педиатр.

Побочные эффекты при приеме Бифидумбактерина — редкость. Самое распространенное ограничение на прием препарата — непереносимость лактозы. В этом случае чаще других назначают Ацилакт, он не содержит лактозу и разрешен при лактазной недостаточности.

В аптеках продают препараты-аналоги: Бифиформ, Лактобактерин, Линекс, Пробифор, Бификол и т. д.

Важно помнить: все эти лекарства разные, с разными правилами приема, дозировкой и т. д. Не все они подходят для детей, особенно грудничков. Большинство из этих препаратов комплексные, а врачи для новорожденных рекомендуют монопрепараты.

Берегите себя и своего малыша!

0

0

698

Facebook

Twitter

Мой мир

Вконтакте

Одноклассники

Интеграция трехмесячного кормления со штаммами бифидобактерий предотвращает желудочно-кишечные симптомы у здоровых новорожденных

, 1, , 2, 3, , 2 , 1 , , 2, 3 , 1 , 4 , 4 , 2 и 1, *

Ирен Алоизио

1 Департамент сельскохозяйственных и пищевых наук Болонского университета, Болонья , Италия

Flavia Prodam

2 Департамент медицинских наук, Università degli Studi del Piemonte Orientale, Новара, Италия

3 Междисциплинарный исследовательский центр аутоиммунных заболеваний (IRCAD), Università degli Studi del Piemonte Orientale, Novarate Orientale Италия

Enza Giglione

2 Департамент медицинских наук, Università degli Studi del Piemonte Orientale, Новара, Италия

Николь Боззи Чио nci

1 Департамент сельскохозяйственных и пищевых наук, Болонский университет, Болонья, Италия

Арианна Солито

2 Департамент медицинских наук, Università degli Studi del Piemonte Orientale, Новара, Италия

Simonetta Bellone

2 Департамент медицинских наук, Università degli Studi del Piemonte Orientale, Новара, Италия

3 Междисциплинарный исследовательский центр аутоиммунных заболеваний (IRCAD), Università degli Studi del Piemonte Orientale, Novara, Италия

Loredana Baffoni 1

Кафедра сельскохозяйственных и пищевых наук, Болонский университет, Болонья, Италия

Лука Могна

4 Biolab Reserach, Новара, Италия

Marco Pane

4 Biolab Reserach, Novara, Италия

Gianni Bona

2 Департамент медицинских наук, Università degli Studi del Piemonte Or ientale, Новара, Италия

Диана Ди Джоя

1 Кафедра сельскохозяйственных и пищевых наук, Болонский университет, Болонья, Италия

1 Кафедра сельскохозяйственных и пищевых наук, Болонский университет, Болонья, Италия

2 Департамент медицинских наук, Università degli Studi del Piemonte Orientale, Новара, Италия

3 Междисциплинарный исследовательский центр аутоиммунных заболеваний (IRCAD), Università degli Studi del Piemonte Orientale, Novara, Italy 9003 Biolab Reseach 4 4 , Новара, Италия

Редакция: Надия В.Бойко, Ужгородский национальный университет, Украина

Рецензент: Брайан Д. Пикколо, Центр детского питания Арканзаса, США; Ирена Рогель, биотехнический факультет, Университет Любляны, Словения

Эта статья была отправлена ​​в раздел «Пищевая микробиология» журнала «Границы питания»

† Эти авторы внесли равный вклад в эту работу.

Поступило 30.11.2017 г .; Принято 23 апреля 2018 г..

Copyright © 2018 Алоизио, Продам, Джильоне, Боцци Чиончи, Солито, Беллоне, Баффони, Могна, Пане, Бона и Ди Джоя.

Это статья в открытом доступе, распространяемая в соответствии с условиями лицензии Creative Commons Attribution License (CC BY). Использование, распространение или воспроизведение на других форумах разрешено при условии указания автора (авторов) и правообладателя и ссылки на оригинальную публикацию в этом журнале в соответствии с принятой академической практикой. Запрещается использование, распространение или воспроизведение без соблюдения этих условий.

Эта статья цитируется в других статьях в PMC.

Abstract

Инфантильные функциональные расстройства желудочно-кишечного тракта распространены в первые месяцы жизни. Их патогенез остается неизвестным, хотя данные свидетельствуют о множестве независимых причин, включая модификации кишечной микробиоты. Тип питания, влияющий на состав кишечной микробиоты, может играть значительную роль в патогенезе. Предыдущие исследования подтвердили успех применения пробиотических добавок против колик, но в основном это были Lactobacillus spp. были протестированы.Целью этого исследования было оценить эффективность против функциональных желудочно-кишечных расстройств пробиотического состава на основе Bifidobacterium breve , включая в исследование субъектов как на грудном, так и на искусственном вскармливании. Двести шестьдесят восемь новорожденных были включены в исследование в течение 15 дней с момента рождения. Сто пятьдесят пять из них эффективно вошли в исследование и были рандомизированы в группы пробиотиков и плацебо, получавших состав в течение 90 дней. Состав пробиотика состоит из смеси 1: 1 2 штаммов B.breve готовят в виде масляной суспензии и вводят в суточной дозе 5 капель, содержащих 10 8 КОЕ каждого штамма. Абсолютное количественное определение выбранных микробных групп в фекалиях проводили с помощью КПЦР. До и после лечения оценивались антропометрические данные, ежедневные дневниковые минуты плача, количество срыгиваний, рвот и отказов, цвет и консистенция стула. Исследование подтвердило положительную роль грудного молока в влиянии на количество целевых микробных групп, в частности, сообщества бифидобактерий.Не сообщалось о побочных эффектах при введении пробиотиков, что свидетельствует о безопасности продукта в этой схеме. B. breve Количество значительно увеличилось у всех новорожденных, которым вводили вакцину ( p <0,02). Исследование демонстрирует, что трехмесячное лечение штаммами B. breve у здоровых новорожденных, находящихся на грудном вскармливании, помогает предотвратить функциональные желудочно-кишечные расстройства, в частности, снижает на 56% ежедневную частоту рвоты ( p <0,03), уменьшая 46,5% дневной нормы. эвакуация с течением времени ( p <0.03) и улучшение консистенции стула (тип 6 в таблице стула Бристоля вместо типа 5) у доношенных ( p <0,0001). Более того, наблюдалось значительное снижение (8,65 против 7,98 LogCFU / г фекалий, p <0,03) B. fragilis в группе кормления из бутылочки, получавшей пробиотический состав.

Ключевые слова: пробиотик, Bifidobacterium breve , детские колики, функциональные желудочно-кишечные расстройства, грудное вскармливание, кормление из бутылочки, микробиота

Введение

Детские колики - распространенное заболевание в первые 3 месяца детства, которое поражает до 30 лет. % новорожденных и характеризуется приступообразным, чрезмерным, неконтролируемым плачем без идентифицируемых причин (1).Wessel et al. (2) дал первое определение этого расстройства как состояние плача или беспокойства, которое длится более 3 часов в день, более 3 дней в неделю. Для клинических целей консенсусная группа Рима IV (3) недавно пересмотрела диагностические критерии, включая возраст новорожденного (<5 месяцев), придав меньшее значение продолжительности плача, учитывая длительный и неотразимый характер эпизодов плача. как раздражительность, которую не могут предотвратить или устранить лица, осуществляющие уход.Симптомы, такие как покраснение лица, метеоризм, сгибание бедер и метеоризм, начинаются на второй неделе жизни как у детей, находящихся на грудном вскармливании, так и у детей, вскармливаемых смесями, и обычно проходят спонтанно со временем (4).

Младенческие колики представляют собой серьезную проблему для семьи, потому что лица, осуществляющие уход, сталкиваются с трудностями в преодолении этих неконтролируемых кризисов, часто приводящих к стрессу и беспокойству; проспективное европейское многоцентровое исследование, проведенное Vik et al. (5) показали, что детские колики и продолжительный плач связаны с высокими показателями материнской депрессии.Точно так же срыгивание, рвота и запор часто требуют посещения педиатра в течение первых 6 месяцев жизни и часто являются причиной смены кормления и использования медицинских методов лечения (6, 7). Более того, наличие колик на раннем этапе жизни было связано с несколькими последствиями: у детей с коликами в анамнезе выше частота функциональных желудочно-кишечных расстройств в более позднем возрасте (8), а у детей с мигренью чаще возникают младенческие колики. чем у людей без мигрени (7).Таким образом, предусмотрена эффективная профилактическая стратегия против функциональных желудочно-кишечных расстройств.

Несмотря на 40 лет исследований, этиология колических кризов и других функциональных желудочно-кишечных расстройств до конца не выяснена. Было высказано предположение, что ряд поведенческих факторов (психологических и социальных), факторов питания (пищевая гиперчувствительность или аллергия), нарушение моторики кишечника и слабое воспаление кишечника могут способствовать его возникновению (6, 9). Неудивительно, что, будучи типичным заболеванием желудочно-кишечного тракта, дисбаланс в составе микробиоты кишечника играет роль в патогенезе этих состояний.Микробиота кишечника очень тесно связана с хозяином, что способствует нормальной физиологии человека: она может служить барьером для колонизации патогенов, синтезировать витамины и другие полезные соединения и стимулировать иммунную систему (10). Неонатальный период является решающим этапом для колонизации желудочно-кишечного тракта, сбалансированного состава кишечной микробиоты, что положительно влияет на здоровье хозяина (11). Младенцы с коликами имеют меньшее фекально-бактериальное разнообразие и стабильность по сравнению со здоровыми.Они также показывают более высокую распространенность грамотрицательных бактерий, особенно колиформ, и меньшее количество полезных бактерий, таких как лактобациллы и бифидобактерии (12).

Диета играет доминирующую роль в формировании микробиоты кишечника, поэтому тип кормления новорожденных оказывает определенное влияние на оценку микробных групп кишечника. Заметные различия показали Lee et al. (13): Актинобактерии были преобладающим филумом у новорожденных, находящихся на грудном вскармливании, за ними следовали Firmicutes и Proteobacteria; Напротив, у младенцев, вскармливаемых смесью, пропорции Actinobacteria и Firmicutes были одинаковыми, за ними следовали Proteobacteria.Кроме того, микробиота кишечника детей, находящихся на искусственном вскармливании, содержит значительное количество родов Escherichia, Veillonella, Enterococcus и Enterobacter , тогда как содержание Lactobacillus было низким. В той же работе сообщается, что основным родом младенцев, вскармливаемых грудью и искусственными смесями, является Bifidobacterium , но эта пропорция значительно выше у младенцев, вскармливаемых грудью. Исследование Mazzola et al. (14) также показали снижение содержания Bifidobacterium spp.у детей, находящихся на смешанном вскармливании (вскармливаемых не менее 50% молочной смеси), по сравнению с грудным вскармливанием. Напротив, дифференциальная представленность рода Bifidobacterium не была обнаружена у младенцев, находящихся на грудном вскармливании, по сравнению с детьми, вскармливаемыми смесью, хотя различия в микробиоте кишечника наблюдались в двух группах (15). Более того, эти исследования выявили более низкое бактериальное богатство и разнообразие на грудном вскармливании, вероятно, из-за наличия уникальных олигосахаридов в грудном молоке, которые служат селективными метаболическими субстратами для ограниченного числа кишечных микробов (16).

Тип питания, влияющий на состав кишечной микробиоты, может играть значительную роль в патогенезе детских колик, хотя после первого года жизни эти различия теряются (17). Недавнее исследование, сфокусированное на младенцах, вскармливаемых смесями и не страдающих коликами, проведенное с использованием FISH в качестве метода подсчета бактерий, выявило более низкую концентрацию общих бактерий и более высокое содержание энтеробактерий у детей, вскармливаемых смесями (18).

Несколько исследований поддерживают использование пробиотиков в качестве терапевтических или профилактических средств против различных заболеваний, в частности кишечных расстройств, а также патологий человека, которые явно не связаны с микробным составом кишечника, таких как аллергии и аутоиммунные заболевания (19, 20).Лечение пробиотиками, благотворное влияние которых на нарушения микробиоты кишечника и на здоровье человека хорошо известно, может иметь защитный эффект от желудочно-кишечных расстройств, включая колики, и уменьшать связанные с ними симптомы, что приводит к правильной микробной колонизации в раннем младенчестве, когда микробиота все еще находится в стадии адаптации.

Многие исследования были сосредоточены на введении Lactobacillus reuteri DSM 17938 в качестве пробиотика для профилактики или уменьшения симптомов функциональных желудочно-кишечных расстройств, включая колики, срыгивание, рвоту и запор, с успешными результатами (6, 21, 22).В частности, Savino et al. (23) показали меньшее количество анаэробных грамотрицательных бактерий, энтеробактерий и энтерококков у новорожденных с коликами, которые получали L. reuteri , по сравнению с детьми, не получавшими лечения. Однако другие виды Lactobacillus , такие как L. delbrueckii subsp. delbruekii DSM 20074 и L. plantarum MB 456 продемонстрировали ингибирующую активность в отношении газообразующих колиформных бактерий и могут быть использованы при лечении детских колик (24).Иными словами, применение бифидобактерий для лечения этих кишечных расстройств остается малоизученным, хотя их роль в здоровой микробиоте кишечника новорожденных была продемонстрирована в обзоре Di Gioia et al. (25). Предыдущее исследование in vitro описало способность некоторых штаммов, принадлежащих к роду Bifidobacterium , включая штаммы Bifidobacterium breve , ингибировать in vitro рост патогенов, типичных для желудочно-кишечного тракта младенцев, включая колиформ, выделенных из новорожденных с коликозной болезнью. 26).Другие исследования продемонстрировали эффективность штамма B. breve для лечения различных детских заболеваний: Li et al. (27) показали полезность в содействии колонизации B. breve и формированию нормальной кишечной биоты у младенцев с низкой массой тела при рождении, Wada et al. (28) описали положительные эффекты этого вида у детей с ослабленным иммунитетом при химиотерапии. Более того, недавние исследования доказали эффективность B. breve для снижения риска некротического энтероколита у недоношенных детей (29, 30).Кроме того, два штамма B. breve, , B632 и BR03 были исследованы на предмет их способности колонизировать кишечник человека, стимулировать иммунный ответ, конкурировать с патогенами, а также были продемонстрированы их оценки безопасности (26, 31, 32). Недавнее исследование также показало способность этих штаммов B. breve , используемых в качестве пробиотиков для детей с глютеновой болезнью, действовать в качестве «пускового» элемента для увеличения других полезных бактериальных родов или типов, таких как Firmicutes (33).

Целью данного исследования было описать эффективность пробиотической композиции на основе B. breve , вводимой новорожденным как на грудном вскармливании, так и на искусственном вскармливании, в: 1) изменении количества целевых групп фекальных микробов; 2) профилактика колик и функциональных желудочно-кишечных расстройств в когорте здоровых новорожденных.

Материалы и методы

Дизайн исследования и сбор образцов

Это было двойное слепое рандомизированное плацебо-контролируемое клиническое испытание ({"type": "клиническое испытание", "attrs": {"text": " NCT03219931 "," term_id ":" NCT03219931 "}} NCT03219931) одобрено этическим комитетом больницы Маджоре делла Карита (CE 63/13).Новорожденные были зачислены в отделение педиатрии факультета медицинских наук Восточного университета Пьемонта им. Авогадро »в период с ноября 2013 г. по сентябрь 2016 г. Новорожденных набирали при рождении и регистрировали в течение 15 дней с момента рождения во время первого посещения (T0). Информированное согласие было получено родителями при зачислении в соответствии с критериями местного этического комитета и критериями Хельсинки. Пациентов попросили выполнить второй визит (Т1) через 90 дней лечения. Число новорожденных, оцененных на соответствие критериям [268], рандомизированных [155] и отнесенных к группе плацебо или пробиотиков, показано на рисунке.Их набирали, если они были здоровы в течение 15 дней после рождения и родились адекватно гестационному возрасту. Критерии исключения: 1) новорожденные-близнецы; 2) лечение любым лекарственным препаратом в рамках набора; 3) лечение пробиотиками; 4) курящие матери; 5) семейный анамнез врожденных заболеваний; 6) длительная желтуха в анамнезе. Матери не рекомендовали никаких особых диетических ограничений во время кормления грудью, за исключением других продуктов, содержащих пробиотики. Пациенты были рандомизированы с использованием компьютерной последовательности распределения в группы плацебо или пробиотиков (1: 1).Персонал исследования и родители были замаскированы для распределения группы исследования. Первоначальная идея исследования заключалась в том, чтобы набрать равное количество новорожденных, находящихся на грудном вскармливании и на искусственном вскармливании, но, учитывая трудности с набором новорожденных, находящихся на искусственном вскармливании, мы решили продолжить с другим количеством новорожденных, принадлежащих к этим двум группы (рисунок).

Группа пробиотиков получала коммерческий пробиотический состав Bifibaby® (Probiotical S.p.A., Новара, Италия), содержащий B. breve в течение 90 дней (T1), а группа плацебо получала состав плацебо на тот же период.Состав пробиотика представлял собой смесь 1: 1 из 2 штаммов, B. breve BR03 (DSM 16604) и B. breve B632 (DSM 24706), приготовленных в масляной суспензии, вводимой в суточной дозе 5 капель, содержащих 10 . 8 КОЕ каждого штамма. Плацебо готовили с теми же эксципиентами без пробиотических штаммов с использованием идентичной формы упаковки.

Клинический мониторинг

Данные о родах были собраны во время первого посещения. Антропометрические данные (вес, рост, окружность головы) и информация о типе кормления собирались как при первом (T0), так и во втором посещении (T1).

Родителей попросили записывать в ежедневный дневник минуты безутешного плача в соответствии с утвержденной анкетой (41). Они также регистрировали ежедневное количество срыгиваний, рвот и опорожнений, а также цвет и консистенцию стула. Бристольская шкала формы стула для детей была передана родителям (42). Колики диагностировали согласно группе консенсуса Рима IV (3).

Родителей также попросили сообщать о любых побочных эффектах (в частности, запорах, рвоте, аллергических реакциях, заболеваниях), лечении, количестве и типах инфекций или боли в животе, имевших место в течение испытательного периода.Соблюдение режима лечения контролировалось телефонными звонками раз в две недели, подсчетом пустых флаконов и ежедневной проверкой молочных заводов.

Сбор образцов кала

Образцы фекалий новорожденных собирали дважды: при зачислении (T0) и в конце вмешательства с пробиотиком / плацебо (T1). Таким образом, проанализированы группы: пробиотик T0, плацебо T0, пробиотик T1, плацебо T1. Образцы фекалий замораживали сразу после сбора при -80 ° C в пронумерованных пластиковых контейнерах с завинчивающейся крышкой, пока они не были обработаны для выделения ДНК.Исследователи, выполняющие экстракцию ДНК и молекулярные анализы (кПЦР), не знали о групповой принадлежности пациентов (группа пробиотиков или плацебо).

Экстракция ДНК из образцов фекалий

ДНК была извлечена из 200 мг фекалий (сохраненных при -80 ° C после сбора) с использованием набора QIAamp DNA Stool Mini (Qiagen, West Sussex, UK) с небольшой модификацией стандартного протокола : дополнительная инкубация при 95 ° C в течение 10 мин образца стула с буфером для лизиса была добавлена ​​для усиления разрыва бактериальных клеток (43).Экстрагированную ДНК хранили при -80 ° C. Чистоту ДНК определяли путем измерения отношения оптической плотности при 260 и 280 нм (Infinite®200 PRO NanoQuant, Tecan, Mannedorf, Швейцария), а концентрацию оценивали с помощью флуорометра Qubit® 3.0 (Invitrogen, Life Technologies, CA, США). ).

Абсолютная количественная оценка выбранных микробных групп с помощью количественной ПЦР (qPCR)

Количественная оценка выбранных микробных групп или видов, обычно отслеживаемых в исследованиях, относящихся к младенцам (38, 43), т.е.е., Bidobacterium spp., Lactobacillus spp., Группа Bacteroides fragilis (включающая наиболее распространенные виды у человека B. fragilis, B. distasonis, B. ovatus, B. thetaiotaomicron, B. vulgatus ) , B. breve, Clostridium difficile, Escherichia coli и общее количество энтеробактерий выполняли с помощью ПЦР в реальном времени на ДНК, выделенной из образцов стула. Анализы проводили с 20 мкл смеси для ПЦР-амплификации, содержащей 10 мкл Fast SYBR® Green Master Mix (Applied Biosystems, Foster city, CA, USA) с оптимизированными концентрациями праймеров (Таблицы), молекулярной степени чистоты H 2 O и 2 мкл ДНК, полученной из проб фекалий в концентрации 2.5 нг / мкл. B. breve анализ выполняли с использованием анализа TaqMan, содержащего 12,5 мкл мастер-микса Universal TaqMan (Applied Biosystems, Foster city, CA, USA), 300 нМ каждого праймера и 100 нМ зонда, меченного 5'-репортерным красителем 6- карбоксифлуоресцеин и 3'-гаситель NFQ-MGB (Applied Biosystems, Nieuwerkerk a / d IJssel, Нидерланды). Число циклов ПЦР составляло 40.

Таблица 1

Последовательности праймеров и условия кПЦР, использованные в различных анализах.

difficile

Микроорганизм-мишень Праймер Последовательность (5'-3 ') Длина ампликона (п.о.) col13 col13 1

Eco-F GTTAATACCTTTGCTCATTGA 340 (34)
Eco-R ACCAGGGTATCTAATCCTGTT Cdiff-F TTGAGCGATTTACTTCGGTAAAGA 114 (35)
Cdiff-R TGTACTG16CTCAC329 903 903 ATTACTG163CTCACCTTTG 903 Bif-F TCGCGTCYGGTGTGAAAG 243 (36)
Bif-R CCACATCCAGCRTCCAC Лак-F GCAGCAGTAGGGAATCTTCCA 349 (37)
Лак-R GCATTYCACCGCTACACATG
Bacteroides ломкая группа Bfra-F CGGAGGATCCGAGCGTTA 92 (38)
Bfra-R CCGCAAACTTTCACAACTGACTTA
B.BREVE F _IS GTGGTGGCTTGAGAACTGGAT А.Г. 118 (39)
R_IS CAAAACGATCGAAACAAACACTAAA
P_IS TGATTCCTCGTTCTTGCTGT
Энтеробактерии Ent-F ATGGCTGTCGTCAGCTCGT 385 (40)
Ent-R CCTACTTCTTTTGCAACCCACTC CCTACTTCTTTTGCAACCCACTC Протоколы

9028 45 Лактобациллы виды .
Целевые бактерии Начальная денатурация Денатурация Отжиг Н.циклы

9029 9029 nM
E. coli
Eco-F / Eco-R 95 ° C - 20 с 95 ° C - 3 с 60 ° C - 30 с 40 400 400
С.difficile
Cdiff-F / Cdiff-R 95 ° C - 20 с 95 ° C - 3 с 60 ° C - 30 с 40 250 250
Бифидобактерии виды .
BifTOT-F / BifTOT-R 95 ° C - 20 с 95 ° C - 3 с 60 ° C - 35 с 40 200 300
Lac-F / Lac-R 95 ° C - 20 с 95 ° C - 3 с 63,5 ° C - 30 с 40 200 200

Концентрации праймеров были оптимизированы с помощью матриц оптимизации праймеров в 48-луночном планшете и оценки наилучшего отношения Ct / ΔRn. Различные праймеры также были проверены на их специфичность с использованием программы поиска сходства нуклеотидов-нуклеотидов в базе данных BLAST (44). Кроме того, для оценки специфичности амплификации анализ кривой плавления продукта проводили после последнего цикла каждой амплификации.Затем данные, полученные в результате амплификации, были преобразованы для получения количества бактериальных клеток (Log КОЕ / г фекалий) в соответствии с количеством копий рРНК, доступным в базе данных количества копий рРНК (45). Стандартные кривые были построены с использованием продуктов ПЦР 16S рРНК типовых штаммов каждого микроорганизма-мишени; использовались стандартные микроорганизмы: B. breve ReO2, Lactobacillus plantarum ATCC 14917, B. fragilis DSM 2151, B. breve B632 DSM 20213, Clostridium sporogenes ATCC 319, coli ATCC 8739. Продукты ПЦР очищали с помощью коммерческой системы очистки ДНК (набор NucleoSpin® Extract II, MACHEREY-NAGEL GmbH & Co. KG, Германия) и концентрацию измеряли спектрофотометрически при 260 нм. Были выполнены серийные разведения, и для калибровки использовали 10 2 , 10 3 , 10 4 , 10 5 , 10 6 , 10 7 копий гена на реакцию. Реакции с образцами проводили трижды, с отрицательным контролем для каждой реакции.

Статистический анализ

Данные выражены как среднее ± стандартное отклонение. Перекошенные переменные были преобразованы в журнал. Ежедневные данные были разделены на 9 категорий, представляющих среднее значение за 10 последовательных дней (от 0 до 90 дней).

Согласно первичному результату, выборка из 58 человек в группе была оценена как достаточная, чтобы продемонстрировать разницу между плацебо и пробиотиками в 0,70 Log КОЕ / г бифидобактерий со стандартным отклонением 1,6, степенью 90% и уровень значимости 95% и процент выбывания 20% согласно опубликованным данным, уже имеющимся во время разработки протокола (32).Согласно вторичному результату выборка из 55 человек в группе была оценена достаточной для снижения на 30% доли желудочно-кишечных расстройств (колики, срыгивание, рвота, запор) с предполагаемой распространенностью 40%, согласно данным литературы (1, 6).

Данные подсчета микробов были подвергнуты тесту Шапиро и тесту Бартлетта для проверки нормального распределения данных и однородности дисперсий. Базовые характеристики сравнивались с точным критерием Фишера для категориальных переменных и двухвыборочным тестом t или тестом Велча t , когда это необходимо для непрерывных переменных.Двухфакторный повторный анализ ANOVA был выполнен для оценки временного эффекта, лечебного эффекта и эффектов взаимодействия (модель 1) на зависимые переменные (минуты плача, характеристики стула, эпизоды рвоты и срыгивания, количество микробов). Использовалась сумма квадратов III типа. Впоследствии были введены следующие ковариаты: пол, тип родов (вагинальные, кесарево, оперативные), антибиотикопрофилактика во время родов (IAP), гестационный возраст, вес новорожденного (модель 2). Модель 3 также включала тип кормления в течение 90 дней (грудное вскармливание, искусственное вскармливание, смешанное вскармливание).Кроме того, в модели 2 и 3 вес, длина и окружность головы также были скорректированы с учетом соответствующей переменной при рождении. Все статистические анализы были выполнены с использованием статистического программного обеспечения R и SPSS для Windows версии 17.0 (SPSS Inc., Чикаго, Иллинойс, США).

Результаты

Исходные характеристики включенных новорожденных

При рождении 268 новорожденных были оценены на соответствие критериям, и их родители приняли участие в исследовании. Сто десять не вошли в исследование, потому что не явились на прием (46), отказались от исследования в тот же день (47) или были исключены из-за лечения антибиотиками после рождения (5).158 субъектов были случайным образом распределены в группу плацебо или пробиотиков. Три из них были потеряны при последующем наблюдении и были исключены (рисунок). Из 155 новорожденных, включенных в протокол, 130 находились на грудном вскармливании (59 плацебо, 71 пробиотик) и 25 находились на искусственном вскармливании (14 плацебо, 11 пробиотиков). Восемьдесят один мужчина и 74 женщины. Кроме того, 139 новорожденных родились вагинально, 10 - кесаревым и 6 - оперативным путем. Все матери были здоровы, не страдали хроническими заболеваниями. Пятнадцать матерей получили ИАП.Во время исследования у трех матерей был эпизод гриппа (2 субъекта в группе кормления грудью и 1 субъект в группе кормления смесью). Ни одна мать не получала лечение антибиотиками во время кормления грудью.

В таблице представлены клинические данные и микробиологические показатели кала на исходном уровне в двух группах распределения (новорожденные, получавшие плацебо и пробиотики). Только Lactobacillus spp. количество было выше в группе плацебо, чем в группе пробиотиков на исходном уровне.

Таблица 3

Ауксологические характеристики всей когорты на исходном уровне (T0) в соответствии с обработкой распределения.

± 901 1,2 (окружность головы ) см)
Плацебо Пробиотик
Пол (М / Ж) 34/39 47/35 903 недель 39,3 ± 1,0
Масса новорожденного (г) 3307,9 ± 397,5 3298,5 ± 362,7
Длина (см) 50,1 ± 2,0 9 Окружность головы 34.2 ± 1,4 33,9 ± 1,1
Рождение (V / C / O) 63/7/3 76/3/3
Дни жизни 10,6 ± 1,9 10,4 ± 2,4
Кормление грудью / из бутылочки 59/14 71/11
Ежедневный плач (мин) 25,5 ± 28,8 28,8 ± 37,7
Частота стула 3,8 ± 16 1,8 4,1 ± 1,9
Эпизоды срыгивания 1.7 ± 1,8 1,6 ± 1,4
Эпизоды рвоты 0,1 ± 0,2 0,2 ± 0,4

Поскольку хорошо известно, что кормление влияет на микробный состав кишечника, а также на клинические проявления у новорожденных, мы исследовали, отличались ли младенцы на грудном и искусственном вскармливании в начале исследования. В дополнительной таблице 1 представлены клинические данные и микробиологические показатели кала на исходном уровне в двух группах (новорожденные на грудном и искусственном вскармливании).Время плача ( p <0,05) и частота стула были выше ( p <0,04), а эпизоды срыгивания были менее частыми ( p <0,05) у младенцев, находящихся на грудном вскармливании. Общее количество энтеробактерий ( p <0,004), E. coli ( p <0,03) и B. fragilis в группе ( p <0,01) было ниже у новорожденных, находящихся на грудном вскармливании, чем у новорожденных, находящихся на искусственном вскармливании. с поправкой на искажающие факторы (пол, гестационный возраст, вес новорожденного, тип родов, ВБД и дни жизни на дату поступления).

Микробиологические результаты во всей когорте после введения пробиотика и плацебо

В таблице показано среднее общее количество микробов, полученное в двух группах образцов: пробиотика и плацебо. Этот анализ показал значительное увеличение количества B. breve на на через 3 месяца. Остальные микробные группы не показали значительной разницы.

Таблица 4

Среднее количество (Log КОЕ / г фекалий) различных микробных групп, проанализированных в образцах стула всей когорты.

90 ± 1,5 ± 1,36
Target Пробиотик T0 Пробиотик T1 Плацебо T0 Плацебо T1
7,00 ± 1,41 7,51 ± 0,88 6,88 ± 1,14 7,29 ± 1,06
B. breve 4,45 ± 1,85 6,40 ± 1,31 162 * 5,33 ± 1,5
Энтеробактерии 6,54 ± 1,23 6,38 ± 1,14 6,02 ± 1,4 6,5 ± 1,02
E. coli 6,72 6,35 ± 2,07 7,42 ± 1,24
Lactobacillus spp. 6,56 ± 1,28 5,60 ± 1,23 6,22 ± 1,06 5,28 ± 1,48
B.fragilis группа 7,44 ± 2,14 7,62 ± 1,97 6,79 ± 2,19 7,23 ± 2,00
C. difficile 2,66 ± 1,48 2,82 ± 1,5 ± 1,58

После этой первой оценки и с учетом различных размеров образцов новорожденных, находящихся на грудном и искусственном вскармливании, а также различий в исходном количестве микробов в этих двух группах, был проведен анализ, разделяющий новорожденных на грудном вскармливании и новорожденных, вскармливаемых из бутылочки. .

Оценка данных лечения пробиотиками новорожденных на грудном вскармливании

На исходном уровне в группе плацебо была меньшая частота стула ( p <0,03) и меньшее количество энтеробактерий, чем в группе пробиотиков ( p <0,01), также с поправкой на искажающие факторы (пол, гестационный возраст, вес новорожденного, тип родов и дни жизни на дату поступления). Предельные средние значения частоты стула и количества энтеробактерий: 3,2 ± 0,4 против 4,3 ± 0,3 ( p <0.01) и 5,86 ± 0,36 против 6,01 ± 0,38 Log КОЕ / г ( p <0,03) соответственно.

Комплаентность к лечению высокая. Все родители ответили на телефонные звонки. 98,7% из них правильно вернули пустые флаконы. О нежелательных явлениях не сообщалось. Трое младенцев (1 в группе плацебо и 2 в группе пробиотика) получали симетикон в течение нескольких дней (<30 дней) из-за срыгивания.

Через 90 дней 100 (43 в группе плацебо, 57 в группе пробиотиков) из 130 новорожденных все еще находились на грудном вскармливании.Из оставшихся 30 младенцев 7 находились на искусственном вскармливании (5 в плацебо, 2 в пробиотике), а остальные 23 находились на смешанном вскармливании (11 в плацебо, 12 в пробиотике).

Клинические данные

Учитывая клинические данные, количество минут плача ( p <0,005) уменьшалось с течением времени без эффекта лечения также в скорректированных моделях.

Число эвакуаций уменьшалось с течением времени ( p <0,0001) с эффектом лечения у тех, кто родился после 40 недель гестационного возраста ( p <0.03). Консистенция стула была больше 5-го типа по Бристольской диаграмме стула ( p <0,03) с течением времени. Дети, рожденные после 40 недель гестационного возраста, чаще имели тип 6 по Бристольской таблице стула у детей, получавших пробиотики ( p <0,0001).

Количество эпизодов срыгивания постоянно уменьшалось с течением времени ( p <0,01) в группе пробиотиков в зависимости от группы плацебо в зависимости от типа кормления ( p <0,03, рисунок).

Количество ежедневных срыгиваний.Группа пробиотиков (сплошная линия) и группа плацебо (пунктирная линия). Новорожденные на грудном вскармливании (A) ; Новорожденные на искусственном вскармливании (B) ; Новорожденные на смешанном вскармливании (С) . Данные выражены как предельное среднее значение ± стандартная ошибка среднего. Данные значимы во взаимодействии ( p <0,04; модель 3). Остатки неоднородны по группам.

Эпизоды рвоты значительно уменьшились со временем в группе пробиотиков, но не в группе плацебо ( p <0,03). Более того, в течение 90 дней частота колик у младенцев была аналогичной в группе плацебо (4 пациента, 6.8%) и пробиотической группе (6 субъектов, 8,5%).

Интересно, что были изменены и ауксологические переменные. Младенцы, получавшие пробиотики, имели меньшую прибавку в весе во время исследования у тех, кто родился с кесаревым сечением ( p <0,03; рисунок), и у тех, кто все еще находился на грудном вскармливании или перешел на искусственное вскармливание во время исследования ( p <0,005) . Разнообразно, младенцы, получавшие пробиотики, имели большее увеличение окружности головы у детей, находящихся на искусственном вскармливании или при смешанном вскармливании ( p <0.01).

Изменение веса за 90 дней. Группа пробиотиков (серая полоса) и группа плацебо (черная полоса). Новорожденные, рожденные естественным путем (A) ; Новорожденные, рожденные путем кесарева сечения (B) ; Новорожденные в результате оперативных родов (С) . Данные выражены как предельное среднее значение ± стандартная ошибка среднего. Данные значимы во взаимодействии ( p <0,03; модель 2). T0: исходный. T1: после 90 дней приема плацебо / пробиотика.

В таблице описаны предельные средние модели 1. В дополнительной таблице 2 описаны также скорректированные модели.

Таблица 5

Клинические и антропометрические вариации в группе грудного вскармливания, полученные с помощью многофакторного анализа повторных измерений.

903,9
Target Пробиотик T0 Пробиотик T1 Плацебо T0 Плацебо T1

1 903 903 903 903 903 903 903 ± 2,9
32,1 ± 5,6 20.5 ± 3,7
Частота стула 4,3 ± 0,2 2,1 ± 0,1 3,9 ± 0,2 2,0 ± 0,1
Цвет стула 6,0 ± 0,1 5,7 ± 0,1 6,0 6,0 ± 0,1
Консистенция стула 5,8 ± 0,1 5,7 ± 0,1 6,0 ± 0,1 5,6 ± 0,1
Регургитация 2,0 ± 0,2 1,6 ± 0,28 ± 0,2 2,0 ± 0,3
Рвота 0,25 ± 0,05 0,11 ± 0,06 * 0,10 ± 0,05 0,20 ± 0,07
3465,6 ± 57,4 3321,5 ± 48,0 3452,2 ± 62,9
Длина (см) 50,1 ± 0,2 51,5 ± 0,2 50,2 ± 0,2 51,5 ± 0,2
33.9 ± 0,1 34,9 ± 0,1 34,3 ± 0,1 35,0 ± 0,1
Микробные данные

Общие энтеробактерии ( p <0,005), Bifidobacterium spp. ( p <0,001) и E. coli ( p <0,001) изменились со временем, но значимость была потеряна при корректировке на искажающие факторы. C. difficile не изменился.

У тех, кто лечился пробиотиками, B. fragilis членов группы уменьшилось с течением времени у рожденных естественным путем, тогда как у других младенцев увеличилось ( p <0.04). Более того, B. breve увеличивалось со временем у тех, кто лечился пробиотиками ( p <0,04). Микробиологические данные представлены в таблице.

Таблица 6

Среднее количество (Log КОЕ / г фекалий) различных микробных групп, проанализированных в образцах стула новорожденных, вскармливаемых грудью.

90
Target Пробиотик T0 Пробиотик T1 Плацебо T0 Плацебо T1
7,11 ± 0,38 7,91 ± 0,27 6,59 ± 0,34 7,78 ± 0,24
B. breve 4,64 ± 0,50 6,10 ± 0,47
62 * 5,8 ± 0,46
Энтеробактерии 6,01 ± 0,38 6,55 ± 0,35 5,86 ± 0,36 6,46 ± 0,34
E. coli 6,70 ± 0,57 6,70 ± 0,5751 6,40 ± 0,54 7,06 ± 0,48
Lactobacillus spp. 6,22 ± 0,33 5,55 ± 0,33 6,28 ± 0,29 6,27 ± 0,35
Группа B. fragilis 6,34 ± 0,64 7,33 ± 0,61 6,4
C. difficile 2,70 ± 0,42 2,89 ± 0,48 2,82 ± 0,37 3.01 ± 0,42

Оценка данных лечения пробиотиками новорожденных на искусственном вскармливании

Исходно в группе плацебо было меньше Lactobacillus spp. больше, чем пробиотический ( p <0,008). При корректировке на факторы, влияющие на факторы (пол, гестационный возраст, вес новорожденного и количество дней жизни на дату поступления), статистическая значимость была потеряна, тогда как количество групп B. fragilis было выше в группе пробиотиков (предельное среднее значение 6,62 ± 0). .53 против 8,62 ± 0,67 Log КОЕ / г, p <0,02).

Клинические данные

Принимая во внимание клинические данные как грубого, так и скорректированного анализа, не было обнаружено никаких изменений в минутах плача, частоте и плотности стула, эпизодах рвоты или срыгивания. Ни у одного ребенка в обеих группах не было коликов. Вес ( p <0,0006), длина ( p <0,01) и окружность головы ( p <0,005) увеличивались со временем без эффекта лечения.

Микробные данные

Всего энтеробактерий и E.coli не менялась со временем. Bifidobacterium spp. ( p <0,02) и C. difficile увеличивались ( p <0,04) со временем без эффекта лечения. В группе, получавшей пробиотики, B. fragilis ( p <0,03) снизились, а B. breve увеличились ( p <0,03) со временем соответственно. Микробиологические данные представлены в таблице.

Таблица 7

Среднее количество (Log КОЕ / г лиц) различных микробных групп, проанализированных в образцах стула новорожденных, вскармливаемых из бутылочки.

90
Target Пробиотик T0 Пробиотик T1 Плацебо T0 Плацебо T1
6,80 ± 0,36 7,56 ± 0,36 6,79 ± 0,30 7,35 ± 0,30
B. breve 4,20 ± 0,35 6,42 ± 0,37 162 * 90.11 ± 0,31 5,09 ± 0,33
Энтеробактерии 7,30 ± 0,41 6,97 ± 0,34 6,75 ± 0,36 7,14 ± 0,30
E. coli ± 0,62 6,67 ± 0,66 7,51 ± 0,54
Lactobacillus spp. 6,81 ± 0,29 6,00 ± 0,35 6,05 ± 0,26 6,39 ± 0,31
B.fragilis группа 8,65 ± 0,61 7,98 ± 1,84 * 7,56 ± 0,56 8,33 ± 0,51
C. difficile 2,54 ± 0,43 903,16 3,35 ± 0,46

Обсуждение

Использование бифидобактерий в качестве пробиотиков у младенцев установлено при некоторых кишечных заболеваниях, наиболее частым из которых является диарея (25). Однако, хотя исследований in vitro и подтверждают использование бифидобактерий против газообразующих колиформ (26), до сих пор не проводилось клинических испытаний их использования против детских колик.Эта работа была сосредоточена на оценке влияния на функциональные желудочно-кишечные симптомы, включая колики, интеграции детского питания с пробиотическим составом на основе B. breve .

Исследование ясно показало способность введенных штаммов B. breve выживать после желудочного транзита и достигать кишечника новорожденного. Фактически, хотя B. breve был обнаружен во всех образцах фекалий, при введении штамма было показано значительное увеличение.В согласии с Lee et al. (13), снижение количества Lactobacillus на , с течением времени наблюдалось во всех группах новорожденных, и это особенно очевидно в группе, получавшей пробиотики. Это может быть связано с высокой способностью Bifidobacterium spp. влиять на состав микробиоты кишечника, усиливая цветение одних видов и уменьшая количество других, как это наблюдалось в других исследованиях, касающихся введения Bifidobacterium (25).

Известно, что тип кормления играет решающую роль в формировании микробиоты кишечника младенца (25, 48).Наше исследование показывает, что при зачислении, когда уже проводилось 7–15 дней кормления грудью или из бутылочки, некоторые различия присутствовали в группах с разным типом кормления: общее количество энтеробактерий и E. coli было выше в группах. на искусственном вскармливании, чем у новорожденных, находящихся на грудном вскармливании, также с поправкой на мешающие факторы. Кроме того, на исходном уровне у младенцев, находящихся на искусственном вскармливании, было обнаружено более высокое количество B. fragilis , что согласуется с более высоким риском инфекции, обычно наблюдаемым у младенцев, не находящихся на грудном вскармливании (49).Это более высокое количество также было очевидным после лечения, как в группе пробиотиков, так и в группе плацебо, подтверждая абсолютную важность начального типа кормления для формирования микробиоты кишечника и, в частности, для уменьшения количества грамотрицательных бактерий. Однако у младенцев, находящихся на искусственном вскармливании, среднее количество B. fragilis было выше в конце лечения в группе плацебо по сравнению с пробиотической, что указывает на возможный положительный эффект от введения B. breve . по крайней мере, до отлучения от груди.Увеличение B. breve также наблюдается у новорожденных на грудном вскармливании, не получавших пробиотики, и это, как уже упоминалось ранее, еще раз подчеркивает положительную роль грудного молока в формировании сообщества бифидобактерий, также учитывая, что B. breve - один из самых распространенных видов в кишечнике новорожденных (50). Это увеличение также подтверждается присутствием в грудном молоке пептидов и олигосахаридов, которые стимулируют рост бифидобактерий (47).

В дополнение к данным о микробах, это исследование направлено на мониторинг типичных желудочно-кишечных симптомов колик, то есть срыгивания, рвоты и запора, с которыми трудно справиться для лиц, осуществляющих уход. Результаты, полученные на применяемых моделях, показали уменьшение количества эвакуаций и улучшение консистенции стула у новорожденных, находящихся на грудном вскармливании, после 90 дней приема пробиотиков. Кроме того, у новорожденных, находящихся на искусственном вскармливании, отмечалось улучшение цвета стула. Эти данные свидетельствуют об улучшении желудочно-кишечного транзита, что может быть связано с приемом пробиотиков.Более того, количество срыгиваний и эпизодов рвоты уменьшилось после лечения пробиотиками. Подобные результаты уже были продемонстрированы с добавлением L. reuteri (6). Уменьшение этих симптомов особенно важно, поскольку они также уменьшают беспокойство родителей и связанные с этим последствия.

Уменьшение срыгивания и рвоты не было показано в группе новорожденных, находящихся на искусственном вскармливании. На этот результат может повлиять небольшой размер группы новорожденных, находящихся на искусственном вскармливании.Исследование не было разработано для оценки различий между двумя режимами кормления, и авторы осведомлены о том, что группа, получавшая искусственное вскармливание, была недостаточна для достижения клинических результатов. Однако данные, относящиеся к разному кормлению, следует анализировать отдельно из-за неожиданных существенных различий в микробном составе на исходном уровне. С другой стороны, у тех, кто находился на грудном вскармливании при наборе, которые перешли на искусственное или смешанное вскармливание, наблюдалось улучшение с уменьшением эпизодов срыгивания. Это важное достижение также с учетом того, что количество новорожденных, находящихся на искусственном вскармливании с самого начала жизни, как правило, невелико, поскольку обычно применяется начало кормления грудным молоком (51).

В этом исследовании продолжительность ежедневного плача младенцев не показала каких-либо различий между группами пробиотиков и плацебо, несмотря на улучшение желудочного транзита из-за введения пробиотиков. Этот результат контрастирует с другими сообщениями в литературе. Можно рассмотреть несколько причин, в первую очередь неточность подсчета минут плача в дневниках самоотчета, хотя и подтвержденных, особенно для такого длительного времени. Было продемонстрировано, что анализ любого существующего инструмента для наблюдения за ежедневным плачем неточен, труден или не подтвержден в течение длительного периода наблюдения (52).Более того, мы оценивали эффекты в течение 3 месяцев, тогда как большинство исследований относились к лечению пробиотиками не дольше 4 недель (1, 53). Более того, после вторых месяцев жизни могут играть роль другие мешающие факторы, в частности, если мы рассматриваем их эффективность в отношении других параметров желудочно-кишечного тракта. Кроме того, частота колик у младенцев была одинаковой, но очень низкой как в группах плацебо, так и в группах пробиотиков. Это следствие рассмотрения в исследовании здоровых новорожденных. В будущем необходимы исследования, включающие только младенцев с коликами.

Главный неожиданный и интересный результат исследования был связан с ауксологическими параметрами. Клинические испытания влияния пробиотиков на параметры роста новорожденных немногочисленны. В нашей популяции младенцы, рожденные с помощью кесарева сечения, имели более низкий догоняющий прирост веса, если их лечили пробиотиком. Этот результат имеет решающее значение для планирования дальнейших интервенционных исследований. Колонизация кишечника микроорганизмами окружающей среды происходит во время или сразу после рождения, тогда как у младенцев, рожденных с помощью кесарева сечения, колонизация кишечника задерживается и часто изменяется, в частности, с изменением количества Bifidobacterium и Lactobacillus (25).Растущие эпидемиологические данные свидетельствуют о том, что дети, рожденные путем кесарева сечения, имеют повышенный риск развития ожирения в более позднем возрасте (54, 55). Как генетический фон и окружающая среда влияют на механизмы, контролирующие аппетит, регуляцию веса и метаболические нарушения, связанные с избыточным весом, а также на иммунное образование, изучены недостаточно. Беременность, роды, послеродовое питание (лактация и отлучение от груди) были определены как критические периоды для программирования питания и гормонального контроля потомства.Некоторые авторы предполагают, что внезапное изменение начальных условий может нарушить физиологический процесс, предрасполагающий к определенным заболеваниям (46, 56, 57), и изменения в преждевременной колонизации играют определенную роль (54, 55). Наши данные предполагают, что лечение штаммами B. breve в первые 3 месяца жизни может влиять на состав микробиоты, и это связано с сопутствующим меньшим набором веса у населения с более высоким риском метаболических нарушений в более позднем возрасте.Другим авторам не удалось показать изменения веса новорожденных, получавших другие пробиотики (53, 58). Различия должны быть вторичными по отношению к штаммам или, что более вероятно, к срокам лечения, согласно нашему протоколу, рассчитанному на 3 месяца, в отличие от большинства исследований, в которых наблюдали младенцев в течение 1 месяца. В нашем исследовании влияние на вес было связано с увеличением окружности головы. Эти данные предполагают, что лечение пробиотиками защищает от нарушения роста, как недавно было продемонстрировано для мультиштаммового пробиотика, содержащего бифидобактерии, у детей с очень низкой массой тела при рождении, подвергшихся воздействию антибиотиков (59).

Основное ограничение этого исследования связано с небольшим размером выборки населения, находящегося на искусственном вскармливании. Однако это является следствием критериев включения (здоровые новорожденные) в состояние, при котором грудное вскармливание должно быть первым выбором (51). Кроме того, хотя мы использовали проверенный опросник для ежедневного плача младенца, другие опросники, используемые для регистрации других желудочно-кишечных симптомов, не прошли проверку. Напротив, сильные стороны нашего исследования - это лечение, продленное более чем на 4 недели, включение новорожденных, не подвергавшихся воздействию антибиотиков, оценка многих факторов, мешающих рождению, и изменений в кормлении с течением времени.

В заключение, наше исследование демонстрирует, что введенные штаммы B. breve могут достигать кишечника здоровых новорожденных, предотвращая функциональные желудочно-кишечные расстройства и снижая преждевременную прибавку в весе, по крайней мере, при отсутствии антибиотиков. О нежелательных явлениях не сообщалось, что свидетельствует о безопасности продукта в этой схеме. Перспективные продольные оценки должны быть полезны для дальнейшего изучения того, имеет ли преждевременное краткосрочное лечение в этом критическом окне преимущества в дальнейшей жизни.

Вклад авторов

DD и GB разработали и разработали исследование. EG и AS отвечали за набор пациентов и сбор клинических данных. IA и NB выполнили эксперименты по количественной ПЦР и внесли свой вклад в написание статьи. FP провела статистический анализ, интерпретировала результаты и способствовала написанию статьи. DD, SB, LB и FP критически отредактировали и одобрили окончательную рукопись. LM и MP разработали пробиотическую добавку.

Заявление о конфликте интересов

Авторы LM и MP были наняты компанией Biolab Research Srl, Новара, Италия, и выполняли все исследования и разработки для Probiotical SpA, Новара, Италия.Другие авторы заявляют, что исследование проводилось в отсутствие каких-либо коммерческих или финансовых отношений, которые могли бы быть истолкованы как потенциальный конфликт интересов.

Благодарности

Авторы выражают благодарность Роберте Рикотти, Элизабетте Мингоа, Эмануэле Монес, Франческе Арчеро и Мауро Заффарони за их техническую поддержку. Эта статья посвящена доктору Джованни Могна, который решительно поддержал описанное исследование.

Ссылки

1. Савино Ф, Пелле Э, Палумери Э, Оггеро Р., Миньеро Р. Lactobacillus reuteri (штамм 55730 американской коллекции типовых культур) по сравнению с симетиконом в лечении детских колик: проспективное рандомизированное исследование. Педиатрия (2007) 119: e124–30. 10.1542 / peds.2006-1222 [PubMed] [CrossRef] [Google Scholar] 2. Wessel MA, Cobb JC, Jackson EB, Harris GSJ, Detwiler AC. Приступы суеты в младенчестве, иногда называемые «коликами». Педиатрия (1954) 14: 421–35. [PubMed] [Google Scholar] 3. Zeevenhooven J, Koppen IJN, Benninga MA. Критерии Нового Рима IV для функциональных желудочно-кишечных расстройств у младенцев и детей ясельного возраста.Педиатр Гастроэнтерол Гепатол Нутр. (2017) 20: 1–13. 10.5223 / pghn.2017.20.1.1 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 4. Лукас А., Робертс ISJ. Плач, беспокойство и колики у младенцев, находящихся на грудном и искусственном вскармливании. Early Hum Dev. (1998) 53: 9–18. 10.1016 / S0378-3782 (98) 00032-2 [PubMed] [CrossRef] [Google Scholar] 5. Вик Т., Гроте В., Эскрибано Дж., Соха Дж., Вердучи Э., Фритч М. и др. . Детские колики, продолжительный плач и послеродовая депрессия у матери. Acta Paediatr. (2009) 98: 1344–8. 10.1111 / j.1651-2227.2009.01317.x [PubMed] [CrossRef] [Google Scholar] 6. Индрио Ф., Ди Мауро А., Риеццо Дж., Чиварди Е., Интини С., Корвалья Л. и др. . Профилактическое использование пробиотика для предотвращения колик, срыгивания и функциональных запоров - рандомизированное клиническое испытание. JAMA Pediatr. (2014) 168: 228–33. 10.1001 / jamapediatrics.2013.4367 [PubMed] [CrossRef] [Google Scholar] 7. Романелло С., Спири Д., Маркуцци Э., Занин А., Буазо П. и др. . Связь между детской мигренью и детской коликой в ​​анамнезе.JAMA J Am Med Assoc. (2013) 309: 1607–12. 10.1001 / jama.2013.747 [PubMed] [CrossRef] [Google Scholar] 8. Индрио Ф., Мауро А Ди, Риеццо Дж., Кавалло Л., Франкавилла Р. Детские колики, срыгивание и запор: ранний травматический инсульт в развитии функциональных желудочно-кишечных расстройств у детей? Eur J Pediatr. (2015) 174: 841–2. 10.1186 / 1824-7288-39-15 [PubMed] [CrossRef] [Google Scholar] 9. Бэнкс С., Томас М., Гордон М., Уоллес С., Акобенг А. Пробиотики для предотвращения детских колик. Кокрановская база данных Syst Rev.(2016) 12: 1–19. 10.1002 / 14651858.CD012473 [CrossRef] [Google Scholar] 10. Кандела М., Бьяджи Э., Маккаферри С., Туррони С., Бриджиди П. Микробиота кишечника - это пластический фактор, реагирующий на изменения окружающей среды. Trends Microbiol. (2012) 20: 385–91. 10.1016 / j.tim.2012.05.003 [PubMed] [CrossRef] [Google Scholar] 11. Секиров И., Рассел С.Л., Antunes LCM, Финлей ББ. Микробиота кишечника в здоровье и болезнях. Physiol Rev. (2010) 90: 859–904. 10.1152 / Physrev.00045.2009. [PubMed] [CrossRef] [Google Scholar] 12. Дюбуа NE, Грегори KE.Характеристика кишечного микробиома при детских коликах: результаты, основанные на интегративном обзоре литературы. Biol Res Nurs. (2016) 18: 307–15. 10.1177 / 10915620840 [PubMed] [CrossRef] [Google Scholar] 13. Lee SA, Lim JY, Kim B, Cho SJ, Kim NY, Bin Kim O, Kim Y. Сравнение профиля кишечной микробиоты у корейских младенцев, вскармливаемых грудью и вскармливаемыми смесями, с использованием пиросеквенирования. Nutr Res Pract. (2015) 9: 242–8. 10.4162 / nrp.2015.9.3.242 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 14. Маццола Дж., Мерфи К., Росс Р.П., Ди Джоя Д., Биавати Б.Ранние нарушения микробиоты кишечника после внутриродовой антибиотикопрофилактики для предотвращения стрептококковой инфекции группы B. PLoS ONE (2016) 11: e0157527. 10.1371 / journal.pone.0157527 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 15. Azad MB, Mph TK, Maughan H, Guttman DS, Field CJ, Chari RS и др. . Микробиота кишечника здоровых канадских младенцев: профили в зависимости от способа родов и питания младенцев в 4 месяца. CMAJ (2013) 185: 385–94. 10.1503 / cmaj.130147 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 16.Abrahamsson TR, Jakobsson HE, Andersson AF, Engstrand L, Jenmalm MC. Низкое разнообразие микробиоты кишечника у младенцев с атопической экземой. J Allergy Clin Immunol. (2005) 129: 434–40. 10.1016 / j.jaci.2011.10.025 [PubMed] [CrossRef] [Google Scholar] 17. Гуаральди Ф., Сальватори Г. Влияние грудного вскармливания и искусственного вскармливания на формирование кишечной микробиоты у новорожденных. Front Cell Infect Microbiol. (2012) 2:94. 10.3389 / fcimb.2012.00094 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 18. Савино Ф., Куартьери А., Де Марко А., Гарро М., Амаретти А., Раймонди С. и др.. Сравнение младенцев на искусственном вскармливании с коликами и без них выявило значительные различия в количестве бактерий, энтеробактерий и аммиака в фекалиях. Acta Paediatr. (2017) 106: 573–8. 10.1111 / apa.13642 [PubMed] [CrossRef] [Google Scholar] 19. Тейлор А.Л., Хейл Дж., Вильчут Дж., Леманн Х., Данстан Дж. А., Прескотт С.Л. Влияние пробиотических добавок в течение первых 6 месяцев жизни на аллергеноспецифичные иммунные реакции. Clin Exp Allergy (2006) 36: 1227–35. 10.1111 / j.1365-2222.2006.02553.x [PubMed] [CrossRef] [Google Scholar] 20.Ресслер А., Фридрих У., Фогельсанг Х., Бауэр А., Каатц М., Хиплер Калифорнийский университет и др. . Пробиотическое вмешательство, по-видимому, по-разному влияет на иммунную систему здоровых взрослых и пациентов с атопическим дерматитом. Clin Exp Allergy (2007) 38: 93–102. 10.1111 / j.1365-2222.2007.02876.x [PubMed] [CrossRef] [Google Scholar] 21. Szajewska H, ​​Gyrczuk E, Horvath A. Lactobacillus reuteri DSM 17938 для лечения младенческих колик у младенцев на грудном вскармливании: рандомизированное двойное слепое плацебо-контролируемое исследование.J Pediatr. (2013) 162: 257–62. 10.1016 / j.jpeds.2012.08.004 [PubMed] [CrossRef] [Google Scholar] 22. Чау К., Лау Е., Гринберг С., Якобсон С., Яздани-Брожени П., Верма Н. и др. . Пробиотики для лечения детских колик: рандомизированное двойное слепое плацебо-контролируемое исследование, изучающее Lactobacillus reuteri DSM 17938. J Pediatr. (2015) 166: 74–8.e1. 10.1016 / j.jpeds.2014.09.020 [PubMed] [CrossRef] [Google Scholar] 23. Савино Ф., Форнасеро С., Сератто С., Де Марко А., Мандрас Н., Роана Дж. И др. . Пробиотики и здоровье кишечника у младенцев: предварительное обсервационное исследование случай - контроль по раннему лечению с помощью Lactobacillus reuter i DSM 17938.Clin Chim Acta (2015) 451: 82–7. 10.1016 / j.cca.2015.02.027 [PubMed] [CrossRef] [Google Scholar] 24. Савино Ф., Кордиско Л., Тараско В., Локателли Е., Ди Джоя Д., Оггеро Р. и др. . Антагонистический эффект штаммов Lactobacillus против газообразующих колиформ, выделенных у младенцев, страдающих коликами. BMC Microbiol. (2011) 11: 157. 10.1186 / 1471-2180-11-157 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 25. Di Gioia D, Aloisio I, Mazzola G. Бифидобактерии: их влияние на состав микробиоты кишечника и их применение в качестве пробиотиков у младенцев.Appl Microbiol Biotechnol. (2014) 98: 563–77. 10.1007 / s00253-013-5405-9 [PubMed] [CrossRef] [Google Scholar] 26. Алоизио I, Сантини С., Биавати Б., Динелли Г., Ченчи А., Чингвару В. и др. . Характеристика Bifidobacterium spp. штаммы для лечения кишечных расстройств у новорожденных. Appl Microbiol Biotechnol. (2012) 96: 1561–76. 10.1007 / s00253-012-4138-5 [PubMed] [CrossRef] [Google Scholar] 27. Ли Й, Шимицу Т., Хосака А., Канеко Н., Оцука Ю., Ямаширо Ю. Влияние добавок Bifidobacterium breve на кишечную флору младенцев с низкой массой тела при рождении.Педиатрия Int. (2004) 46: 509–15. 10.1111 / j.1442-200x.2004.01953.x [PubMed] [CrossRef] [Google Scholar] 28. Вада М., Нагата С., Сайто М., Симидзу Т., Ямаширо Ю., Мацуки Т. и др. . Влияние энтерального введения Bifidobacterium breve на пациентов, проходящих химиотерапию по поводу детских злокачественных новообразований. Поддержите лечение рака (2010) 18: 751–9. 10.1007 / s00520-009-0711-6 [PubMed] [CrossRef] [Google Scholar] 29. Костелое К., Харди П., Ющак Э., Вилкс М., Миллар М.Р. Bifidobacterium breve BBG-001 у очень недоношенных новорожденных: рандомизированное контролируемое исследование фазы 3.Ланцет (2016) 387: 649–60. 10.1016 / s0140-6736 (15) 01027-2 [PubMed] [CrossRef] [Google Scholar] 30. Патоле С.К., Рао С.К., Кейл А.Д., Натан Э.А., Доэрти Д.А., Симмер К.Н. Преимущества добавки Bifidobacterium breve M-16V у недоношенных новорожденных - ретроспективное когортное исследование. PLoS ONE (2016) 11: e0150775. 10.1371 / journal.pone.0150775 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 31. Могна Л., Дель Пиано М., Могна Г. Способность двух микроорганизмов Bifidobacterium breve B632 и Bifidobacterium breve BR03 колонизировать кишечную микробиоту детей.J Clin Gastroenterol. (2014) 48: S37–9. 10.1097 / MCG.0000000000000234 [PubMed] [CrossRef] [Google Scholar] 32. Simone M, Gozzoli C, Quartieri A, Mazzola G, Di Gioia D, Amaretti A и др. . Пробиотик Bifidobacterium breve B632 Подавлял рост Enterobacteriaceae в культурах детской микробиоты, пораженной коликами. Biomed Res Int. (2014) 2014: 1–7. 10.1155 / 2014/301053 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 33. Quagliariello A, Aloisio I, Bozzi Cionci N, Luiselli D, Auria GD, Martinez-priego L, et al.. Влияние > Bifidobacterium breve на микробиоту кишечника детей с глютеновой диете на безглютеновой диете: пилотное исследование. Питательные вещества (2016) 8: 660–76. 10.3390 / nu8100660 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 34. Малинен Э., Кассинен А., Ринттила Т., Палва А. Сравнение ПЦР в реальном времени с анализами SYBR Green I или 5 9-нуклеаз и дот-блот-гибридизацией с олигонуклеотидными зондами, нацеленными на рДНК, при количественной оценке выбранных фекальных бактерий. Микробиология (2003) 149: 269–77.10.1099 / mic.0.25975-0 [PubMed] [CrossRef] [Google Scholar] 35. Пендерс Дж., Винк С., Дриссен К., Лондон Н., Тийс С., Стобберинг Э. Количественная оценка Bifidobacterium spp., Escherichia coli и Clostridium difficile в образцах фекалий младенцев, вскармливаемых грудью и вскармливаемых смесями, с помощью ПЦР в реальном времени. FEMS Microbiol Lett. (2005) 243: 141–7. 10.1016 / j.femsle.2004.11.052 [PubMed] [CrossRef] [Google Scholar] 36. Ринттила Т., Кассинен А., Малинен Э., Крогиус Л., Палва А. Разработка обширного набора праймеров, нацеленных на 16S рДНК, для количественной оценки патогенных и аборигенных бактерий в образцах фекалий с помощью ПЦР в реальном времени.J Appl Microbiol. (2004) 97: 1166–77. 10.1111 / j.1365-2672.2004.02409.x [PubMed] [CrossRef] [Google Scholar] 37. Кастильо М., Мартин-Оруэ С.М., Мансанилла Э.Г., Бадиола И., Мартин М., Гаса Дж. Количественная оценка общего количества бактерий, энтеробактерий и лактобактерий в пищеварительном тракте свиней с помощью ПЦР в реальном времени. Vet Microbiol. (2006) 114: 165–70. 10.1016 / j.vetmic.2005.11.055 [PubMed] [CrossRef] [Google Scholar] 38. Пендерс Дж., Тийс С., Винк С., Стелма Ф.Ф., Снидерс Б., Куммелинг И., ван ден Брандт П.А., Стобберинг Э. Факторы, влияющие на состав кишечной микробиоты в раннем детстве.Педиатрия (2006) 118: 511–21. 10.1542 / peds.2005-2824 [PubMed] [CrossRef] [Google Scholar] 39. Хаарман М., Кнол Дж. Количественные ПЦР-анализы в реальном времени для идентификации и количественного определения фекальных видов Bifidobacterium у младенцев, получающих пребиотическую смесь для грудных детей. Appl Environ Microbiol. (2005) 71: 2318–24. 10.1128 / AEM.71.5.2318-2324.2005 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 40. Leser TD, Amenuvor JZ, Jensen TK, Lindecrona RH, Boye M, Møller K. Независимый от культуры анализ кишечных бактерий: повторный визит микробиоты желудочно-кишечного тракта свиней.Appl Environ Microbiol. (2002) 68: 673–90. 10.1128 / AEM.68.2.673 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 41. Барр Р.Г., Крамер М.С., Буашоли К., Маквей-Уайт Л., Плесс И.Б. родительский дневник детского крика и суетливого поведения. Arch Dis Childh. (1988) 63: 380–7. 10.1136 / adc.63.4.380 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 42. Переулок М.М., Чижевский Д.И., Мпч БПК, Шульман Р.Дж. Надежность и валидность модифицированной бристольной шкалы формы стула для детей. J Pediatr. (2011) 159: 437–41.e1. 10.1016 / j.jpeds.2011.03.002 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 43. Aloisio I, Mazzola G, Corvaglia LT, Tonti G, Faldella G, Biavati B и др. . Влияние антибиотикопрофилактики во время родов против Streptococcus группы B на ранний состав кишечника новорожденных и оценка антистрептококковой активности штаммов Bifidobacterium . Appl Microbiol Biotechnol. (2014) 98: 6051–60. 10.1007 / s00253-014-5712-9 [PubMed] [CrossRef] [Google Scholar] 44. Альтшул С.Ф., Гиш В., Миллер В., Майерс Е. В., Липман Д. Д..Базовый инструмент поиска локального выравнивания. J Mol Biol. (1990) 215: 403–10. 10.1016 / S0022-2836 (05) 80360-2 [PubMed] [CrossRef] [Google Scholar] 45. Ли ZMP, Bussema C, Schmidt TM. rrn DB: Документирование количества генов рРНК и тРНК у бактерий и архей. Nucleic Acids Res. (2009) 37: 489–93. 10.1093 / nar / gkn689 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 46. Индрио Ф., Мартини С., Франкавилла Р., Корвалья Л., Кристофори Ф., Мартини С. Эпигенетические вопросы: связь между ранним питанием, микробиомом и долгосрочным развитием здоровья.Фронт Педиатр. (2017) 5: 178. 10.3389 / fped.2017.00178 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 47. Лиепке С., Адерманн К., Райда М., Магерт Х.-Дж., Форссманн В., Цухт HD. Грудное молоко содержит пептиды, которые сильно стимулируют рост бифидобактерий. Eur J Biochem. (2002) 269: 712–8. 10.1046 / j.0014-2956.2001.02712.x [PubMed] [CrossRef] [Google Scholar] 48. Обермайер Т., Грабнар И., Бенедик Э., Тушар Т., Пикель Т.Р., Мис Н.Ф., Матияшич Б.Б., Рогель И. Микробы в развитии кишечника младенца: определение изобилия в параметрах окружающей среды, клинических условиях и росте.Научный доклад (2017) 7: 11230. 10.1038 / s41598-017-10244-x [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 50. Фавье К.Ф., Воан Э.Э., Де Вос В.М., Аккерманс АДЛ. Молекулярный мониторинг сукцессии бактериальных сообществ у новорожденных человека. Общество (2002) 68: 219–26. 10.1128 / AEM.68.1.219 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 51. Макфадден А., Гэвин А., Ренфрю М., Уэйд А., Бьюкенен П., Тейлор Дж. И др. . Поддержка здоровых кормящих матерей со здоровыми доношенными детьми. Кокрановская база данных Syst Rev.(2017) 2: 1-224. 10.1002 / 14651858.CD001141 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 52. Гарсиа Маркес С., Чильон Мартинес Р., Гонсалес Сапата С., Реболло Салас М., Хименес Реджано Х. Дж. Инструменты оценки и диагностики детских колик: систематический обзор. Child Care Health Dev. (2017) 43: 481–8. 10.1111 / cch.12454 [PubMed] [CrossRef] [Google Scholar] 53. Сюй М., Ван Дж., Ван Н., Сунь Ф., Ван Л., Лю X. Эффективность и безопасность пробиотической бактерии Lactobacillus reuteri DSM 17938 для младенческой колики: метаанализ рандомизированных контролируемых испытаний.PLoS ONE (2015) 10: 1–16. 10.1371 / journal.pone.0141445 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 54. Магне Ф., Пучи Силва А., Каравахал Б., Готтеланд М. Повышенная частота кесарева сечения и его вклад в неинфекционные хронические заболевания в Латинской Америке: растущее участие микробиоты. Фронт Педиатр. (2017) 5: 192. 10.3389 / fped.2017.00192 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 55. Kuhle S, Тонг OS, Woolcott CG. Связь детского ожирения и беременности между кесаревым сечением и детским ожирением: систематический обзор и метаанализ.Obes Rev. (2015) 16: 295–303. 10.1111 / obr.12267 [PubMed] [CrossRef] [Google Scholar] 56. Де Моура Э. Г., Лиссабон, ПК, Пассос, MCF. Неонатальное программирование нейроиммуномодуляции - роль адипоцитокинов и нейропептидов. Нейроиммуномодуляция (2008) 15: 176–88. 10.1159 / 000153422 [PubMed] [CrossRef] [Google Scholar] 58. Baldassarre ME, Di Mauro A, Mastromarino P, Fanelli M, Martinelli D, Urbano F и др. . Назначение женщинам в перинатальном периоде мультиштаммового пробиотического продукта по-разному влияет на цитокиновый профиль грудного молока и может оказывать благотворное влияние на функциональные симптомы желудочно-кишечного тракта новорожденных.рандомизированное клиническое испытание. Питательные вещества (2016) 8: 1–13. 10.3390 / nu8110677 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 59. Härtel C, Pagel J, Spiegler J, Buma J, Henneke P, Viemann D, et al. . Lactobacillus acidophilus / Bifidobacterium infantis пробиотики связаны с повышенным ростом VLBWI среди тех, кто подвергается воздействию антибиотиков. Sci Rep. (2017) 7: 1–11. 10.1038 / s41598-017-06161-8 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]

Интеграция трехмесячного кормления со штаммами бифидобактерий предотвращает желудочно-кишечные симптомы у здоровых новорожденных

, 1, , 2, 3, , 2 , 1 , 2 , 2, 3 , 1 , 4 , 4 , 2 , *

Ирен Алоизио

1 Кафедра сельскохозяйственных и пищевых наук, Болонский университет, Болонья, Италия

Флавия Продам

2 Кафедра медицинских наук, Università degli Studi del Piemonte Orientale, Новара, Италия

3 Междисциплинарный исследовательский центр аутоиммунных заболеваний (IRCAD), Università degli Studi del Piemonte Orientale, Новара, Италия

Enza Giglione

2 Департамент медицинских наук, университеты ità degli Studi del Piemonte Orientale, Новара, Италия

Николь Боцци Чиончи

1 Кафедра сельскохозяйственных и пищевых наук, Болонский университет, Болонья, Италия

Арианна Солито

2 Департамент медицинских наук, Università degli Studi del Piemonte Orientale, Новара, Италия

Симонетта Беллоне

2 Департамент медицинских наук, Università degli Studi del Piemonte Orientale, Новара, Италия

3 Междисциплинарный исследовательский центр изучения аутоиммунных заболеваний (IRCAD), Университет del Piemonte Orientale, Новара, Италия

Лоредана Баффони

1 Кафедра сельскохозяйственных и пищевых наук Болонского университета, Болонья, Италия

Лука Могна

4 Biolab Reserach, Новара, Италия

Марко Пане

4 Biolab Reserach, Новара, Италия

Джанни Бона

2 Департамент медицинских наук, Università degli Studi del Piemonte Orientale, Новара, Италия

Diana Di Gioia

1 Департамент сельскохозяйственных и пищевых наук Болонского университета, Болонья, Италия

1 Департамент сельского хозяйства и пищевых наук, Болонский университет, Болонья, Италия

2 Департамент медицинских наук, Università degli Studi del Piemonte Orientale, Новара, Италия

3 Междисциплинарный исследовательский центр аутоиммунных заболеваний (IRCAD), Università degli Studi del Piemonte Orientale, Новара, Италия

4 Biolab Reserach, Новара, Италия

Редактор: Надия В.Бойко, Ужгородский национальный университет, Украина

Рецензент: Брайан Д. Пикколо, Центр детского питания Арканзаса, США; Ирена Рогель, биотехнический факультет, Университет Любляны, Словения

Эта статья была отправлена ​​в раздел «Пищевая микробиология» журнала «Границы питания»

† Эти авторы внесли равный вклад в эту работу.

Поступило 30.11.2017 г .; Принято 23 апреля 2018 г..

Copyright © 2018 Алоизио, Продам, Джильоне, Боцци Чиончи, Солито, Беллоне, Баффони, Могна, Пане, Бона и Ди Джоя.

Это статья в открытом доступе, распространяемая в соответствии с условиями лицензии Creative Commons Attribution License (CC BY). Использование, распространение или воспроизведение на других форумах разрешено при условии указания автора (авторов) и правообладателя и ссылки на оригинальную публикацию в этом журнале в соответствии с принятой академической практикой. Запрещается использование, распространение или воспроизведение без соблюдения этих условий.

Эта статья цитируется в других статьях в PMC.

Abstract

Инфантильные функциональные расстройства желудочно-кишечного тракта распространены в первые месяцы жизни. Их патогенез остается неизвестным, хотя данные свидетельствуют о множестве независимых причин, включая модификации кишечной микробиоты. Тип питания, влияющий на состав кишечной микробиоты, может играть значительную роль в патогенезе. Предыдущие исследования подтвердили успех применения пробиотических добавок против колик, но в основном это были Lactobacillus spp. были протестированы.Целью этого исследования было оценить эффективность против функциональных желудочно-кишечных расстройств пробиотического состава на основе Bifidobacterium breve , включая в исследование субъектов как на грудном, так и на искусственном вскармливании. Двести шестьдесят восемь новорожденных были включены в исследование в течение 15 дней с момента рождения. Сто пятьдесят пять из них эффективно вошли в исследование и были рандомизированы в группы пробиотиков и плацебо, получавших состав в течение 90 дней. Состав пробиотика состоит из смеси 1: 1 2 штаммов B.breve готовят в виде масляной суспензии и вводят в суточной дозе 5 капель, содержащих 10 8 КОЕ каждого штамма. Абсолютное количественное определение выбранных микробных групп в фекалиях проводили с помощью КПЦР. До и после лечения оценивались антропометрические данные, ежедневные дневниковые минуты плача, количество срыгиваний, рвот и отказов, цвет и консистенция стула. Исследование подтвердило положительную роль грудного молока в влиянии на количество целевых микробных групп, в частности, сообщества бифидобактерий.Не сообщалось о побочных эффектах при введении пробиотиков, что свидетельствует о безопасности продукта в этой схеме. B. breve Количество значительно увеличилось у всех новорожденных, которым вводили вакцину ( p <0,02). Исследование демонстрирует, что трехмесячное лечение штаммами B. breve у здоровых новорожденных, находящихся на грудном вскармливании, помогает предотвратить функциональные желудочно-кишечные расстройства, в частности, снижает на 56% ежедневную частоту рвоты ( p <0,03), уменьшая 46,5% дневной нормы. эвакуация с течением времени ( p <0.03) и улучшение консистенции стула (тип 6 в таблице стула Бристоля вместо типа 5) у доношенных ( p <0,0001). Более того, наблюдалось значительное снижение (8,65 против 7,98 LogCFU / г фекалий, p <0,03) B. fragilis в группе кормления из бутылочки, получавшей пробиотический состав.

Ключевые слова: пробиотик, Bifidobacterium breve , детские колики, функциональные желудочно-кишечные расстройства, грудное вскармливание, кормление из бутылочки, микробиота

Введение

Детские колики - распространенное заболевание в первые 3 месяца детства, которое поражает до 30 лет. % новорожденных и характеризуется приступообразным, чрезмерным, неконтролируемым плачем без идентифицируемых причин (1).Wessel et al. (2) дал первое определение этого расстройства как состояние плача или беспокойства, которое длится более 3 часов в день, более 3 дней в неделю. Для клинических целей консенсусная группа Рима IV (3) недавно пересмотрела диагностические критерии, включая возраст новорожденного (<5 месяцев), придав меньшее значение продолжительности плача, учитывая длительный и неотразимый характер эпизодов плача. как раздражительность, которую не могут предотвратить или устранить лица, осуществляющие уход.Симптомы, такие как покраснение лица, метеоризм, сгибание бедер и метеоризм, начинаются на второй неделе жизни как у детей, находящихся на грудном вскармливании, так и у детей, вскармливаемых смесями, и обычно проходят спонтанно со временем (4).

Младенческие колики представляют собой серьезную проблему для семьи, потому что лица, осуществляющие уход, сталкиваются с трудностями в преодолении этих неконтролируемых кризисов, часто приводящих к стрессу и беспокойству; проспективное европейское многоцентровое исследование, проведенное Vik et al. (5) показали, что детские колики и продолжительный плач связаны с высокими показателями материнской депрессии.Точно так же срыгивание, рвота и запор часто требуют посещения педиатра в течение первых 6 месяцев жизни и часто являются причиной смены кормления и использования медицинских методов лечения (6, 7). Более того, наличие колик на раннем этапе жизни было связано с несколькими последствиями: у детей с коликами в анамнезе выше частота функциональных желудочно-кишечных расстройств в более позднем возрасте (8), а у детей с мигренью чаще возникают младенческие колики. чем у людей без мигрени (7).Таким образом, предусмотрена эффективная профилактическая стратегия против функциональных желудочно-кишечных расстройств.

Несмотря на 40 лет исследований, этиология колических кризов и других функциональных желудочно-кишечных расстройств до конца не выяснена. Было высказано предположение, что ряд поведенческих факторов (психологических и социальных), факторов питания (пищевая гиперчувствительность или аллергия), нарушение моторики кишечника и слабое воспаление кишечника могут способствовать его возникновению (6, 9). Неудивительно, что, будучи типичным заболеванием желудочно-кишечного тракта, дисбаланс в составе микробиоты кишечника играет роль в патогенезе этих состояний.Микробиота кишечника очень тесно связана с хозяином, что способствует нормальной физиологии человека: она может служить барьером для колонизации патогенов, синтезировать витамины и другие полезные соединения и стимулировать иммунную систему (10). Неонатальный период является решающим этапом для колонизации желудочно-кишечного тракта, сбалансированного состава кишечной микробиоты, что положительно влияет на здоровье хозяина (11). Младенцы с коликами имеют меньшее фекально-бактериальное разнообразие и стабильность по сравнению со здоровыми.Они также показывают более высокую распространенность грамотрицательных бактерий, особенно колиформ, и меньшее количество полезных бактерий, таких как лактобациллы и бифидобактерии (12).

Диета играет доминирующую роль в формировании микробиоты кишечника, поэтому тип кормления новорожденных оказывает определенное влияние на оценку микробных групп кишечника. Заметные различия показали Lee et al. (13): Актинобактерии были преобладающим филумом у новорожденных, находящихся на грудном вскармливании, за ними следовали Firmicutes и Proteobacteria; Напротив, у младенцев, вскармливаемых смесью, пропорции Actinobacteria и Firmicutes были одинаковыми, за ними следовали Proteobacteria.Кроме того, микробиота кишечника детей, находящихся на искусственном вскармливании, содержит значительное количество родов Escherichia, Veillonella, Enterococcus и Enterobacter , тогда как содержание Lactobacillus было низким. В той же работе сообщается, что основным родом младенцев, вскармливаемых грудью и искусственными смесями, является Bifidobacterium , но эта пропорция значительно выше у младенцев, вскармливаемых грудью. Исследование Mazzola et al. (14) также показали снижение содержания Bifidobacterium spp.у детей, находящихся на смешанном вскармливании (вскармливаемых не менее 50% молочной смеси), по сравнению с грудным вскармливанием. Напротив, дифференциальная представленность рода Bifidobacterium не была обнаружена у младенцев, находящихся на грудном вскармливании, по сравнению с детьми, вскармливаемыми смесью, хотя различия в микробиоте кишечника наблюдались в двух группах (15). Более того, эти исследования выявили более низкое бактериальное богатство и разнообразие на грудном вскармливании, вероятно, из-за наличия уникальных олигосахаридов в грудном молоке, которые служат селективными метаболическими субстратами для ограниченного числа кишечных микробов (16).

Тип питания, влияющий на состав кишечной микробиоты, может играть значительную роль в патогенезе детских колик, хотя после первого года жизни эти различия теряются (17). Недавнее исследование, сфокусированное на младенцах, вскармливаемых смесями и не страдающих коликами, проведенное с использованием FISH в качестве метода подсчета бактерий, выявило более низкую концентрацию общих бактерий и более высокое содержание энтеробактерий у детей, вскармливаемых смесями (18).

Несколько исследований поддерживают использование пробиотиков в качестве терапевтических или профилактических средств против различных заболеваний, в частности кишечных расстройств, а также патологий человека, которые явно не связаны с микробным составом кишечника, таких как аллергии и аутоиммунные заболевания (19, 20).Лечение пробиотиками, благотворное влияние которых на нарушения микробиоты кишечника и на здоровье человека хорошо известно, может иметь защитный эффект от желудочно-кишечных расстройств, включая колики, и уменьшать связанные с ними симптомы, что приводит к правильной микробной колонизации в раннем младенчестве, когда микробиота все еще находится в стадии адаптации.

Многие исследования были сосредоточены на введении Lactobacillus reuteri DSM 17938 в качестве пробиотика для профилактики или уменьшения симптомов функциональных желудочно-кишечных расстройств, включая колики, срыгивание, рвоту и запор, с успешными результатами (6, 21, 22).В частности, Savino et al. (23) показали меньшее количество анаэробных грамотрицательных бактерий, энтеробактерий и энтерококков у новорожденных с коликами, которые получали L. reuteri , по сравнению с детьми, не получавшими лечения. Однако другие виды Lactobacillus , такие как L. delbrueckii subsp. delbruekii DSM 20074 и L. plantarum MB 456 продемонстрировали ингибирующую активность в отношении газообразующих колиформных бактерий и могут быть использованы при лечении детских колик (24).Иными словами, применение бифидобактерий для лечения этих кишечных расстройств остается малоизученным, хотя их роль в здоровой микробиоте кишечника новорожденных была продемонстрирована в обзоре Di Gioia et al. (25). Предыдущее исследование in vitro описало способность некоторых штаммов, принадлежащих к роду Bifidobacterium , включая штаммы Bifidobacterium breve , ингибировать in vitro рост патогенов, типичных для желудочно-кишечного тракта младенцев, включая колиформ, выделенных из новорожденных с коликозной болезнью. 26).Другие исследования продемонстрировали эффективность штамма B. breve для лечения различных детских заболеваний: Li et al. (27) показали полезность в содействии колонизации B. breve и формированию нормальной кишечной биоты у младенцев с низкой массой тела при рождении, Wada et al. (28) описали положительные эффекты этого вида у детей с ослабленным иммунитетом при химиотерапии. Более того, недавние исследования доказали эффективность B. breve для снижения риска некротического энтероколита у недоношенных детей (29, 30).Кроме того, два штамма B. breve, , B632 и BR03 были исследованы на предмет их способности колонизировать кишечник человека, стимулировать иммунный ответ, конкурировать с патогенами, а также были продемонстрированы их оценки безопасности (26, 31, 32). Недавнее исследование также показало способность этих штаммов B. breve , используемых в качестве пробиотиков для детей с глютеновой болезнью, действовать в качестве «пускового» элемента для увеличения других полезных бактериальных родов или типов, таких как Firmicutes (33).

Целью данного исследования было описать эффективность пробиотической композиции на основе B. breve , вводимой новорожденным как на грудном вскармливании, так и на искусственном вскармливании, в: 1) изменении количества целевых групп фекальных микробов; 2) профилактика колик и функциональных желудочно-кишечных расстройств в когорте здоровых новорожденных.

Материалы и методы

Дизайн исследования и сбор образцов

Это было двойное слепое рандомизированное плацебо-контролируемое клиническое испытание ({"type": "клиническое испытание", "attrs": {"text": " NCT03219931 "," term_id ":" NCT03219931 "}} NCT03219931) одобрено этическим комитетом больницы Маджоре делла Карита (CE 63/13).Новорожденные были зачислены в отделение педиатрии факультета медицинских наук Восточного университета Пьемонта им. Авогадро »в период с ноября 2013 г. по сентябрь 2016 г. Новорожденных набирали при рождении и регистрировали в течение 15 дней с момента рождения во время первого посещения (T0). Информированное согласие было получено родителями при зачислении в соответствии с критериями местного этического комитета и критериями Хельсинки. Пациентов попросили выполнить второй визит (Т1) через 90 дней лечения. Число новорожденных, оцененных на соответствие критериям [268], рандомизированных [155] и отнесенных к группе плацебо или пробиотиков, показано на рисунке.Их набирали, если они были здоровы в течение 15 дней после рождения и родились адекватно гестационному возрасту. Критерии исключения: 1) новорожденные-близнецы; 2) лечение любым лекарственным препаратом в рамках набора; 3) лечение пробиотиками; 4) курящие матери; 5) семейный анамнез врожденных заболеваний; 6) длительная желтуха в анамнезе. Матери не рекомендовали никаких особых диетических ограничений во время кормления грудью, за исключением других продуктов, содержащих пробиотики. Пациенты были рандомизированы с использованием компьютерной последовательности распределения в группы плацебо или пробиотиков (1: 1).Персонал исследования и родители были замаскированы для распределения группы исследования. Первоначальная идея исследования заключалась в том, чтобы набрать равное количество новорожденных, находящихся на грудном вскармливании и на искусственном вскармливании, но, учитывая трудности с набором новорожденных, находящихся на искусственном вскармливании, мы решили продолжить с другим количеством новорожденных, принадлежащих к этим двум группы (рисунок).

Группа пробиотиков получала коммерческий пробиотический состав Bifibaby® (Probiotical S.p.A., Новара, Италия), содержащий B. breve в течение 90 дней (T1), а группа плацебо получала состав плацебо на тот же период.Состав пробиотика представлял собой смесь 1: 1 из 2 штаммов, B. breve BR03 (DSM 16604) и B. breve B632 (DSM 24706), приготовленных в масляной суспензии, вводимой в суточной дозе 5 капель, содержащих 10 . 8 КОЕ каждого штамма. Плацебо готовили с теми же эксципиентами без пробиотических штаммов с использованием идентичной формы упаковки.

Клинический мониторинг

Данные о родах были собраны во время первого посещения. Антропометрические данные (вес, рост, окружность головы) и информация о типе кормления собирались как при первом (T0), так и во втором посещении (T1).

Родителей попросили записывать в ежедневный дневник минуты безутешного плача в соответствии с утвержденной анкетой (41). Они также регистрировали ежедневное количество срыгиваний, рвот и опорожнений, а также цвет и консистенцию стула. Бристольская шкала формы стула для детей была передана родителям (42). Колики диагностировали согласно группе консенсуса Рима IV (3).

Родителей также попросили сообщать о любых побочных эффектах (в частности, запорах, рвоте, аллергических реакциях, заболеваниях), лечении, количестве и типах инфекций или боли в животе, имевших место в течение испытательного периода.Соблюдение режима лечения контролировалось телефонными звонками раз в две недели, подсчетом пустых флаконов и ежедневной проверкой молочных заводов.

Сбор образцов кала

Образцы фекалий новорожденных собирали дважды: при зачислении (T0) и в конце вмешательства с пробиотиком / плацебо (T1). Таким образом, проанализированы группы: пробиотик T0, плацебо T0, пробиотик T1, плацебо T1. Образцы фекалий замораживали сразу после сбора при -80 ° C в пронумерованных пластиковых контейнерах с завинчивающейся крышкой, пока они не были обработаны для выделения ДНК.Исследователи, выполняющие экстракцию ДНК и молекулярные анализы (кПЦР), не знали о групповой принадлежности пациентов (группа пробиотиков или плацебо).

Экстракция ДНК из образцов фекалий

ДНК была извлечена из 200 мг фекалий (сохраненных при -80 ° C после сбора) с использованием набора QIAamp DNA Stool Mini (Qiagen, West Sussex, UK) с небольшой модификацией стандартного протокола : дополнительная инкубация при 95 ° C в течение 10 мин образца стула с буфером для лизиса была добавлена ​​для усиления разрыва бактериальных клеток (43).Экстрагированную ДНК хранили при -80 ° C. Чистоту ДНК определяли путем измерения отношения оптической плотности при 260 и 280 нм (Infinite®200 PRO NanoQuant, Tecan, Mannedorf, Швейцария), а концентрацию оценивали с помощью флуорометра Qubit® 3.0 (Invitrogen, Life Technologies, CA, США). ).

Абсолютная количественная оценка выбранных микробных групп с помощью количественной ПЦР (qPCR)

Количественная оценка выбранных микробных групп или видов, обычно отслеживаемых в исследованиях, относящихся к младенцам (38, 43), т.е.е., Bidobacterium spp., Lactobacillus spp., Группа Bacteroides fragilis (включающая наиболее распространенные виды у человека B. fragilis, B. distasonis, B. ovatus, B. thetaiotaomicron, B. vulgatus ) , B. breve, Clostridium difficile, Escherichia coli и общее количество энтеробактерий выполняли с помощью ПЦР в реальном времени на ДНК, выделенной из образцов стула. Анализы проводили с 20 мкл смеси для ПЦР-амплификации, содержащей 10 мкл Fast SYBR® Green Master Mix (Applied Biosystems, Foster city, CA, USA) с оптимизированными концентрациями праймеров (Таблицы), молекулярной степени чистоты H 2 O и 2 мкл ДНК, полученной из проб фекалий в концентрации 2.5 нг / мкл. B. breve анализ выполняли с использованием анализа TaqMan, содержащего 12,5 мкл мастер-микса Universal TaqMan (Applied Biosystems, Foster city, CA, USA), 300 нМ каждого праймера и 100 нМ зонда, меченного 5'-репортерным красителем 6- карбоксифлуоресцеин и 3'-гаситель NFQ-MGB (Applied Biosystems, Nieuwerkerk a / d IJssel, Нидерланды). Число циклов ПЦР составляло 40.

Таблица 1

Последовательности праймеров и условия кПЦР, использованные в различных анализах.

difficile

Микроорганизм-мишень Праймер Последовательность (5'-3 ') Длина ампликона (п.о.) col13 col13 1

Eco-F GTTAATACCTTTGCTCATTGA 340 (34)
Eco-R ACCAGGGTATCTAATCCTGTT Cdiff-F TTGAGCGATTTACTTCGGTAAAGA 114 (35)
Cdiff-R TGTACTG16CTCAC329 903 903 ATTACTG163CTCACCTTTG 903 Bif-F TCGCGTCYGGTGTGAAAG 243 (36)
Bif-R CCACATCCAGCRTCCAC Лак-F GCAGCAGTAGGGAATCTTCCA 349 (37)
Лак-R GCATTYCACCGCTACACATG
Bacteroides ломкая группа Bfra-F CGGAGGATCCGAGCGTTA 92 (38)
Bfra-R CCGCAAACTTTCACAACTGACTTA
B.BREVE F _IS GTGGTGGCTTGAGAACTGGAT А.Г. 118 (39)
R_IS CAAAACGATCGAAACAAACACTAAA
P_IS TGATTCCTCGTTCTTGCTGT
Энтеробактерии Ent-F ATGGCTGTCGTCAGCTCGT 385 (40)
Ent-R CCTACTTCTTTTGCAACCCACTC CCTACTTCTTTTGCAACCCACTC Протоколы

9028 45 Лактобациллы виды .
Целевые бактерии Начальная денатурация Денатурация Отжиг Н.циклы

9029 9029 nM
E. coli
Eco-F / Eco-R 95 ° C - 20 с 95 ° C - 3 с 60 ° C - 30 с 40 400 400
С.difficile
Cdiff-F / Cdiff-R 95 ° C - 20 с 95 ° C - 3 с 60 ° C - 30 с 40 250 250
Бифидобактерии виды .
BifTOT-F / BifTOT-R 95 ° C - 20 с 95 ° C - 3 с 60 ° C - 35 с 40 200 300
Lac-F / Lac-R 95 ° C - 20 с 95 ° C - 3 с 63,5 ° C - 30 с 40 200 200

Концентрации праймеров были оптимизированы с помощью матриц оптимизации праймеров в 48-луночном планшете и оценки наилучшего отношения Ct / ΔRn. Различные праймеры также были проверены на их специфичность с использованием программы поиска сходства нуклеотидов-нуклеотидов в базе данных BLAST (44). Кроме того, для оценки специфичности амплификации анализ кривой плавления продукта проводили после последнего цикла каждой амплификации.Затем данные, полученные в результате амплификации, были преобразованы для получения количества бактериальных клеток (Log КОЕ / г фекалий) в соответствии с количеством копий рРНК, доступным в базе данных количества копий рРНК (45). Стандартные кривые были построены с использованием продуктов ПЦР 16S рРНК типовых штаммов каждого микроорганизма-мишени; использовались стандартные микроорганизмы: B. breve ReO2, Lactobacillus plantarum ATCC 14917, B. fragilis DSM 2151, B. breve B632 DSM 20213, Clostridium sporogenes ATCC 319, coli ATCC 8739. Продукты ПЦР очищали с помощью коммерческой системы очистки ДНК (набор NucleoSpin® Extract II, MACHEREY-NAGEL GmbH & Co. KG, Германия) и концентрацию измеряли спектрофотометрически при 260 нм. Были выполнены серийные разведения, и для калибровки использовали 10 2 , 10 3 , 10 4 , 10 5 , 10 6 , 10 7 копий гена на реакцию. Реакции с образцами проводили трижды, с отрицательным контролем для каждой реакции.

Статистический анализ

Данные выражены как среднее ± стандартное отклонение. Перекошенные переменные были преобразованы в журнал. Ежедневные данные были разделены на 9 категорий, представляющих среднее значение за 10 последовательных дней (от 0 до 90 дней).

Согласно первичному результату, выборка из 58 человек в группе была оценена как достаточная, чтобы продемонстрировать разницу между плацебо и пробиотиками в 0,70 Log КОЕ / г бифидобактерий со стандартным отклонением 1,6, степенью 90% и уровень значимости 95% и процент выбывания 20% согласно опубликованным данным, уже имеющимся во время разработки протокола (32).Согласно вторичному результату выборка из 55 человек в группе была оценена достаточной для снижения на 30% доли желудочно-кишечных расстройств (колики, срыгивание, рвота, запор) с предполагаемой распространенностью 40%, согласно данным литературы (1, 6).

Данные подсчета микробов были подвергнуты тесту Шапиро и тесту Бартлетта для проверки нормального распределения данных и однородности дисперсий. Базовые характеристики сравнивались с точным критерием Фишера для категориальных переменных и двухвыборочным тестом t или тестом Велча t , когда это необходимо для непрерывных переменных.Двухфакторный повторный анализ ANOVA был выполнен для оценки временного эффекта, лечебного эффекта и эффектов взаимодействия (модель 1) на зависимые переменные (минуты плача, характеристики стула, эпизоды рвоты и срыгивания, количество микробов). Использовалась сумма квадратов III типа. Впоследствии были введены следующие ковариаты: пол, тип родов (вагинальные, кесарево, оперативные), антибиотикопрофилактика во время родов (IAP), гестационный возраст, вес новорожденного (модель 2). Модель 3 также включала тип кормления в течение 90 дней (грудное вскармливание, искусственное вскармливание, смешанное вскармливание).Кроме того, в модели 2 и 3 вес, длина и окружность головы также были скорректированы с учетом соответствующей переменной при рождении. Все статистические анализы были выполнены с использованием статистического программного обеспечения R и SPSS для Windows версии 17.0 (SPSS Inc., Чикаго, Иллинойс, США).

Результаты

Исходные характеристики включенных новорожденных

При рождении 268 новорожденных были оценены на соответствие критериям, и их родители приняли участие в исследовании. Сто десять не вошли в исследование, потому что не явились на прием (46), отказались от исследования в тот же день (47) или были исключены из-за лечения антибиотиками после рождения (5).158 субъектов были случайным образом распределены в группу плацебо или пробиотиков. Три из них были потеряны при последующем наблюдении и были исключены (рисунок). Из 155 новорожденных, включенных в протокол, 130 находились на грудном вскармливании (59 плацебо, 71 пробиотик) и 25 находились на искусственном вскармливании (14 плацебо, 11 пробиотиков). Восемьдесят один мужчина и 74 женщины. Кроме того, 139 новорожденных родились вагинально, 10 - кесаревым и 6 - оперативным путем. Все матери были здоровы, не страдали хроническими заболеваниями. Пятнадцать матерей получили ИАП.Во время исследования у трех матерей был эпизод гриппа (2 субъекта в группе кормления грудью и 1 субъект в группе кормления смесью). Ни одна мать не получала лечение антибиотиками во время кормления грудью.

В таблице представлены клинические данные и микробиологические показатели кала на исходном уровне в двух группах распределения (новорожденные, получавшие плацебо и пробиотики). Только Lactobacillus spp. количество было выше в группе плацебо, чем в группе пробиотиков на исходном уровне.

Таблица 3

Ауксологические характеристики всей когорты на исходном уровне (T0) в соответствии с обработкой распределения.

± 901 1,2 (окружность головы ) см)
Плацебо Пробиотик
Пол (М / Ж) 34/39 47/35 903 недель 39,3 ± 1,0
Масса новорожденного (г) 3307,9 ± 397,5 3298,5 ± 362,7
Длина (см) 50,1 ± 2,0 9 Окружность головы 34.2 ± 1,4 33,9 ± 1,1
Рождение (V / C / O) 63/7/3 76/3/3
Дни жизни 10,6 ± 1,9 10,4 ± 2,4
Кормление грудью / из бутылочки 59/14 71/11
Ежедневный плач (мин) 25,5 ± 28,8 28,8 ± 37,7
Частота стула 3,8 ± 16 1,8 4,1 ± 1,9
Эпизоды срыгивания 1.7 ± 1,8 1,6 ± 1,4
Эпизоды рвоты 0,1 ± 0,2 0,2 ± 0,4

Поскольку хорошо известно, что кормление влияет на микробный состав кишечника, а также на клинические проявления у новорожденных, мы исследовали, отличались ли младенцы на грудном и искусственном вскармливании в начале исследования. В дополнительной таблице 1 представлены клинические данные и микробиологические показатели кала на исходном уровне в двух группах (новорожденные на грудном и искусственном вскармливании).Время плача ( p <0,05) и частота стула были выше ( p <0,04), а эпизоды срыгивания были менее частыми ( p <0,05) у младенцев, находящихся на грудном вскармливании. Общее количество энтеробактерий ( p <0,004), E. coli ( p <0,03) и B. fragilis в группе ( p <0,01) было ниже у новорожденных, находящихся на грудном вскармливании, чем у новорожденных, находящихся на искусственном вскармливании. с поправкой на искажающие факторы (пол, гестационный возраст, вес новорожденного, тип родов, ВБД и дни жизни на дату поступления).

Микробиологические результаты во всей когорте после введения пробиотика и плацебо

В таблице показано среднее общее количество микробов, полученное в двух группах образцов: пробиотика и плацебо. Этот анализ показал значительное увеличение количества B. breve на на через 3 месяца. Остальные микробные группы не показали значительной разницы.

Таблица 4

Среднее количество (Log КОЕ / г фекалий) различных микробных групп, проанализированных в образцах стула всей когорты.

90 ± 1,5 ± 1,36
Target Пробиотик T0 Пробиотик T1 Плацебо T0 Плацебо T1
7,00 ± 1,41 7,51 ± 0,88 6,88 ± 1,14 7,29 ± 1,06
B. breve 4,45 ± 1,85 6,40 ± 1,31 162 * 5,33 ± 1,5
Энтеробактерии 6,54 ± 1,23 6,38 ± 1,14 6,02 ± 1,4 6,5 ± 1,02
E. coli 6,72 6,35 ± 2,07 7,42 ± 1,24
Lactobacillus spp. 6,56 ± 1,28 5,60 ± 1,23 6,22 ± 1,06 5,28 ± 1,48
B.fragilis группа 7,44 ± 2,14 7,62 ± 1,97 6,79 ± 2,19 7,23 ± 2,00
C. difficile 2,66 ± 1,48 2,82 ± 1,5 ± 1,58

После этой первой оценки и с учетом различных размеров образцов новорожденных, находящихся на грудном и искусственном вскармливании, а также различий в исходном количестве микробов в этих двух группах, был проведен анализ, разделяющий новорожденных на грудном вскармливании и новорожденных, вскармливаемых из бутылочки. .

Оценка данных лечения пробиотиками новорожденных на грудном вскармливании

На исходном уровне в группе плацебо была меньшая частота стула ( p <0,03) и меньшее количество энтеробактерий, чем в группе пробиотиков ( p <0,01), также с поправкой на искажающие факторы (пол, гестационный возраст, вес новорожденного, тип родов и дни жизни на дату поступления). Предельные средние значения частоты стула и количества энтеробактерий: 3,2 ± 0,4 против 4,3 ± 0,3 ( p <0.01) и 5,86 ± 0,36 против 6,01 ± 0,38 Log КОЕ / г ( p <0,03) соответственно.

Комплаентность к лечению высокая. Все родители ответили на телефонные звонки. 98,7% из них правильно вернули пустые флаконы. О нежелательных явлениях не сообщалось. Трое младенцев (1 в группе плацебо и 2 в группе пробиотика) получали симетикон в течение нескольких дней (<30 дней) из-за срыгивания.

Через 90 дней 100 (43 в группе плацебо, 57 в группе пробиотиков) из 130 новорожденных все еще находились на грудном вскармливании.Из оставшихся 30 младенцев 7 находились на искусственном вскармливании (5 в плацебо, 2 в пробиотике), а остальные 23 находились на смешанном вскармливании (11 в плацебо, 12 в пробиотике).

Клинические данные

Учитывая клинические данные, количество минут плача ( p <0,005) уменьшалось с течением времени без эффекта лечения также в скорректированных моделях.

Число эвакуаций уменьшалось с течением времени ( p <0,0001) с эффектом лечения у тех, кто родился после 40 недель гестационного возраста ( p <0.03). Консистенция стула была больше 5-го типа по Бристольской диаграмме стула ( p <0,03) с течением времени. Дети, рожденные после 40 недель гестационного возраста, чаще имели тип 6 по Бристольской таблице стула у детей, получавших пробиотики ( p <0,0001).

Количество эпизодов срыгивания постоянно уменьшалось с течением времени ( p <0,01) в группе пробиотиков в зависимости от группы плацебо в зависимости от типа кормления ( p <0,03, рисунок).

Количество ежедневных срыгиваний.Группа пробиотиков (сплошная линия) и группа плацебо (пунктирная линия). Новорожденные на грудном вскармливании (A) ; Новорожденные на искусственном вскармливании (B) ; Новорожденные на смешанном вскармливании (С) . Данные выражены как предельное среднее значение ± стандартная ошибка среднего. Данные значимы во взаимодействии ( p <0,04; модель 3). Остатки неоднородны по группам.

Эпизоды рвоты значительно уменьшились со временем в группе пробиотиков, но не в группе плацебо ( p <0,03). Более того, в течение 90 дней частота колик у младенцев была аналогичной в группе плацебо (4 пациента, 6.8%) и пробиотической группе (6 субъектов, 8,5%).

Интересно, что были изменены и ауксологические переменные. Младенцы, получавшие пробиотики, имели меньшую прибавку в весе во время исследования у тех, кто родился с кесаревым сечением ( p <0,03; рисунок), и у тех, кто все еще находился на грудном вскармливании или перешел на искусственное вскармливание во время исследования ( p <0,005) . Разнообразно, младенцы, получавшие пробиотики, имели большее увеличение окружности головы у детей, находящихся на искусственном вскармливании или при смешанном вскармливании ( p <0.01).

Изменение веса за 90 дней. Группа пробиотиков (серая полоса) и группа плацебо (черная полоса). Новорожденные, рожденные естественным путем (A) ; Новорожденные, рожденные путем кесарева сечения (B) ; Новорожденные в результате оперативных родов (С) . Данные выражены как предельное среднее значение ± стандартная ошибка среднего. Данные значимы во взаимодействии ( p <0,03; модель 2). T0: исходный. T1: после 90 дней приема плацебо / пробиотика.

В таблице описаны предельные средние модели 1. В дополнительной таблице 2 описаны также скорректированные модели.

Таблица 5

Клинические и антропометрические вариации в группе грудного вскармливания, полученные с помощью многофакторного анализа повторных измерений.

903,9
Target Пробиотик T0 Пробиотик T1 Плацебо T0 Плацебо T1

1 903 903 903 903 903 903 903 ± 2,9
32,1 ± 5,6 20.5 ± 3,7
Частота стула 4,3 ± 0,2 2,1 ± 0,1 3,9 ± 0,2 2,0 ± 0,1
Цвет стула 6,0 ± 0,1 5,7 ± 0,1 6,0 6,0 ± 0,1
Консистенция стула 5,8 ± 0,1 5,7 ± 0,1 6,0 ± 0,1 5,6 ± 0,1
Регургитация 2,0 ± 0,2 1,6 ± 0,28 ± 0,2 2,0 ± 0,3
Рвота 0,25 ± 0,05 0,11 ± 0,06 * 0,10 ± 0,05 0,20 ± 0,07
3465,6 ± 57,4 3321,5 ± 48,0 3452,2 ± 62,9
Длина (см) 50,1 ± 0,2 51,5 ± 0,2 50,2 ± 0,2 51,5 ± 0,2
33.9 ± 0,1 34,9 ± 0,1 34,3 ± 0,1 35,0 ± 0,1
Микробные данные

Общие энтеробактерии ( p <0,005), Bifidobacterium spp. ( p <0,001) и E. coli ( p <0,001) изменились со временем, но значимость была потеряна при корректировке на искажающие факторы. C. difficile не изменился.

У тех, кто лечился пробиотиками, B. fragilis членов группы уменьшилось с течением времени у рожденных естественным путем, тогда как у других младенцев увеличилось ( p <0.04). Более того, B. breve увеличивалось со временем у тех, кто лечился пробиотиками ( p <0,04). Микробиологические данные представлены в таблице.

Таблица 6

Среднее количество (Log КОЕ / г фекалий) различных микробных групп, проанализированных в образцах стула новорожденных, вскармливаемых грудью.

90
Target Пробиотик T0 Пробиотик T1 Плацебо T0 Плацебо T1
7,11 ± 0,38 7,91 ± 0,27 6,59 ± 0,34 7,78 ± 0,24
B. breve 4,64 ± 0,50 6,10 ± 0,47
62 * 5,8 ± 0,46
Энтеробактерии 6,01 ± 0,38 6,55 ± 0,35 5,86 ± 0,36 6,46 ± 0,34
E. coli 6,70 ± 0,57 6,70 ± 0,5751 6,40 ± 0,54 7,06 ± 0,48
Lactobacillus spp. 6,22 ± 0,33 5,55 ± 0,33 6,28 ± 0,29 6,27 ± 0,35
Группа B. fragilis 6,34 ± 0,64 7,33 ± 0,61 6,4
C. difficile 2,70 ± 0,42 2,89 ± 0,48 2,82 ± 0,37 3.01 ± 0,42

Оценка данных лечения пробиотиками новорожденных на искусственном вскармливании

Исходно в группе плацебо было меньше Lactobacillus spp. больше, чем пробиотический ( p <0,008). При корректировке на факторы, влияющие на факторы (пол, гестационный возраст, вес новорожденного и количество дней жизни на дату поступления), статистическая значимость была потеряна, тогда как количество групп B. fragilis было выше в группе пробиотиков (предельное среднее значение 6,62 ± 0). .53 против 8,62 ± 0,67 Log КОЕ / г, p <0,02).

Клинические данные

Принимая во внимание клинические данные как грубого, так и скорректированного анализа, не было обнаружено никаких изменений в минутах плача, частоте и плотности стула, эпизодах рвоты или срыгивания. Ни у одного ребенка в обеих группах не было коликов. Вес ( p <0,0006), длина ( p <0,01) и окружность головы ( p <0,005) увеличивались со временем без эффекта лечения.

Микробные данные

Всего энтеробактерий и E.coli не менялась со временем. Bifidobacterium spp. ( p <0,02) и C. difficile увеличивались ( p <0,04) со временем без эффекта лечения. В группе, получавшей пробиотики, B. fragilis ( p <0,03) снизились, а B. breve увеличились ( p <0,03) со временем соответственно. Микробиологические данные представлены в таблице.

Таблица 7

Среднее количество (Log КОЕ / г лиц) различных микробных групп, проанализированных в образцах стула новорожденных, вскармливаемых из бутылочки.

90
Target Пробиотик T0 Пробиотик T1 Плацебо T0 Плацебо T1
6,80 ± 0,36 7,56 ± 0,36 6,79 ± 0,30 7,35 ± 0,30
B. breve 4,20 ± 0,35 6,42 ± 0,37 162 * 90.11 ± 0,31 5,09 ± 0,33
Энтеробактерии 7,30 ± 0,41 6,97 ± 0,34 6,75 ± 0,36 7,14 ± 0,30
E. coli ± 0,62 6,67 ± 0,66 7,51 ± 0,54
Lactobacillus spp. 6,81 ± 0,29 6,00 ± 0,35 6,05 ± 0,26 6,39 ± 0,31
B.fragilis группа 8,65 ± 0,61 7,98 ± 1,84 * 7,56 ± 0,56 8,33 ± 0,51
C. difficile 2,54 ± 0,43 903,16 3,35 ± 0,46

Обсуждение

Использование бифидобактерий в качестве пробиотиков у младенцев установлено при некоторых кишечных заболеваниях, наиболее частым из которых является диарея (25). Однако, хотя исследований in vitro и подтверждают использование бифидобактерий против газообразующих колиформ (26), до сих пор не проводилось клинических испытаний их использования против детских колик.Эта работа была сосредоточена на оценке влияния на функциональные желудочно-кишечные симптомы, включая колики, интеграции детского питания с пробиотическим составом на основе B. breve .

Исследование ясно показало способность введенных штаммов B. breve выживать после желудочного транзита и достигать кишечника новорожденного. Фактически, хотя B. breve был обнаружен во всех образцах фекалий, при введении штамма было показано значительное увеличение.В согласии с Lee et al. (13), снижение количества Lactobacillus на , с течением времени наблюдалось во всех группах новорожденных, и это особенно очевидно в группе, получавшей пробиотики. Это может быть связано с высокой способностью Bifidobacterium spp. влиять на состав микробиоты кишечника, усиливая цветение одних видов и уменьшая количество других, как это наблюдалось в других исследованиях, касающихся введения Bifidobacterium (25).

Известно, что тип кормления играет решающую роль в формировании микробиоты кишечника младенца (25, 48).Наше исследование показывает, что при зачислении, когда уже проводилось 7–15 дней кормления грудью или из бутылочки, некоторые различия присутствовали в группах с разным типом кормления: общее количество энтеробактерий и E. coli было выше в группах. на искусственном вскармливании, чем у новорожденных, находящихся на грудном вскармливании, также с поправкой на мешающие факторы. Кроме того, на исходном уровне у младенцев, находящихся на искусственном вскармливании, было обнаружено более высокое количество B. fragilis , что согласуется с более высоким риском инфекции, обычно наблюдаемым у младенцев, не находящихся на грудном вскармливании (49).Это более высокое количество также было очевидным после лечения, как в группе пробиотиков, так и в группе плацебо, подтверждая абсолютную важность начального типа кормления для формирования микробиоты кишечника и, в частности, для уменьшения количества грамотрицательных бактерий. Однако у младенцев, находящихся на искусственном вскармливании, среднее количество B. fragilis было выше в конце лечения в группе плацебо по сравнению с пробиотической, что указывает на возможный положительный эффект от введения B. breve . по крайней мере, до отлучения от груди.Увеличение B. breve также наблюдается у новорожденных на грудном вскармливании, не получавших пробиотики, и это, как уже упоминалось ранее, еще раз подчеркивает положительную роль грудного молока в формировании сообщества бифидобактерий, также учитывая, что B. breve - один из самых распространенных видов в кишечнике новорожденных (50). Это увеличение также подтверждается присутствием в грудном молоке пептидов и олигосахаридов, которые стимулируют рост бифидобактерий (47).

В дополнение к данным о микробах, это исследование направлено на мониторинг типичных желудочно-кишечных симптомов колик, то есть срыгивания, рвоты и запора, с которыми трудно справиться для лиц, осуществляющих уход. Результаты, полученные на применяемых моделях, показали уменьшение количества эвакуаций и улучшение консистенции стула у новорожденных, находящихся на грудном вскармливании, после 90 дней приема пробиотиков. Кроме того, у новорожденных, находящихся на искусственном вскармливании, отмечалось улучшение цвета стула. Эти данные свидетельствуют об улучшении желудочно-кишечного транзита, что может быть связано с приемом пробиотиков.Более того, количество срыгиваний и эпизодов рвоты уменьшилось после лечения пробиотиками. Подобные результаты уже были продемонстрированы с добавлением L. reuteri (6). Уменьшение этих симптомов особенно важно, поскольку они также уменьшают беспокойство родителей и связанные с этим последствия.

Уменьшение срыгивания и рвоты не было показано в группе новорожденных, находящихся на искусственном вскармливании. На этот результат может повлиять небольшой размер группы новорожденных, находящихся на искусственном вскармливании.Исследование не было разработано для оценки различий между двумя режимами кормления, и авторы осведомлены о том, что группа, получавшая искусственное вскармливание, была недостаточна для достижения клинических результатов. Однако данные, относящиеся к разному кормлению, следует анализировать отдельно из-за неожиданных существенных различий в микробном составе на исходном уровне. С другой стороны, у тех, кто находился на грудном вскармливании при наборе, которые перешли на искусственное или смешанное вскармливание, наблюдалось улучшение с уменьшением эпизодов срыгивания. Это важное достижение также с учетом того, что количество новорожденных, находящихся на искусственном вскармливании с самого начала жизни, как правило, невелико, поскольку обычно применяется начало кормления грудным молоком (51).

В этом исследовании продолжительность ежедневного плача младенцев не показала каких-либо различий между группами пробиотиков и плацебо, несмотря на улучшение желудочного транзита из-за введения пробиотиков. Этот результат контрастирует с другими сообщениями в литературе. Можно рассмотреть несколько причин, в первую очередь неточность подсчета минут плача в дневниках самоотчета, хотя и подтвержденных, особенно для такого длительного времени. Было продемонстрировано, что анализ любого существующего инструмента для наблюдения за ежедневным плачем неточен, труден или не подтвержден в течение длительного периода наблюдения (52).Более того, мы оценивали эффекты в течение 3 месяцев, тогда как большинство исследований относились к лечению пробиотиками не дольше 4 недель (1, 53). Более того, после вторых месяцев жизни могут играть роль другие мешающие факторы, в частности, если мы рассматриваем их эффективность в отношении других параметров желудочно-кишечного тракта. Кроме того, частота колик у младенцев была одинаковой, но очень низкой как в группах плацебо, так и в группах пробиотиков. Это следствие рассмотрения в исследовании здоровых новорожденных. В будущем необходимы исследования, включающие только младенцев с коликами.

Главный неожиданный и интересный результат исследования был связан с ауксологическими параметрами. Клинические испытания влияния пробиотиков на параметры роста новорожденных немногочисленны. В нашей популяции младенцы, рожденные с помощью кесарева сечения, имели более низкий догоняющий прирост веса, если их лечили пробиотиком. Этот результат имеет решающее значение для планирования дальнейших интервенционных исследований. Колонизация кишечника микроорганизмами окружающей среды происходит во время или сразу после рождения, тогда как у младенцев, рожденных с помощью кесарева сечения, колонизация кишечника задерживается и часто изменяется, в частности, с изменением количества Bifidobacterium и Lactobacillus (25).Растущие эпидемиологические данные свидетельствуют о том, что дети, рожденные путем кесарева сечения, имеют повышенный риск развития ожирения в более позднем возрасте (54, 55). Как генетический фон и окружающая среда влияют на механизмы, контролирующие аппетит, регуляцию веса и метаболические нарушения, связанные с избыточным весом, а также на иммунное образование, изучены недостаточно. Беременность, роды, послеродовое питание (лактация и отлучение от груди) были определены как критические периоды для программирования питания и гормонального контроля потомства.Некоторые авторы предполагают, что внезапное изменение начальных условий может нарушить физиологический процесс, предрасполагающий к определенным заболеваниям (46, 56, 57), и изменения в преждевременной колонизации играют определенную роль (54, 55). Наши данные предполагают, что лечение штаммами B. breve в первые 3 месяца жизни может влиять на состав микробиоты, и это связано с сопутствующим меньшим набором веса у населения с более высоким риском метаболических нарушений в более позднем возрасте.Другим авторам не удалось показать изменения веса новорожденных, получавших другие пробиотики (53, 58). Различия должны быть вторичными по отношению к штаммам или, что более вероятно, к срокам лечения, согласно нашему протоколу, рассчитанному на 3 месяца, в отличие от большинства исследований, в которых наблюдали младенцев в течение 1 месяца. В нашем исследовании влияние на вес было связано с увеличением окружности головы. Эти данные предполагают, что лечение пробиотиками защищает от нарушения роста, как недавно было продемонстрировано для мультиштаммового пробиотика, содержащего бифидобактерии, у детей с очень низкой массой тела при рождении, подвергшихся воздействию антибиотиков (59).

Основное ограничение этого исследования связано с небольшим размером выборки населения, находящегося на искусственном вскармливании. Однако это является следствием критериев включения (здоровые новорожденные) в состояние, при котором грудное вскармливание должно быть первым выбором (51). Кроме того, хотя мы использовали проверенный опросник для ежедневного плача младенца, другие опросники, используемые для регистрации других желудочно-кишечных симптомов, не прошли проверку. Напротив, сильные стороны нашего исследования - это лечение, продленное более чем на 4 недели, включение новорожденных, не подвергавшихся воздействию антибиотиков, оценка многих факторов, мешающих рождению, и изменений в кормлении с течением времени.

В заключение, наше исследование демонстрирует, что введенные штаммы B. breve могут достигать кишечника здоровых новорожденных, предотвращая функциональные желудочно-кишечные расстройства и снижая преждевременную прибавку в весе, по крайней мере, при отсутствии антибиотиков. О нежелательных явлениях не сообщалось, что свидетельствует о безопасности продукта в этой схеме. Перспективные продольные оценки должны быть полезны для дальнейшего изучения того, имеет ли преждевременное краткосрочное лечение в этом критическом окне преимущества в дальнейшей жизни.

Вклад авторов

DD и GB разработали и разработали исследование. EG и AS отвечали за набор пациентов и сбор клинических данных. IA и NB выполнили эксперименты по количественной ПЦР и внесли свой вклад в написание статьи. FP провела статистический анализ, интерпретировала результаты и способствовала написанию статьи. DD, SB, LB и FP критически отредактировали и одобрили окончательную рукопись. LM и MP разработали пробиотическую добавку.

Заявление о конфликте интересов

Авторы LM и MP были наняты компанией Biolab Research Srl, Новара, Италия, и выполняли все исследования и разработки для Probiotical SpA, Новара, Италия.Другие авторы заявляют, что исследование проводилось в отсутствие каких-либо коммерческих или финансовых отношений, которые могли бы быть истолкованы как потенциальный конфликт интересов.

Благодарности

Авторы выражают благодарность Роберте Рикотти, Элизабетте Мингоа, Эмануэле Монес, Франческе Арчеро и Мауро Заффарони за их техническую поддержку. Эта статья посвящена доктору Джованни Могна, который решительно поддержал описанное исследование.

Ссылки

1. Савино Ф, Пелле Э, Палумери Э, Оггеро Р., Миньеро Р. Lactobacillus reuteri (штамм 55730 американской коллекции типовых культур) по сравнению с симетиконом в лечении детских колик: проспективное рандомизированное исследование. Педиатрия (2007) 119: e124–30. 10.1542 / peds.2006-1222 [PubMed] [CrossRef] [Google Scholar] 2. Wessel MA, Cobb JC, Jackson EB, Harris GSJ, Detwiler AC. Приступы суеты в младенчестве, иногда называемые «коликами». Педиатрия (1954) 14: 421–35. [PubMed] [Google Scholar] 3. Zeevenhooven J, Koppen IJN, Benninga MA. Критерии Нового Рима IV для функциональных желудочно-кишечных расстройств у младенцев и детей ясельного возраста.Педиатр Гастроэнтерол Гепатол Нутр. (2017) 20: 1–13. 10.5223 / pghn.2017.20.1.1 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 4. Лукас А., Робертс ISJ. Плач, беспокойство и колики у младенцев, находящихся на грудном и искусственном вскармливании. Early Hum Dev. (1998) 53: 9–18. 10.1016 / S0378-3782 (98) 00032-2 [PubMed] [CrossRef] [Google Scholar] 5. Вик Т., Гроте В., Эскрибано Дж., Соха Дж., Вердучи Э., Фритч М. и др. . Детские колики, продолжительный плач и послеродовая депрессия у матери. Acta Paediatr. (2009) 98: 1344–8. 10.1111 / j.1651-2227.2009.01317.x [PubMed] [CrossRef] [Google Scholar] 6. Индрио Ф., Ди Мауро А., Риеццо Дж., Чиварди Е., Интини С., Корвалья Л. и др. . Профилактическое использование пробиотика для предотвращения колик, срыгивания и функциональных запоров - рандомизированное клиническое испытание. JAMA Pediatr. (2014) 168: 228–33. 10.1001 / jamapediatrics.2013.4367 [PubMed] [CrossRef] [Google Scholar] 7. Романелло С., Спири Д., Маркуцци Э., Занин А., Буазо П. и др. . Связь между детской мигренью и детской коликой в ​​анамнезе.JAMA J Am Med Assoc. (2013) 309: 1607–12. 10.1001 / jama.2013.747 [PubMed] [CrossRef] [Google Scholar] 8. Индрио Ф., Мауро А Ди, Риеццо Дж., Кавалло Л., Франкавилла Р. Детские колики, срыгивание и запор: ранний травматический инсульт в развитии функциональных желудочно-кишечных расстройств у детей? Eur J Pediatr. (2015) 174: 841–2. 10.1186 / 1824-7288-39-15 [PubMed] [CrossRef] [Google Scholar] 9. Бэнкс С., Томас М., Гордон М., Уоллес С., Акобенг А. Пробиотики для предотвращения детских колик. Кокрановская база данных Syst Rev.(2016) 12: 1–19. 10.1002 / 14651858.CD012473 [CrossRef] [Google Scholar] 10. Кандела М., Бьяджи Э., Маккаферри С., Туррони С., Бриджиди П. Микробиота кишечника - это пластический фактор, реагирующий на изменения окружающей среды. Trends Microbiol. (2012) 20: 385–91. 10.1016 / j.tim.2012.05.003 [PubMed] [CrossRef] [Google Scholar] 11. Секиров И., Рассел С.Л., Antunes LCM, Финлей ББ. Микробиота кишечника в здоровье и болезнях. Physiol Rev. (2010) 90: 859–904. 10.1152 / Physrev.00045.2009. [PubMed] [CrossRef] [Google Scholar] 12. Дюбуа NE, Грегори KE.Характеристика кишечного микробиома при детских коликах: результаты, основанные на интегративном обзоре литературы. Biol Res Nurs. (2016) 18: 307–15. 10.1177 / 10915620840 [PubMed] [CrossRef] [Google Scholar] 13. Lee SA, Lim JY, Kim B, Cho SJ, Kim NY, Bin Kim O, Kim Y. Сравнение профиля кишечной микробиоты у корейских младенцев, вскармливаемых грудью и вскармливаемыми смесями, с использованием пиросеквенирования. Nutr Res Pract. (2015) 9: 242–8. 10.4162 / nrp.2015.9.3.242 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 14. Маццола Дж., Мерфи К., Росс Р.П., Ди Джоя Д., Биавати Б.Ранние нарушения микробиоты кишечника после внутриродовой антибиотикопрофилактики для предотвращения стрептококковой инфекции группы B. PLoS ONE (2016) 11: e0157527. 10.1371 / journal.pone.0157527 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 15. Azad MB, Mph TK, Maughan H, Guttman DS, Field CJ, Chari RS и др. . Микробиота кишечника здоровых канадских младенцев: профили в зависимости от способа родов и питания младенцев в 4 месяца. CMAJ (2013) 185: 385–94. 10.1503 / cmaj.130147 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 16.Abrahamsson TR, Jakobsson HE, Andersson AF, Engstrand L, Jenmalm MC. Низкое разнообразие микробиоты кишечника у младенцев с атопической экземой. J Allergy Clin Immunol. (2005) 129: 434–40. 10.1016 / j.jaci.2011.10.025 [PubMed] [CrossRef] [Google Scholar] 17. Гуаральди Ф., Сальватори Г. Влияние грудного вскармливания и искусственного вскармливания на формирование кишечной микробиоты у новорожденных. Front Cell Infect Microbiol. (2012) 2:94. 10.3389 / fcimb.2012.00094 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 18. Савино Ф., Куартьери А., Де Марко А., Гарро М., Амаретти А., Раймонди С. и др.. Сравнение младенцев на искусственном вскармливании с коликами и без них выявило значительные различия в количестве бактерий, энтеробактерий и аммиака в фекалиях. Acta Paediatr. (2017) 106: 573–8. 10.1111 / apa.13642 [PubMed] [CrossRef] [Google Scholar] 19. Тейлор А.Л., Хейл Дж., Вильчут Дж., Леманн Х., Данстан Дж. А., Прескотт С.Л. Влияние пробиотических добавок в течение первых 6 месяцев жизни на аллергеноспецифичные иммунные реакции. Clin Exp Allergy (2006) 36: 1227–35. 10.1111 / j.1365-2222.2006.02553.x [PubMed] [CrossRef] [Google Scholar] 20.Ресслер А., Фридрих У., Фогельсанг Х., Бауэр А., Каатц М., Хиплер Калифорнийский университет и др. . Пробиотическое вмешательство, по-видимому, по-разному влияет на иммунную систему здоровых взрослых и пациентов с атопическим дерматитом. Clin Exp Allergy (2007) 38: 93–102. 10.1111 / j.1365-2222.2007.02876.x [PubMed] [CrossRef] [Google Scholar] 21. Szajewska H, ​​Gyrczuk E, Horvath A. Lactobacillus reuteri DSM 17938 для лечения младенческих колик у младенцев на грудном вскармливании: рандомизированное двойное слепое плацебо-контролируемое исследование.J Pediatr. (2013) 162: 257–62. 10.1016 / j.jpeds.2012.08.004 [PubMed] [CrossRef] [Google Scholar] 22. Чау К., Лау Е., Гринберг С., Якобсон С., Яздани-Брожени П., Верма Н. и др. . Пробиотики для лечения детских колик: рандомизированное двойное слепое плацебо-контролируемое исследование, изучающее Lactobacillus reuteri DSM 17938. J Pediatr. (2015) 166: 74–8.e1. 10.1016 / j.jpeds.2014.09.020 [PubMed] [CrossRef] [Google Scholar] 23. Савино Ф., Форнасеро С., Сератто С., Де Марко А., Мандрас Н., Роана Дж. И др. . Пробиотики и здоровье кишечника у младенцев: предварительное обсервационное исследование случай - контроль по раннему лечению с помощью Lactobacillus reuter i DSM 17938.Clin Chim Acta (2015) 451: 82–7. 10.1016 / j.cca.2015.02.027 [PubMed] [CrossRef] [Google Scholar] 24. Савино Ф., Кордиско Л., Тараско В., Локателли Е., Ди Джоя Д., Оггеро Р. и др. . Антагонистический эффект штаммов Lactobacillus против газообразующих колиформ, выделенных у младенцев, страдающих коликами. BMC Microbiol. (2011) 11: 157. 10.1186 / 1471-2180-11-157 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 25. Di Gioia D, Aloisio I, Mazzola G. Бифидобактерии: их влияние на состав микробиоты кишечника и их применение в качестве пробиотиков у младенцев.Appl Microbiol Biotechnol. (2014) 98: 563–77. 10.1007 / s00253-013-5405-9 [PubMed] [CrossRef] [Google Scholar] 26. Алоизио I, Сантини С., Биавати Б., Динелли Г., Ченчи А., Чингвару В. и др. . Характеристика Bifidobacterium spp. штаммы для лечения кишечных расстройств у новорожденных. Appl Microbiol Biotechnol. (2012) 96: 1561–76. 10.1007 / s00253-012-4138-5 [PubMed] [CrossRef] [Google Scholar] 27. Ли Й, Шимицу Т., Хосака А., Канеко Н., Оцука Ю., Ямаширо Ю. Влияние добавок Bifidobacterium breve на кишечную флору младенцев с низкой массой тела при рождении.Педиатрия Int. (2004) 46: 509–15. 10.1111 / j.1442-200x.2004.01953.x [PubMed] [CrossRef] [Google Scholar] 28. Вада М., Нагата С., Сайто М., Симидзу Т., Ямаширо Ю., Мацуки Т. и др. . Влияние энтерального введения Bifidobacterium breve на пациентов, проходящих химиотерапию по поводу детских злокачественных новообразований. Поддержите лечение рака (2010) 18: 751–9. 10.1007 / s00520-009-0711-6 [PubMed] [CrossRef] [Google Scholar] 29. Костелое К., Харди П., Ющак Э., Вилкс М., Миллар М.Р. Bifidobacterium breve BBG-001 у очень недоношенных новорожденных: рандомизированное контролируемое исследование фазы 3.Ланцет (2016) 387: 649–60. 10.1016 / s0140-6736 (15) 01027-2 [PubMed] [CrossRef] [Google Scholar] 30. Патоле С.К., Рао С.К., Кейл А.Д., Натан Э.А., Доэрти Д.А., Симмер К.Н. Преимущества добавки Bifidobacterium breve M-16V у недоношенных новорожденных - ретроспективное когортное исследование. PLoS ONE (2016) 11: e0150775. 10.1371 / journal.pone.0150775 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 31. Могна Л., Дель Пиано М., Могна Г. Способность двух микроорганизмов Bifidobacterium breve B632 и Bifidobacterium breve BR03 колонизировать кишечную микробиоту детей.J Clin Gastroenterol. (2014) 48: S37–9. 10.1097 / MCG.0000000000000234 [PubMed] [CrossRef] [Google Scholar] 32. Simone M, Gozzoli C, Quartieri A, Mazzola G, Di Gioia D, Amaretti A и др. . Пробиотик Bifidobacterium breve B632 Подавлял рост Enterobacteriaceae в культурах детской микробиоты, пораженной коликами. Biomed Res Int. (2014) 2014: 1–7. 10.1155 / 2014/301053 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 33. Quagliariello A, Aloisio I, Bozzi Cionci N, Luiselli D, Auria GD, Martinez-priego L, et al.. Влияние > Bifidobacterium breve на микробиоту кишечника детей с глютеновой диете на безглютеновой диете: пилотное исследование. Питательные вещества (2016) 8: 660–76. 10.3390 / nu8100660 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 34. Малинен Э., Кассинен А., Ринттила Т., Палва А. Сравнение ПЦР в реальном времени с анализами SYBR Green I или 5 9-нуклеаз и дот-блот-гибридизацией с олигонуклеотидными зондами, нацеленными на рДНК, при количественной оценке выбранных фекальных бактерий. Микробиология (2003) 149: 269–77.10.1099 / mic.0.25975-0 [PubMed] [CrossRef] [Google Scholar] 35. Пендерс Дж., Винк С., Дриссен К., Лондон Н., Тийс С., Стобберинг Э. Количественная оценка Bifidobacterium spp., Escherichia coli и Clostridium difficile в образцах фекалий младенцев, вскармливаемых грудью и вскармливаемых смесями, с помощью ПЦР в реальном времени. FEMS Microbiol Lett. (2005) 243: 141–7. 10.1016 / j.femsle.2004.11.052 [PubMed] [CrossRef] [Google Scholar] 36. Ринттила Т., Кассинен А., Малинен Э., Крогиус Л., Палва А. Разработка обширного набора праймеров, нацеленных на 16S рДНК, для количественной оценки патогенных и аборигенных бактерий в образцах фекалий с помощью ПЦР в реальном времени.J Appl Microbiol. (2004) 97: 1166–77. 10.1111 / j.1365-2672.2004.02409.x [PubMed] [CrossRef] [Google Scholar] 37. Кастильо М., Мартин-Оруэ С.М., Мансанилла Э.Г., Бадиола И., Мартин М., Гаса Дж. Количественная оценка общего количества бактерий, энтеробактерий и лактобактерий в пищеварительном тракте свиней с помощью ПЦР в реальном времени. Vet Microbiol. (2006) 114: 165–70. 10.1016 / j.vetmic.2005.11.055 [PubMed] [CrossRef] [Google Scholar] 38. Пендерс Дж., Тийс С., Винк С., Стелма Ф.Ф., Снидерс Б., Куммелинг И., ван ден Брандт П.А., Стобберинг Э. Факторы, влияющие на состав кишечной микробиоты в раннем детстве.Педиатрия (2006) 118: 511–21. 10.1542 / peds.2005-2824 [PubMed] [CrossRef] [Google Scholar] 39. Хаарман М., Кнол Дж. Количественные ПЦР-анализы в реальном времени для идентификации и количественного определения фекальных видов Bifidobacterium у младенцев, получающих пребиотическую смесь для грудных детей. Appl Environ Microbiol. (2005) 71: 2318–24. 10.1128 / AEM.71.5.2318-2324.2005 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 40. Leser TD, Amenuvor JZ, Jensen TK, Lindecrona RH, Boye M, Møller K. Независимый от культуры анализ кишечных бактерий: повторный визит микробиоты желудочно-кишечного тракта свиней.Appl Environ Microbiol. (2002) 68: 673–90. 10.1128 / AEM.68.2.673 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 41. Барр Р.Г., Крамер М.С., Буашоли К., Маквей-Уайт Л., Плесс И.Б. родительский дневник детского крика и суетливого поведения. Arch Dis Childh. (1988) 63: 380–7. 10.1136 / adc.63.4.380 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 42. Переулок М.М., Чижевский Д.И., Мпч БПК, Шульман Р.Дж. Надежность и валидность модифицированной бристольной шкалы формы стула для детей. J Pediatr. (2011) 159: 437–41.e1. 10.1016 / j.jpeds.2011.03.002 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 43. Aloisio I, Mazzola G, Corvaglia LT, Tonti G, Faldella G, Biavati B и др. . Влияние антибиотикопрофилактики во время родов против Streptococcus группы B на ранний состав кишечника новорожденных и оценка антистрептококковой активности штаммов Bifidobacterium . Appl Microbiol Biotechnol. (2014) 98: 6051–60. 10.1007 / s00253-014-5712-9 [PubMed] [CrossRef] [Google Scholar] 44. Альтшул С.Ф., Гиш В., Миллер В., Майерс Е. В., Липман Д. Д..Базовый инструмент поиска локального выравнивания. J Mol Biol. (1990) 215: 403–10. 10.1016 / S0022-2836 (05) 80360-2 [PubMed] [CrossRef] [Google Scholar] 45. Ли ZMP, Bussema C, Schmidt TM. rrn DB: Документирование количества генов рРНК и тРНК у бактерий и архей. Nucleic Acids Res. (2009) 37: 489–93. 10.1093 / nar / gkn689 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 46. Индрио Ф., Мартини С., Франкавилла Р., Корвалья Л., Кристофори Ф., Мартини С. Эпигенетические вопросы: связь между ранним питанием, микробиомом и долгосрочным развитием здоровья.Фронт Педиатр. (2017) 5: 178. 10.3389 / fped.2017.00178 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 47. Лиепке С., Адерманн К., Райда М., Магерт Х.-Дж., Форссманн В., Цухт HD. Грудное молоко содержит пептиды, которые сильно стимулируют рост бифидобактерий. Eur J Biochem. (2002) 269: 712–8. 10.1046 / j.0014-2956.2001.02712.x [PubMed] [CrossRef] [Google Scholar] 48. Обермайер Т., Грабнар И., Бенедик Э., Тушар Т., Пикель Т.Р., Мис Н.Ф., Матияшич Б.Б., Рогель И. Микробы в развитии кишечника младенца: определение изобилия в параметрах окружающей среды, клинических условиях и росте.Научный доклад (2017) 7: 11230. 10.1038 / s41598-017-10244-x [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 50. Фавье К.Ф., Воан Э.Э., Де Вос В.М., Аккерманс АДЛ. Молекулярный мониторинг сукцессии бактериальных сообществ у новорожденных человека. Общество (2002) 68: 219–26. 10.1128 / AEM.68.1.219 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 51. Макфадден А., Гэвин А., Ренфрю М., Уэйд А., Бьюкенен П., Тейлор Дж. И др. . Поддержка здоровых кормящих матерей со здоровыми доношенными детьми. Кокрановская база данных Syst Rev.(2017) 2: 1-224. 10.1002 / 14651858.CD001141 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 52. Гарсиа Маркес С., Чильон Мартинес Р., Гонсалес Сапата С., Реболло Салас М., Хименес Реджано Х. Дж. Инструменты оценки и диагностики детских колик: систематический обзор. Child Care Health Dev. (2017) 43: 481–8. 10.1111 / cch.12454 [PubMed] [CrossRef] [Google Scholar] 53. Сюй М., Ван Дж., Ван Н., Сунь Ф., Ван Л., Лю X. Эффективность и безопасность пробиотической бактерии Lactobacillus reuteri DSM 17938 для младенческой колики: метаанализ рандомизированных контролируемых испытаний.PLoS ONE (2015) 10: 1–16. 10.1371 / journal.pone.0141445 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 54. Магне Ф., Пучи Силва А., Каравахал Б., Готтеланд М. Повышенная частота кесарева сечения и его вклад в неинфекционные хронические заболевания в Латинской Америке: растущее участие микробиоты. Фронт Педиатр. (2017) 5: 192. 10.3389 / fped.2017.00192 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 55. Kuhle S, Тонг OS, Woolcott CG. Связь детского ожирения и беременности между кесаревым сечением и детским ожирением: систематический обзор и метаанализ.Obes Rev. (2015) 16: 295–303. 10.1111 / obr.12267 [PubMed] [CrossRef] [Google Scholar] 56. Де Моура Э. Г., Лиссабон, ПК, Пассос, MCF. Неонатальное программирование нейроиммуномодуляции - роль адипоцитокинов и нейропептидов. Нейроиммуномодуляция (2008) 15: 176–88. 10.1159 / 000153422 [PubMed] [CrossRef] [Google Scholar] 58. Baldassarre ME, Di Mauro A, Mastromarino P, Fanelli M, Martinelli D, Urbano F и др. . Назначение женщинам в перинатальном периоде мультиштаммового пробиотического продукта по-разному влияет на цитокиновый профиль грудного молока и может оказывать благотворное влияние на функциональные симптомы желудочно-кишечного тракта новорожденных.рандомизированное клиническое испытание. Питательные вещества (2016) 8: 1–13. 10.3390 / nu8110677 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 59. Härtel C, Pagel J, Spiegler J, Buma J, Henneke P, Viemann D, et al. . Lactobacillus acidophilus / Bifidobacterium infantis пробиотики связаны с повышенным ростом VLBWI среди тех, кто подвергается воздействию антибиотиков. Sci Rep. (2017) 7: 1–11. 10.1038 / s41598-017-06161-8 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]

Интеграция трехмесячного кормления со штаммами бифидобактерий предотвращает желудочно-кишечные симптомы у здоровых новорожденных

, 1, , 2, 3, , 2 , 1 , 2 , 2, 3 , 1 , 4 , 4 , 2 , *

Ирен Алоизио

1 Кафедра сельскохозяйственных и пищевых наук, Болонский университет, Болонья, Италия

Флавия Продам

2 Кафедра медицинских наук, Università degli Studi del Piemonte Orientale, Новара, Италия

3 Междисциплинарный исследовательский центр аутоиммунных заболеваний (IRCAD), Università degli Studi del Piemonte Orientale, Новара, Италия

Enza Giglione

2 Департамент медицинских наук, университеты ità degli Studi del Piemonte Orientale, Новара, Италия

Николь Боцци Чиончи

1 Кафедра сельскохозяйственных и пищевых наук, Болонский университет, Болонья, Италия

Арианна Солито

2 Департамент медицинских наук, Università degli Studi del Piemonte Orientale, Новара, Италия

Симонетта Беллоне

2 Департамент медицинских наук, Università degli Studi del Piemonte Orientale, Новара, Италия

3 Междисциплинарный исследовательский центр изучения аутоиммунных заболеваний (IRCAD), Университет del Piemonte Orientale, Новара, Италия

Лоредана Баффони

1 Кафедра сельскохозяйственных и пищевых наук Болонского университета, Болонья, Италия

Лука Могна

4 Biolab Reserach, Новара, Италия

Марко Пане

4 Biolab Reserach, Новара, Италия

Джанни Бона

2 Департамент медицинских наук, Università degli Studi del Piemonte Orientale, Новара, Италия

Diana Di Gioia

1 Департамент сельскохозяйственных и пищевых наук Болонского университета, Болонья, Италия

1 Департамент сельского хозяйства и пищевых наук, Болонский университет, Болонья, Италия

2 Департамент медицинских наук, Università degli Studi del Piemonte Orientale, Новара, Италия

3 Междисциплинарный исследовательский центр аутоиммунных заболеваний (IRCAD), Università degli Studi del Piemonte Orientale, Новара, Италия

4 Biolab Reserach, Новара, Италия

Редактор: Надия В.Бойко, Ужгородский национальный университет, Украина

Рецензент: Брайан Д. Пикколо, Центр детского питания Арканзаса, США; Ирена Рогель, биотехнический факультет, Университет Любляны, Словения

Эта статья была отправлена ​​в раздел «Пищевая микробиология» журнала «Границы питания»

† Эти авторы внесли равный вклад в эту работу.

Поступило 30.11.2017 г .; Принято 23 апреля 2018 г..

Copyright © 2018 Алоизио, Продам, Джильоне, Боцци Чиончи, Солито, Беллоне, Баффони, Могна, Пане, Бона и Ди Джоя.

Это статья в открытом доступе, распространяемая в соответствии с условиями лицензии Creative Commons Attribution License (CC BY). Использование, распространение или воспроизведение на других форумах разрешено при условии указания автора (авторов) и правообладателя и ссылки на оригинальную публикацию в этом журнале в соответствии с принятой академической практикой. Запрещается использование, распространение или воспроизведение без соблюдения этих условий.

Эта статья цитируется в других статьях в PMC.

Abstract

Инфантильные функциональные расстройства желудочно-кишечного тракта распространены в первые месяцы жизни. Их патогенез остается неизвестным, хотя данные свидетельствуют о множестве независимых причин, включая модификации кишечной микробиоты. Тип питания, влияющий на состав кишечной микробиоты, может играть значительную роль в патогенезе. Предыдущие исследования подтвердили успех применения пробиотических добавок против колик, но в основном это были Lactobacillus spp. были протестированы.Целью этого исследования было оценить эффективность против функциональных желудочно-кишечных расстройств пробиотического состава на основе Bifidobacterium breve , включая в исследование субъектов как на грудном, так и на искусственном вскармливании. Двести шестьдесят восемь новорожденных были включены в исследование в течение 15 дней с момента рождения. Сто пятьдесят пять из них эффективно вошли в исследование и были рандомизированы в группы пробиотиков и плацебо, получавших состав в течение 90 дней. Состав пробиотика состоит из смеси 1: 1 2 штаммов B.breve готовят в виде масляной суспензии и вводят в суточной дозе 5 капель, содержащих 10 8 КОЕ каждого штамма. Абсолютное количественное определение выбранных микробных групп в фекалиях проводили с помощью КПЦР. До и после лечения оценивались антропометрические данные, ежедневные дневниковые минуты плача, количество срыгиваний, рвот и отказов, цвет и консистенция стула. Исследование подтвердило положительную роль грудного молока в влиянии на количество целевых микробных групп, в частности, сообщества бифидобактерий.Не сообщалось о побочных эффектах при введении пробиотиков, что свидетельствует о безопасности продукта в этой схеме. B. breve Количество значительно увеличилось у всех новорожденных, которым вводили вакцину ( p <0,02). Исследование демонстрирует, что трехмесячное лечение штаммами B. breve у здоровых новорожденных, находящихся на грудном вскармливании, помогает предотвратить функциональные желудочно-кишечные расстройства, в частности, снижает на 56% ежедневную частоту рвоты ( p <0,03), уменьшая 46,5% дневной нормы. эвакуация с течением времени ( p <0.03) и улучшение консистенции стула (тип 6 в таблице стула Бристоля вместо типа 5) у доношенных ( p <0,0001). Более того, наблюдалось значительное снижение (8,65 против 7,98 LogCFU / г фекалий, p <0,03) B. fragilis в группе кормления из бутылочки, получавшей пробиотический состав.

Ключевые слова: пробиотик, Bifidobacterium breve , детские колики, функциональные желудочно-кишечные расстройства, грудное вскармливание, кормление из бутылочки, микробиота

Введение

Детские колики - распространенное заболевание в первые 3 месяца детства, которое поражает до 30 лет. % новорожденных и характеризуется приступообразным, чрезмерным, неконтролируемым плачем без идентифицируемых причин (1).Wessel et al. (2) дал первое определение этого расстройства как состояние плача или беспокойства, которое длится более 3 часов в день, более 3 дней в неделю. Для клинических целей консенсусная группа Рима IV (3) недавно пересмотрела диагностические критерии, включая возраст новорожденного (<5 месяцев), придав меньшее значение продолжительности плача, учитывая длительный и неотразимый характер эпизодов плача. как раздражительность, которую не могут предотвратить или устранить лица, осуществляющие уход.Симптомы, такие как покраснение лица, метеоризм, сгибание бедер и метеоризм, начинаются на второй неделе жизни как у детей, находящихся на грудном вскармливании, так и у детей, вскармливаемых смесями, и обычно проходят спонтанно со временем (4).

Младенческие колики представляют собой серьезную проблему для семьи, потому что лица, осуществляющие уход, сталкиваются с трудностями в преодолении этих неконтролируемых кризисов, часто приводящих к стрессу и беспокойству; проспективное европейское многоцентровое исследование, проведенное Vik et al. (5) показали, что детские колики и продолжительный плач связаны с высокими показателями материнской депрессии.Точно так же срыгивание, рвота и запор часто требуют посещения педиатра в течение первых 6 месяцев жизни и часто являются причиной смены кормления и использования медицинских методов лечения (6, 7). Более того, наличие колик на раннем этапе жизни было связано с несколькими последствиями: у детей с коликами в анамнезе выше частота функциональных желудочно-кишечных расстройств в более позднем возрасте (8), а у детей с мигренью чаще возникают младенческие колики. чем у людей без мигрени (7).Таким образом, предусмотрена эффективная профилактическая стратегия против функциональных желудочно-кишечных расстройств.

Несмотря на 40 лет исследований, этиология колических кризов и других функциональных желудочно-кишечных расстройств до конца не выяснена. Было высказано предположение, что ряд поведенческих факторов (психологических и социальных), факторов питания (пищевая гиперчувствительность или аллергия), нарушение моторики кишечника и слабое воспаление кишечника могут способствовать его возникновению (6, 9). Неудивительно, что, будучи типичным заболеванием желудочно-кишечного тракта, дисбаланс в составе микробиоты кишечника играет роль в патогенезе этих состояний.Микробиота кишечника очень тесно связана с хозяином, что способствует нормальной физиологии человека: она может служить барьером для колонизации патогенов, синтезировать витамины и другие полезные соединения и стимулировать иммунную систему (10). Неонатальный период является решающим этапом для колонизации желудочно-кишечного тракта, сбалансированного состава кишечной микробиоты, что положительно влияет на здоровье хозяина (11). Младенцы с коликами имеют меньшее фекально-бактериальное разнообразие и стабильность по сравнению со здоровыми.Они также показывают более высокую распространенность грамотрицательных бактерий, особенно колиформ, и меньшее количество полезных бактерий, таких как лактобациллы и бифидобактерии (12).

Диета играет доминирующую роль в формировании микробиоты кишечника, поэтому тип кормления новорожденных оказывает определенное влияние на оценку микробных групп кишечника. Заметные различия показали Lee et al. (13): Актинобактерии были преобладающим филумом у новорожденных, находящихся на грудном вскармливании, за ними следовали Firmicutes и Proteobacteria; Напротив, у младенцев, вскармливаемых смесью, пропорции Actinobacteria и Firmicutes были одинаковыми, за ними следовали Proteobacteria.Кроме того, микробиота кишечника детей, находящихся на искусственном вскармливании, содержит значительное количество родов Escherichia, Veillonella, Enterococcus и Enterobacter , тогда как содержание Lactobacillus было низким. В той же работе сообщается, что основным родом младенцев, вскармливаемых грудью и искусственными смесями, является Bifidobacterium , но эта пропорция значительно выше у младенцев, вскармливаемых грудью. Исследование Mazzola et al. (14) также показали снижение содержания Bifidobacterium spp.у детей, находящихся на смешанном вскармливании (вскармливаемых не менее 50% молочной смеси), по сравнению с грудным вскармливанием. Напротив, дифференциальная представленность рода Bifidobacterium не была обнаружена у младенцев, находящихся на грудном вскармливании, по сравнению с детьми, вскармливаемыми смесью, хотя различия в микробиоте кишечника наблюдались в двух группах (15). Более того, эти исследования выявили более низкое бактериальное богатство и разнообразие на грудном вскармливании, вероятно, из-за наличия уникальных олигосахаридов в грудном молоке, которые служат селективными метаболическими субстратами для ограниченного числа кишечных микробов (16).

Тип питания, влияющий на состав кишечной микробиоты, может играть значительную роль в патогенезе детских колик, хотя после первого года жизни эти различия теряются (17). Недавнее исследование, сфокусированное на младенцах, вскармливаемых смесями и не страдающих коликами, проведенное с использованием FISH в качестве метода подсчета бактерий, выявило более низкую концентрацию общих бактерий и более высокое содержание энтеробактерий у детей, вскармливаемых смесями (18).

Несколько исследований поддерживают использование пробиотиков в качестве терапевтических или профилактических средств против различных заболеваний, в частности кишечных расстройств, а также патологий человека, которые явно не связаны с микробным составом кишечника, таких как аллергии и аутоиммунные заболевания (19, 20).Лечение пробиотиками, благотворное влияние которых на нарушения микробиоты кишечника и на здоровье человека хорошо известно, может иметь защитный эффект от желудочно-кишечных расстройств, включая колики, и уменьшать связанные с ними симптомы, что приводит к правильной микробной колонизации в раннем младенчестве, когда микробиота все еще находится в стадии адаптации.

Многие исследования были сосредоточены на введении Lactobacillus reuteri DSM 17938 в качестве пробиотика для профилактики или уменьшения симптомов функциональных желудочно-кишечных расстройств, включая колики, срыгивание, рвоту и запор, с успешными результатами (6, 21, 22).В частности, Savino et al. (23) показали меньшее количество анаэробных грамотрицательных бактерий, энтеробактерий и энтерококков у новорожденных с коликами, которые получали L. reuteri , по сравнению с детьми, не получавшими лечения. Однако другие виды Lactobacillus , такие как L. delbrueckii subsp. delbruekii DSM 20074 и L. plantarum MB 456 продемонстрировали ингибирующую активность в отношении газообразующих колиформных бактерий и могут быть использованы при лечении детских колик (24).Иными словами, применение бифидобактерий для лечения этих кишечных расстройств остается малоизученным, хотя их роль в здоровой микробиоте кишечника новорожденных была продемонстрирована в обзоре Di Gioia et al. (25). Предыдущее исследование in vitro описало способность некоторых штаммов, принадлежащих к роду Bifidobacterium , включая штаммы Bifidobacterium breve , ингибировать in vitro рост патогенов, типичных для желудочно-кишечного тракта младенцев, включая колиформ, выделенных из новорожденных с коликозной болезнью. 26).Другие исследования продемонстрировали эффективность штамма B. breve для лечения различных детских заболеваний: Li et al. (27) показали полезность в содействии колонизации B. breve и формированию нормальной кишечной биоты у младенцев с низкой массой тела при рождении, Wada et al. (28) описали положительные эффекты этого вида у детей с ослабленным иммунитетом при химиотерапии. Более того, недавние исследования доказали эффективность B. breve для снижения риска некротического энтероколита у недоношенных детей (29, 30).Кроме того, два штамма B. breve, , B632 и BR03 были исследованы на предмет их способности колонизировать кишечник человека, стимулировать иммунный ответ, конкурировать с патогенами, а также были продемонстрированы их оценки безопасности (26, 31, 32). Недавнее исследование также показало способность этих штаммов B. breve , используемых в качестве пробиотиков для детей с глютеновой болезнью, действовать в качестве «пускового» элемента для увеличения других полезных бактериальных родов или типов, таких как Firmicutes (33).

Целью данного исследования было описать эффективность пробиотической композиции на основе B. breve , вводимой новорожденным как на грудном вскармливании, так и на искусственном вскармливании, в: 1) изменении количества целевых групп фекальных микробов; 2) профилактика колик и функциональных желудочно-кишечных расстройств в когорте здоровых новорожденных.

Материалы и методы

Дизайн исследования и сбор образцов

Это было двойное слепое рандомизированное плацебо-контролируемое клиническое испытание ({"type": "клиническое испытание", "attrs": {"text": " NCT03219931 "," term_id ":" NCT03219931 "}} NCT03219931) одобрено этическим комитетом больницы Маджоре делла Карита (CE 63/13).Новорожденные были зачислены в отделение педиатрии факультета медицинских наук Восточного университета Пьемонта им. Авогадро »в период с ноября 2013 г. по сентябрь 2016 г. Новорожденных набирали при рождении и регистрировали в течение 15 дней с момента рождения во время первого посещения (T0). Информированное согласие было получено родителями при зачислении в соответствии с критериями местного этического комитета и критериями Хельсинки. Пациентов попросили выполнить второй визит (Т1) через 90 дней лечения. Число новорожденных, оцененных на соответствие критериям [268], рандомизированных [155] и отнесенных к группе плацебо или пробиотиков, показано на рисунке.Их набирали, если они были здоровы в течение 15 дней после рождения и родились адекватно гестационному возрасту. Критерии исключения: 1) новорожденные-близнецы; 2) лечение любым лекарственным препаратом в рамках набора; 3) лечение пробиотиками; 4) курящие матери; 5) семейный анамнез врожденных заболеваний; 6) длительная желтуха в анамнезе. Матери не рекомендовали никаких особых диетических ограничений во время кормления грудью, за исключением других продуктов, содержащих пробиотики. Пациенты были рандомизированы с использованием компьютерной последовательности распределения в группы плацебо или пробиотиков (1: 1).Персонал исследования и родители были замаскированы для распределения группы исследования. Первоначальная идея исследования заключалась в том, чтобы набрать равное количество новорожденных, находящихся на грудном вскармливании и на искусственном вскармливании, но, учитывая трудности с набором новорожденных, находящихся на искусственном вскармливании, мы решили продолжить с другим количеством новорожденных, принадлежащих к этим двум группы (рисунок).

Группа пробиотиков получала коммерческий пробиотический состав Bifibaby® (Probiotical S.p.A., Новара, Италия), содержащий B. breve в течение 90 дней (T1), а группа плацебо получала состав плацебо на тот же период.Состав пробиотика представлял собой смесь 1: 1 из 2 штаммов, B. breve BR03 (DSM 16604) и B. breve B632 (DSM 24706), приготовленных в масляной суспензии, вводимой в суточной дозе 5 капель, содержащих 10 . 8 КОЕ каждого штамма. Плацебо готовили с теми же эксципиентами без пробиотических штаммов с использованием идентичной формы упаковки.

Клинический мониторинг

Данные о родах были собраны во время первого посещения. Антропометрические данные (вес, рост, окружность головы) и информация о типе кормления собирались как при первом (T0), так и во втором посещении (T1).

Родителей попросили записывать в ежедневный дневник минуты безутешного плача в соответствии с утвержденной анкетой (41). Они также регистрировали ежедневное количество срыгиваний, рвот и опорожнений, а также цвет и консистенцию стула. Бристольская шкала формы стула для детей была передана родителям (42). Колики диагностировали согласно группе консенсуса Рима IV (3).

Родителей также попросили сообщать о любых побочных эффектах (в частности, запорах, рвоте, аллергических реакциях, заболеваниях), лечении, количестве и типах инфекций или боли в животе, имевших место в течение испытательного периода.Соблюдение режима лечения контролировалось телефонными звонками раз в две недели, подсчетом пустых флаконов и ежедневной проверкой молочных заводов.

Сбор образцов кала

Образцы фекалий новорожденных собирали дважды: при зачислении (T0) и в конце вмешательства с пробиотиком / плацебо (T1). Таким образом, проанализированы группы: пробиотик T0, плацебо T0, пробиотик T1, плацебо T1. Образцы фекалий замораживали сразу после сбора при -80 ° C в пронумерованных пластиковых контейнерах с завинчивающейся крышкой, пока они не были обработаны для выделения ДНК.Исследователи, выполняющие экстракцию ДНК и молекулярные анализы (кПЦР), не знали о групповой принадлежности пациентов (группа пробиотиков или плацебо).

Экстракция ДНК из образцов фекалий

ДНК была извлечена из 200 мг фекалий (сохраненных при -80 ° C после сбора) с использованием набора QIAamp DNA Stool Mini (Qiagen, West Sussex, UK) с небольшой модификацией стандартного протокола : дополнительная инкубация при 95 ° C в течение 10 мин образца стула с буфером для лизиса была добавлена ​​для усиления разрыва бактериальных клеток (43).Экстрагированную ДНК хранили при -80 ° C. Чистоту ДНК определяли путем измерения отношения оптической плотности при 260 и 280 нм (Infinite®200 PRO NanoQuant, Tecan, Mannedorf, Швейцария), а концентрацию оценивали с помощью флуорометра Qubit® 3.0 (Invitrogen, Life Technologies, CA, США). ).

Абсолютная количественная оценка выбранных микробных групп с помощью количественной ПЦР (qPCR)

Количественная оценка выбранных микробных групп или видов, обычно отслеживаемых в исследованиях, относящихся к младенцам (38, 43), т.е.е., Bidobacterium spp., Lactobacillus spp., Группа Bacteroides fragilis (включающая наиболее распространенные виды у человека B. fragilis, B. distasonis, B. ovatus, B. thetaiotaomicron, B. vulgatus ) , B. breve, Clostridium difficile, Escherichia coli и общее количество энтеробактерий выполняли с помощью ПЦР в реальном времени на ДНК, выделенной из образцов стула. Анализы проводили с 20 мкл смеси для ПЦР-амплификации, содержащей 10 мкл Fast SYBR® Green Master Mix (Applied Biosystems, Foster city, CA, USA) с оптимизированными концентрациями праймеров (Таблицы), молекулярной степени чистоты H 2 O и 2 мкл ДНК, полученной из проб фекалий в концентрации 2.5 нг / мкл. B. breve анализ выполняли с использованием анализа TaqMan, содержащего 12,5 мкл мастер-микса Universal TaqMan (Applied Biosystems, Foster city, CA, USA), 300 нМ каждого праймера и 100 нМ зонда, меченного 5'-репортерным красителем 6- карбоксифлуоресцеин и 3'-гаситель NFQ-MGB (Applied Biosystems, Nieuwerkerk a / d IJssel, Нидерланды). Число циклов ПЦР составляло 40.

Таблица 1

Последовательности праймеров и условия кПЦР, использованные в различных анализах.

difficile

Микроорганизм-мишень Праймер Последовательность (5'-3 ') Длина ампликона (п.о.) col13 col13 1

Eco-F GTTAATACCTTTGCTCATTGA 340 (34)
Eco-R ACCAGGGTATCTAATCCTGTT Cdiff-F TTGAGCGATTTACTTCGGTAAAGA 114 (35)
Cdiff-R TGTACTG16CTCAC329 903 903 ATTACTG163CTCACCTTTG 903 Bif-F TCGCGTCYGGTGTGAAAG 243 (36)
Bif-R CCACATCCAGCRTCCAC Лак-F GCAGCAGTAGGGAATCTTCCA 349 (37)
Лак-R GCATTYCACCGCTACACATG
Bacteroides ломкая группа Bfra-F CGGAGGATCCGAGCGTTA 92 (38)
Bfra-R CCGCAAACTTTCACAACTGACTTA
B.BREVE F _IS GTGGTGGCTTGAGAACTGGAT А.Г. 118 (39)
R_IS CAAAACGATCGAAACAAACACTAAA
P_IS TGATTCCTCGTTCTTGCTGT
Энтеробактерии Ent-F ATGGCTGTCGTCAGCTCGT 385 (40)
Ent-R CCTACTTCTTTTGCAACCCACTC CCTACTTCTTTTGCAACCCACTC Протоколы

9028 45 Лактобациллы виды .
Целевые бактерии Начальная денатурация Денатурация Отжиг Н.циклы

9029 9029 nM
E. coli
Eco-F / Eco-R 95 ° C - 20 с 95 ° C - 3 с 60 ° C - 30 с 40 400 400
С.difficile
Cdiff-F / Cdiff-R 95 ° C - 20 с 95 ° C - 3 с 60 ° C - 30 с 40 250 250
Бифидобактерии виды .
BifTOT-F / BifTOT-R 95 ° C - 20 с 95 ° C - 3 с 60 ° C - 35 с 40 200 300
Lac-F / Lac-R 95 ° C - 20 с 95 ° C - 3 с 63,5 ° C - 30 с 40 200 200

Концентрации праймеров были оптимизированы с помощью матриц оптимизации праймеров в 48-луночном планшете и оценки наилучшего отношения Ct / ΔRn. Различные праймеры также были проверены на их специфичность с использованием программы поиска сходства нуклеотидов-нуклеотидов в базе данных BLAST (44). Кроме того, для оценки специфичности амплификации анализ кривой плавления продукта проводили после последнего цикла каждой амплификации.Затем данные, полученные в результате амплификации, были преобразованы для получения количества бактериальных клеток (Log КОЕ / г фекалий) в соответствии с количеством копий рРНК, доступным в базе данных количества копий рРНК (45). Стандартные кривые были построены с использованием продуктов ПЦР 16S рРНК типовых штаммов каждого микроорганизма-мишени; использовались стандартные микроорганизмы: B. breve ReO2, Lactobacillus plantarum ATCC 14917, B. fragilis DSM 2151, B. breve B632 DSM 20213, Clostridium sporogenes ATCC 319, coli ATCC 8739. Продукты ПЦР очищали с помощью коммерческой системы очистки ДНК (набор NucleoSpin® Extract II, MACHEREY-NAGEL GmbH & Co. KG, Германия) и концентрацию измеряли спектрофотометрически при 260 нм. Были выполнены серийные разведения, и для калибровки использовали 10 2 , 10 3 , 10 4 , 10 5 , 10 6 , 10 7 копий гена на реакцию. Реакции с образцами проводили трижды, с отрицательным контролем для каждой реакции.

Статистический анализ

Данные выражены как среднее ± стандартное отклонение. Перекошенные переменные были преобразованы в журнал. Ежедневные данные были разделены на 9 категорий, представляющих среднее значение за 10 последовательных дней (от 0 до 90 дней).

Согласно первичному результату, выборка из 58 человек в группе была оценена как достаточная, чтобы продемонстрировать разницу между плацебо и пробиотиками в 0,70 Log КОЕ / г бифидобактерий со стандартным отклонением 1,6, степенью 90% и уровень значимости 95% и процент выбывания 20% согласно опубликованным данным, уже имеющимся во время разработки протокола (32).Согласно вторичному результату выборка из 55 человек в группе была оценена достаточной для снижения на 30% доли желудочно-кишечных расстройств (колики, срыгивание, рвота, запор) с предполагаемой распространенностью 40%, согласно данным литературы (1, 6).

Данные подсчета микробов были подвергнуты тесту Шапиро и тесту Бартлетта для проверки нормального распределения данных и однородности дисперсий. Базовые характеристики сравнивались с точным критерием Фишера для категориальных переменных и двухвыборочным тестом t или тестом Велча t , когда это необходимо для непрерывных переменных.Двухфакторный повторный анализ ANOVA был выполнен для оценки временного эффекта, лечебного эффекта и эффектов взаимодействия (модель 1) на зависимые переменные (минуты плача, характеристики стула, эпизоды рвоты и срыгивания, количество микробов). Использовалась сумма квадратов III типа. Впоследствии были введены следующие ковариаты: пол, тип родов (вагинальные, кесарево, оперативные), антибиотикопрофилактика во время родов (IAP), гестационный возраст, вес новорожденного (модель 2). Модель 3 также включала тип кормления в течение 90 дней (грудное вскармливание, искусственное вскармливание, смешанное вскармливание).Кроме того, в модели 2 и 3 вес, длина и окружность головы также были скорректированы с учетом соответствующей переменной при рождении. Все статистические анализы были выполнены с использованием статистического программного обеспечения R и SPSS для Windows версии 17.0 (SPSS Inc., Чикаго, Иллинойс, США).

Результаты

Исходные характеристики включенных новорожденных

При рождении 268 новорожденных были оценены на соответствие критериям, и их родители приняли участие в исследовании. Сто десять не вошли в исследование, потому что не явились на прием (46), отказались от исследования в тот же день (47) или были исключены из-за лечения антибиотиками после рождения (5).158 субъектов были случайным образом распределены в группу плацебо или пробиотиков. Три из них были потеряны при последующем наблюдении и были исключены (рисунок). Из 155 новорожденных, включенных в протокол, 130 находились на грудном вскармливании (59 плацебо, 71 пробиотик) и 25 находились на искусственном вскармливании (14 плацебо, 11 пробиотиков). Восемьдесят один мужчина и 74 женщины. Кроме того, 139 новорожденных родились вагинально, 10 - кесаревым и 6 - оперативным путем. Все матери были здоровы, не страдали хроническими заболеваниями. Пятнадцать матерей получили ИАП.Во время исследования у трех матерей был эпизод гриппа (2 субъекта в группе кормления грудью и 1 субъект в группе кормления смесью). Ни одна мать не получала лечение антибиотиками во время кормления грудью.

В таблице представлены клинические данные и микробиологические показатели кала на исходном уровне в двух группах распределения (новорожденные, получавшие плацебо и пробиотики). Только Lactobacillus spp. количество было выше в группе плацебо, чем в группе пробиотиков на исходном уровне.

Таблица 3

Ауксологические характеристики всей когорты на исходном уровне (T0) в соответствии с обработкой распределения.

± 901 1,2 (окружность головы ) см)
Плацебо Пробиотик
Пол (М / Ж) 34/39 47/35 903 недель 39,3 ± 1,0
Масса новорожденного (г) 3307,9 ± 397,5 3298,5 ± 362,7
Длина (см) 50,1 ± 2,0 9 Окружность головы 34.2 ± 1,4 33,9 ± 1,1
Рождение (V / C / O) 63/7/3 76/3/3
Дни жизни 10,6 ± 1,9 10,4 ± 2,4
Кормление грудью / из бутылочки 59/14 71/11
Ежедневный плач (мин) 25,5 ± 28,8 28,8 ± 37,7
Частота стула 3,8 ± 16 1,8 4,1 ± 1,9
Эпизоды срыгивания 1.7 ± 1,8 1,6 ± 1,4
Эпизоды рвоты 0,1 ± 0,2 0,2 ± 0,4

Поскольку хорошо известно, что кормление влияет на микробный состав кишечника, а также на клинические проявления у новорожденных, мы исследовали, отличались ли младенцы на грудном и искусственном вскармливании в начале исследования. В дополнительной таблице 1 представлены клинические данные и микробиологические показатели кала на исходном уровне в двух группах (новорожденные на грудном и искусственном вскармливании).Время плача ( p <0,05) и частота стула были выше ( p <0,04), а эпизоды срыгивания были менее частыми ( p <0,05) у младенцев, находящихся на грудном вскармливании. Общее количество энтеробактерий ( p <0,004), E. coli ( p <0,03) и B. fragilis в группе ( p <0,01) было ниже у новорожденных, находящихся на грудном вскармливании, чем у новорожденных, находящихся на искусственном вскармливании. с поправкой на искажающие факторы (пол, гестационный возраст, вес новорожденного, тип родов, ВБД и дни жизни на дату поступления).

Микробиологические результаты во всей когорте после введения пробиотика и плацебо

В таблице показано среднее общее количество микробов, полученное в двух группах образцов: пробиотика и плацебо. Этот анализ показал значительное увеличение количества B. breve на на через 3 месяца. Остальные микробные группы не показали значительной разницы.

Таблица 4

Среднее количество (Log КОЕ / г фекалий) различных микробных групп, проанализированных в образцах стула всей когорты.

90 ± 1,5 ± 1,36
Target Пробиотик T0 Пробиотик T1 Плацебо T0 Плацебо T1
7,00 ± 1,41 7,51 ± 0,88 6,88 ± 1,14 7,29 ± 1,06
B. breve 4,45 ± 1,85 6,40 ± 1,31 162 * 5,33 ± 1,5
Энтеробактерии 6,54 ± 1,23 6,38 ± 1,14 6,02 ± 1,4 6,5 ± 1,02
E. coli 6,72 6,35 ± 2,07 7,42 ± 1,24
Lactobacillus spp. 6,56 ± 1,28 5,60 ± 1,23 6,22 ± 1,06 5,28 ± 1,48
B.fragilis группа 7,44 ± 2,14 7,62 ± 1,97 6,79 ± 2,19 7,23 ± 2,00
C. difficile 2,66 ± 1,48 2,82 ± 1,5 ± 1,58

После этой первой оценки и с учетом различных размеров образцов новорожденных, находящихся на грудном и искусственном вскармливании, а также различий в исходном количестве микробов в этих двух группах, был проведен анализ, разделяющий новорожденных на грудном вскармливании и новорожденных, вскармливаемых из бутылочки. .

Оценка данных лечения пробиотиками новорожденных на грудном вскармливании

На исходном уровне в группе плацебо была меньшая частота стула ( p <0,03) и меньшее количество энтеробактерий, чем в группе пробиотиков ( p <0,01), также с поправкой на искажающие факторы (пол, гестационный возраст, вес новорожденного, тип родов и дни жизни на дату поступления). Предельные средние значения частоты стула и количества энтеробактерий: 3,2 ± 0,4 против 4,3 ± 0,3 ( p <0.01) и 5,86 ± 0,36 против 6,01 ± 0,38 Log КОЕ / г ( p <0,03) соответственно.

Комплаентность к лечению высокая. Все родители ответили на телефонные звонки. 98,7% из них правильно вернули пустые флаконы. О нежелательных явлениях не сообщалось. Трое младенцев (1 в группе плацебо и 2 в группе пробиотика) получали симетикон в течение нескольких дней (<30 дней) из-за срыгивания.

Через 90 дней 100 (43 в группе плацебо, 57 в группе пробиотиков) из 130 новорожденных все еще находились на грудном вскармливании.Из оставшихся 30 младенцев 7 находились на искусственном вскармливании (5 в плацебо, 2 в пробиотике), а остальные 23 находились на смешанном вскармливании (11 в плацебо, 12 в пробиотике).

Клинические данные

Учитывая клинические данные, количество минут плача ( p <0,005) уменьшалось с течением времени без эффекта лечения также в скорректированных моделях.

Число эвакуаций уменьшалось с течением времени ( p <0,0001) с эффектом лечения у тех, кто родился после 40 недель гестационного возраста ( p <0.03). Консистенция стула была больше 5-го типа по Бристольской диаграмме стула ( p <0,03) с течением времени. Дети, рожденные после 40 недель гестационного возраста, чаще имели тип 6 по Бристольской таблице стула у детей, получавших пробиотики ( p <0,0001).

Количество эпизодов срыгивания постоянно уменьшалось с течением времени ( p <0,01) в группе пробиотиков в зависимости от группы плацебо в зависимости от типа кормления ( p <0,03, рисунок).

Количество ежедневных срыгиваний.Группа пробиотиков (сплошная линия) и группа плацебо (пунктирная линия). Новорожденные на грудном вскармливании (A) ; Новорожденные на искусственном вскармливании (B) ; Новорожденные на смешанном вскармливании (С) . Данные выражены как предельное среднее значение ± стандартная ошибка среднего. Данные значимы во взаимодействии ( p <0,04; модель 3). Остатки неоднородны по группам.

Эпизоды рвоты значительно уменьшились со временем в группе пробиотиков, но не в группе плацебо ( p <0,03). Более того, в течение 90 дней частота колик у младенцев была аналогичной в группе плацебо (4 пациента, 6.8%) и пробиотической группе (6 субъектов, 8,5%).

Интересно, что были изменены и ауксологические переменные. Младенцы, получавшие пробиотики, имели меньшую прибавку в весе во время исследования у тех, кто родился с кесаревым сечением ( p <0,03; рисунок), и у тех, кто все еще находился на грудном вскармливании или перешел на искусственное вскармливание во время исследования ( p <0,005) . Разнообразно, младенцы, получавшие пробиотики, имели большее увеличение окружности головы у детей, находящихся на искусственном вскармливании или при смешанном вскармливании ( p <0.01).

Изменение веса за 90 дней. Группа пробиотиков (серая полоса) и группа плацебо (черная полоса). Новорожденные, рожденные естественным путем (A) ; Новорожденные, рожденные путем кесарева сечения (B) ; Новорожденные в результате оперативных родов (С) . Данные выражены как предельное среднее значение ± стандартная ошибка среднего. Данные значимы во взаимодействии ( p <0,03; модель 2). T0: исходный. T1: после 90 дней приема плацебо / пробиотика.

В таблице описаны предельные средние модели 1. В дополнительной таблице 2 описаны также скорректированные модели.

Таблица 5

Клинические и антропометрические вариации в группе грудного вскармливания, полученные с помощью многофакторного анализа повторных измерений.

903,9
Target Пробиотик T0 Пробиотик T1 Плацебо T0 Плацебо T1

1 903 903 903 903 903 903 903 ± 2,9
32,1 ± 5,6 20.5 ± 3,7
Частота стула 4,3 ± 0,2 2,1 ± 0,1 3,9 ± 0,2 2,0 ± 0,1
Цвет стула 6,0 ± 0,1 5,7 ± 0,1 6,0 6,0 ± 0,1
Консистенция стула 5,8 ± 0,1 5,7 ± 0,1 6,0 ± 0,1 5,6 ± 0,1
Регургитация 2,0 ± 0,2 1,6 ± 0,28 ± 0,2 2,0 ± 0,3
Рвота 0,25 ± 0,05 0,11 ± 0,06 * 0,10 ± 0,05 0,20 ± 0,07
3465,6 ± 57,4 3321,5 ± 48,0 3452,2 ± 62,9
Длина (см) 50,1 ± 0,2 51,5 ± 0,2 50,2 ± 0,2 51,5 ± 0,2
33.9 ± 0,1 34,9 ± 0,1 34,3 ± 0,1 35,0 ± 0,1
Микробные данные

Общие энтеробактерии ( p <0,005), Bifidobacterium spp. ( p <0,001) и E. coli ( p <0,001) изменились со временем, но значимость была потеряна при корректировке на искажающие факторы. C. difficile не изменился.

У тех, кто лечился пробиотиками, B. fragilis членов группы уменьшилось с течением времени у рожденных естественным путем, тогда как у других младенцев увеличилось ( p <0.04). Более того, B. breve увеличивалось со временем у тех, кто лечился пробиотиками ( p <0,04). Микробиологические данные представлены в таблице.

Таблица 6

Среднее количество (Log КОЕ / г фекалий) различных микробных групп, проанализированных в образцах стула новорожденных, вскармливаемых грудью.

90
Target Пробиотик T0 Пробиотик T1 Плацебо T0 Плацебо T1
7,11 ± 0,38 7,91 ± 0,27 6,59 ± 0,34 7,78 ± 0,24
B. breve 4,64 ± 0,50 6,10 ± 0,47
62 * 5,8 ± 0,46
Энтеробактерии 6,01 ± 0,38 6,55 ± 0,35 5,86 ± 0,36 6,46 ± 0,34
E. coli 6,70 ± 0,57 6,70 ± 0,5751 6,40 ± 0,54 7,06 ± 0,48
Lactobacillus spp. 6,22 ± 0,33 5,55 ± 0,33 6,28 ± 0,29 6,27 ± 0,35
Группа B. fragilis 6,34 ± 0,64 7,33 ± 0,61 6,4
C. difficile 2,70 ± 0,42 2,89 ± 0,48 2,82 ± 0,37 3.01 ± 0,42

Оценка данных лечения пробиотиками новорожденных на искусственном вскармливании

Исходно в группе плацебо было меньше Lactobacillus spp. больше, чем пробиотический ( p <0,008). При корректировке на факторы, влияющие на факторы (пол, гестационный возраст, вес новорожденного и количество дней жизни на дату поступления), статистическая значимость была потеряна, тогда как количество групп B. fragilis было выше в группе пробиотиков (предельное среднее значение 6,62 ± 0). .53 против 8,62 ± 0,67 Log КОЕ / г, p <0,02).

Клинические данные

Принимая во внимание клинические данные как грубого, так и скорректированного анализа, не было обнаружено никаких изменений в минутах плача, частоте и плотности стула, эпизодах рвоты или срыгивания. Ни у одного ребенка в обеих группах не было коликов. Вес ( p <0,0006), длина ( p <0,01) и окружность головы ( p <0,005) увеличивались со временем без эффекта лечения.

Микробные данные

Всего энтеробактерий и E.coli не менялась со временем. Bifidobacterium spp. ( p <0,02) и C. difficile увеличивались ( p <0,04) со временем без эффекта лечения. В группе, получавшей пробиотики, B. fragilis ( p <0,03) снизились, а B. breve увеличились ( p <0,03) со временем соответственно. Микробиологические данные представлены в таблице.

Таблица 7

Среднее количество (Log КОЕ / г лиц) различных микробных групп, проанализированных в образцах стула новорожденных, вскармливаемых из бутылочки.

90
Target Пробиотик T0 Пробиотик T1 Плацебо T0 Плацебо T1
6,80 ± 0,36 7,56 ± 0,36 6,79 ± 0,30 7,35 ± 0,30
B. breve 4,20 ± 0,35 6,42 ± 0,37 162 * 90.11 ± 0,31 5,09 ± 0,33
Энтеробактерии 7,30 ± 0,41 6,97 ± 0,34 6,75 ± 0,36 7,14 ± 0,30
E. coli ± 0,62 6,67 ± 0,66 7,51 ± 0,54
Lactobacillus spp. 6,81 ± 0,29 6,00 ± 0,35 6,05 ± 0,26 6,39 ± 0,31
B.fragilis группа 8,65 ± 0,61 7,98 ± 1,84 * 7,56 ± 0,56 8,33 ± 0,51
C. difficile 2,54 ± 0,43 903,16 3,35 ± 0,46

Обсуждение

Использование бифидобактерий в качестве пробиотиков у младенцев установлено при некоторых кишечных заболеваниях, наиболее частым из которых является диарея (25). Однако, хотя исследований in vitro и подтверждают использование бифидобактерий против газообразующих колиформ (26), до сих пор не проводилось клинических испытаний их использования против детских колик.Эта работа была сосредоточена на оценке влияния на функциональные желудочно-кишечные симптомы, включая колики, интеграции детского питания с пробиотическим составом на основе B. breve .

Исследование ясно показало способность введенных штаммов B. breve выживать после желудочного транзита и достигать кишечника новорожденного. Фактически, хотя B. breve был обнаружен во всех образцах фекалий, при введении штамма было показано значительное увеличение.В согласии с Lee et al. (13), снижение количества Lactobacillus на , с течением времени наблюдалось во всех группах новорожденных, и это особенно очевидно в группе, получавшей пробиотики. Это может быть связано с высокой способностью Bifidobacterium spp. влиять на состав микробиоты кишечника, усиливая цветение одних видов и уменьшая количество других, как это наблюдалось в других исследованиях, касающихся введения Bifidobacterium (25).

Известно, что тип кормления играет решающую роль в формировании микробиоты кишечника младенца (25, 48).Наше исследование показывает, что при зачислении, когда уже проводилось 7–15 дней кормления грудью или из бутылочки, некоторые различия присутствовали в группах с разным типом кормления: общее количество энтеробактерий и E. coli было выше в группах. на искусственном вскармливании, чем у новорожденных, находящихся на грудном вскармливании, также с поправкой на мешающие факторы. Кроме того, на исходном уровне у младенцев, находящихся на искусственном вскармливании, было обнаружено более высокое количество B. fragilis , что согласуется с более высоким риском инфекции, обычно наблюдаемым у младенцев, не находящихся на грудном вскармливании (49).Это более высокое количество также было очевидным после лечения, как в группе пробиотиков, так и в группе плацебо, подтверждая абсолютную важность начального типа кормления для формирования микробиоты кишечника и, в частности, для уменьшения количества грамотрицательных бактерий. Однако у младенцев, находящихся на искусственном вскармливании, среднее количество B. fragilis было выше в конце лечения в группе плацебо по сравнению с пробиотической, что указывает на возможный положительный эффект от введения B. breve . по крайней мере, до отлучения от груди.Увеличение B. breve также наблюдается у новорожденных на грудном вскармливании, не получавших пробиотики, и это, как уже упоминалось ранее, еще раз подчеркивает положительную роль грудного молока в формировании сообщества бифидобактерий, также учитывая, что B. breve - один из самых распространенных видов в кишечнике новорожденных (50). Это увеличение также подтверждается присутствием в грудном молоке пептидов и олигосахаридов, которые стимулируют рост бифидобактерий (47).

В дополнение к данным о микробах, это исследование направлено на мониторинг типичных желудочно-кишечных симптомов колик, то есть срыгивания, рвоты и запора, с которыми трудно справиться для лиц, осуществляющих уход. Результаты, полученные на применяемых моделях, показали уменьшение количества эвакуаций и улучшение консистенции стула у новорожденных, находящихся на грудном вскармливании, после 90 дней приема пробиотиков. Кроме того, у новорожденных, находящихся на искусственном вскармливании, отмечалось улучшение цвета стула. Эти данные свидетельствуют об улучшении желудочно-кишечного транзита, что может быть связано с приемом пробиотиков.Более того, количество срыгиваний и эпизодов рвоты уменьшилось после лечения пробиотиками. Подобные результаты уже были продемонстрированы с добавлением L. reuteri (6). Уменьшение этих симптомов особенно важно, поскольку они также уменьшают беспокойство родителей и связанные с этим последствия.

Уменьшение срыгивания и рвоты не было показано в группе новорожденных, находящихся на искусственном вскармливании. На этот результат может повлиять небольшой размер группы новорожденных, находящихся на искусственном вскармливании.Исследование не было разработано для оценки различий между двумя режимами кормления, и авторы осведомлены о том, что группа, получавшая искусственное вскармливание, была недостаточна для достижения клинических результатов. Однако данные, относящиеся к разному кормлению, следует анализировать отдельно из-за неожиданных существенных различий в микробном составе на исходном уровне. С другой стороны, у тех, кто находился на грудном вскармливании при наборе, которые перешли на искусственное или смешанное вскармливание, наблюдалось улучшение с уменьшением эпизодов срыгивания. Это важное достижение также с учетом того, что количество новорожденных, находящихся на искусственном вскармливании с самого начала жизни, как правило, невелико, поскольку обычно применяется начало кормления грудным молоком (51).

В этом исследовании продолжительность ежедневного плача младенцев не показала каких-либо различий между группами пробиотиков и плацебо, несмотря на улучшение желудочного транзита из-за введения пробиотиков. Этот результат контрастирует с другими сообщениями в литературе. Можно рассмотреть несколько причин, в первую очередь неточность подсчета минут плача в дневниках самоотчета, хотя и подтвержденных, особенно для такого длительного времени. Было продемонстрировано, что анализ любого существующего инструмента для наблюдения за ежедневным плачем неточен, труден или не подтвержден в течение длительного периода наблюдения (52).Более того, мы оценивали эффекты в течение 3 месяцев, тогда как большинство исследований относились к лечению пробиотиками не дольше 4 недель (1, 53). Более того, после вторых месяцев жизни могут играть роль другие мешающие факторы, в частности, если мы рассматриваем их эффективность в отношении других параметров желудочно-кишечного тракта. Кроме того, частота колик у младенцев была одинаковой, но очень низкой как в группах плацебо, так и в группах пробиотиков. Это следствие рассмотрения в исследовании здоровых новорожденных. В будущем необходимы исследования, включающие только младенцев с коликами.

Главный неожиданный и интересный результат исследования был связан с ауксологическими параметрами. Клинические испытания влияния пробиотиков на параметры роста новорожденных немногочисленны. В нашей популяции младенцы, рожденные с помощью кесарева сечения, имели более низкий догоняющий прирост веса, если их лечили пробиотиком. Этот результат имеет решающее значение для планирования дальнейших интервенционных исследований. Колонизация кишечника микроорганизмами окружающей среды происходит во время или сразу после рождения, тогда как у младенцев, рожденных с помощью кесарева сечения, колонизация кишечника задерживается и часто изменяется, в частности, с изменением количества Bifidobacterium и Lactobacillus (25).Растущие эпидемиологические данные свидетельствуют о том, что дети, рожденные путем кесарева сечения, имеют повышенный риск развития ожирения в более позднем возрасте (54, 55). Как генетический фон и окружающая среда влияют на механизмы, контролирующие аппетит, регуляцию веса и метаболические нарушения, связанные с избыточным весом, а также на иммунное образование, изучены недостаточно. Беременность, роды, послеродовое питание (лактация и отлучение от груди) были определены как критические периоды для программирования питания и гормонального контроля потомства.Некоторые авторы предполагают, что внезапное изменение начальных условий может нарушить физиологический процесс, предрасполагающий к определенным заболеваниям (46, 56, 57), и изменения в преждевременной колонизации играют определенную роль (54, 55). Наши данные предполагают, что лечение штаммами B. breve в первые 3 месяца жизни может влиять на состав микробиоты, и это связано с сопутствующим меньшим набором веса у населения с более высоким риском метаболических нарушений в более позднем возрасте.Другим авторам не удалось показать изменения веса новорожденных, получавших другие пробиотики (53, 58). Различия должны быть вторичными по отношению к штаммам или, что более вероятно, к срокам лечения, согласно нашему протоколу, рассчитанному на 3 месяца, в отличие от большинства исследований, в которых наблюдали младенцев в течение 1 месяца. В нашем исследовании влияние на вес было связано с увеличением окружности головы. Эти данные предполагают, что лечение пробиотиками защищает от нарушения роста, как недавно было продемонстрировано для мультиштаммового пробиотика, содержащего бифидобактерии, у детей с очень низкой массой тела при рождении, подвергшихся воздействию антибиотиков (59).

Основное ограничение этого исследования связано с небольшим размером выборки населения, находящегося на искусственном вскармливании. Однако это является следствием критериев включения (здоровые новорожденные) в состояние, при котором грудное вскармливание должно быть первым выбором (51). Кроме того, хотя мы использовали проверенный опросник для ежедневного плача младенца, другие опросники, используемые для регистрации других желудочно-кишечных симптомов, не прошли проверку. Напротив, сильные стороны нашего исследования - это лечение, продленное более чем на 4 недели, включение новорожденных, не подвергавшихся воздействию антибиотиков, оценка многих факторов, мешающих рождению, и изменений в кормлении с течением времени.

В заключение, наше исследование демонстрирует, что введенные штаммы B. breve могут достигать кишечника здоровых новорожденных, предотвращая функциональные желудочно-кишечные расстройства и снижая преждевременную прибавку в весе, по крайней мере, при отсутствии антибиотиков. О нежелательных явлениях не сообщалось, что свидетельствует о безопасности продукта в этой схеме. Перспективные продольные оценки должны быть полезны для дальнейшего изучения того, имеет ли преждевременное краткосрочное лечение в этом критическом окне преимущества в дальнейшей жизни.

Вклад авторов

DD и GB разработали и разработали исследование. EG и AS отвечали за набор пациентов и сбор клинических данных. IA и NB выполнили эксперименты по количественной ПЦР и внесли свой вклад в написание статьи. FP провела статистический анализ, интерпретировала результаты и способствовала написанию статьи. DD, SB, LB и FP критически отредактировали и одобрили окончательную рукопись. LM и MP разработали пробиотическую добавку.

Заявление о конфликте интересов

Авторы LM и MP были наняты компанией Biolab Research Srl, Новара, Италия, и выполняли все исследования и разработки для Probiotical SpA, Новара, Италия.Другие авторы заявляют, что исследование проводилось в отсутствие каких-либо коммерческих или финансовых отношений, которые могли бы быть истолкованы как потенциальный конфликт интересов.

Благодарности

Авторы выражают благодарность Роберте Рикотти, Элизабетте Мингоа, Эмануэле Монес, Франческе Арчеро и Мауро Заффарони за их техническую поддержку. Эта статья посвящена доктору Джованни Могна, который решительно поддержал описанное исследование.

Ссылки

1. Савино Ф, Пелле Э, Палумери Э, Оггеро Р., Миньеро Р. Lactobacillus reuteri (штамм 55730 американской коллекции типовых культур) по сравнению с симетиконом в лечении детских колик: проспективное рандомизированное исследование. Педиатрия (2007) 119: e124–30. 10.1542 / peds.2006-1222 [PubMed] [CrossRef] [Google Scholar] 2. Wessel MA, Cobb JC, Jackson EB, Harris GSJ, Detwiler AC. Приступы суеты в младенчестве, иногда называемые «коликами». Педиатрия (1954) 14: 421–35. [PubMed] [Google Scholar] 3. Zeevenhooven J, Koppen IJN, Benninga MA. Критерии Нового Рима IV для функциональных желудочно-кишечных расстройств у младенцев и детей ясельного возраста.Педиатр Гастроэнтерол Гепатол Нутр. (2017) 20: 1–13. 10.5223 / pghn.2017.20.1.1 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 4. Лукас А., Робертс ISJ. Плач, беспокойство и колики у младенцев, находящихся на грудном и искусственном вскармливании. Early Hum Dev. (1998) 53: 9–18. 10.1016 / S0378-3782 (98) 00032-2 [PubMed] [CrossRef] [Google Scholar] 5. Вик Т., Гроте В., Эскрибано Дж., Соха Дж., Вердучи Э., Фритч М. и др. . Детские колики, продолжительный плач и послеродовая депрессия у матери. Acta Paediatr. (2009) 98: 1344–8. 10.1111 / j.1651-2227.2009.01317.x [PubMed] [CrossRef] [Google Scholar] 6. Индрио Ф., Ди Мауро А., Риеццо Дж., Чиварди Е., Интини С., Корвалья Л. и др. . Профилактическое использование пробиотика для предотвращения колик, срыгивания и функциональных запоров - рандомизированное клиническое испытание. JAMA Pediatr. (2014) 168: 228–33. 10.1001 / jamapediatrics.2013.4367 [PubMed] [CrossRef] [Google Scholar] 7. Романелло С., Спири Д., Маркуцци Э., Занин А., Буазо П. и др. . Связь между детской мигренью и детской коликой в ​​анамнезе.JAMA J Am Med Assoc. (2013) 309: 1607–12. 10.1001 / jama.2013.747 [PubMed] [CrossRef] [Google Scholar] 8. Индрио Ф., Мауро А Ди, Риеццо Дж., Кавалло Л., Франкавилла Р. Детские колики, срыгивание и запор: ранний травматический инсульт в развитии функциональных желудочно-кишечных расстройств у детей? Eur J Pediatr. (2015) 174: 841–2. 10.1186 / 1824-7288-39-15 [PubMed] [CrossRef] [Google Scholar] 9. Бэнкс С., Томас М., Гордон М., Уоллес С., Акобенг А. Пробиотики для предотвращения детских колик. Кокрановская база данных Syst Rev.(2016) 12: 1–19. 10.1002 / 14651858.CD012473 [CrossRef] [Google Scholar] 10. Кандела М., Бьяджи Э., Маккаферри С., Туррони С., Бриджиди П. Микробиота кишечника - это пластический фактор, реагирующий на изменения окружающей среды. Trends Microbiol. (2012) 20: 385–91. 10.1016 / j.tim.2012.05.003 [PubMed] [CrossRef] [Google Scholar] 11. Секиров И., Рассел С.Л., Antunes LCM, Финлей ББ. Микробиота кишечника в здоровье и болезнях. Physiol Rev. (2010) 90: 859–904. 10.1152 / Physrev.00045.2009. [PubMed] [CrossRef] [Google Scholar] 12. Дюбуа NE, Грегори KE.Характеристика кишечного микробиома при детских коликах: результаты, основанные на интегративном обзоре литературы. Biol Res Nurs. (2016) 18: 307–15. 10.1177 / 10915620840 [PubMed] [CrossRef] [Google Scholar] 13. Lee SA, Lim JY, Kim B, Cho SJ, Kim NY, Bin Kim O, Kim Y. Сравнение профиля кишечной микробиоты у корейских младенцев, вскармливаемых грудью и вскармливаемыми смесями, с использованием пиросеквенирования. Nutr Res Pract. (2015) 9: 242–8. 10.4162 / nrp.2015.9.3.242 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 14. Маццола Дж., Мерфи К., Росс Р.П., Ди Джоя Д., Биавати Б.Ранние нарушения микробиоты кишечника после внутриродовой антибиотикопрофилактики для предотвращения стрептококковой инфекции группы B. PLoS ONE (2016) 11: e0157527. 10.1371 / journal.pone.0157527 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 15. Azad MB, Mph TK, Maughan H, Guttman DS, Field CJ, Chari RS и др. . Микробиота кишечника здоровых канадских младенцев: профили в зависимости от способа родов и питания младенцев в 4 месяца. CMAJ (2013) 185: 385–94. 10.1503 / cmaj.130147 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 16.Abrahamsson TR, Jakobsson HE, Andersson AF, Engstrand L, Jenmalm MC. Низкое разнообразие микробиоты кишечника у младенцев с атопической экземой. J Allergy Clin Immunol. (2005) 129: 434–40. 10.1016 / j.jaci.2011.10.025 [PubMed] [CrossRef] [Google Scholar] 17. Гуаральди Ф., Сальватори Г. Влияние грудного вскармливания и искусственного вскармливания на формирование кишечной микробиоты у новорожденных. Front Cell Infect Microbiol. (2012) 2:94. 10.3389 / fcimb.2012.00094 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 18. Савино Ф., Куартьери А., Де Марко А., Гарро М., Амаретти А., Раймонди С. и др.. Сравнение младенцев на искусственном вскармливании с коликами и без них выявило значительные различия в количестве бактерий, энтеробактерий и аммиака в фекалиях. Acta Paediatr. (2017) 106: 573–8. 10.1111 / apa.13642 [PubMed] [CrossRef] [Google Scholar] 19. Тейлор А.Л., Хейл Дж., Вильчут Дж., Леманн Х., Данстан Дж. А., Прескотт С.Л. Влияние пробиотических добавок в течение первых 6 месяцев жизни на аллергеноспецифичные иммунные реакции. Clin Exp Allergy (2006) 36: 1227–35. 10.1111 / j.1365-2222.2006.02553.x [PubMed] [CrossRef] [Google Scholar] 20.Ресслер А., Фридрих У., Фогельсанг Х., Бауэр А., Каатц М., Хиплер Калифорнийский университет и др. . Пробиотическое вмешательство, по-видимому, по-разному влияет на иммунную систему здоровых взрослых и пациентов с атопическим дерматитом. Clin Exp Allergy (2007) 38: 93–102. 10.1111 / j.1365-2222.2007.02876.x [PubMed] [CrossRef] [Google Scholar] 21. Szajewska H, ​​Gyrczuk E, Horvath A. Lactobacillus reuteri DSM 17938 для лечения младенческих колик у младенцев на грудном вскармливании: рандомизированное двойное слепое плацебо-контролируемое исследование.J Pediatr. (2013) 162: 257–62. 10.1016 / j.jpeds.2012.08.004 [PubMed] [CrossRef] [Google Scholar] 22. Чау К., Лау Е., Гринберг С., Якобсон С., Яздани-Брожени П., Верма Н. и др. . Пробиотики для лечения детских колик: рандомизированное двойное слепое плацебо-контролируемое исследование, изучающее Lactobacillus reuteri DSM 17938. J Pediatr. (2015) 166: 74–8.e1. 10.1016 / j.jpeds.2014.09.020 [PubMed] [CrossRef] [Google Scholar] 23. Савино Ф., Форнасеро С., Сератто С., Де Марко А., Мандрас Н., Роана Дж. И др. . Пробиотики и здоровье кишечника у младенцев: предварительное обсервационное исследование случай - контроль по раннему лечению с помощью Lactobacillus reuter i DSM 17938.Clin Chim Acta (2015) 451: 82–7. 10.1016 / j.cca.2015.02.027 [PubMed] [CrossRef] [Google Scholar] 24. Савино Ф., Кордиско Л., Тараско В., Локателли Е., Ди Джоя Д., Оггеро Р. и др. . Антагонистический эффект штаммов Lactobacillus против газообразующих колиформ, выделенных у младенцев, страдающих коликами. BMC Microbiol. (2011) 11: 157. 10.1186 / 1471-2180-11-157 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 25. Di Gioia D, Aloisio I, Mazzola G. Бифидобактерии: их влияние на состав микробиоты кишечника и их применение в качестве пробиотиков у младенцев.Appl Microbiol Biotechnol. (2014) 98: 563–77. 10.1007 / s00253-013-5405-9 [PubMed] [CrossRef] [Google Scholar] 26. Алоизио I, Сантини С., Биавати Б., Динелли Г., Ченчи А., Чингвару В. и др. . Характеристика Bifidobacterium spp. штаммы для лечения кишечных расстройств у новорожденных. Appl Microbiol Biotechnol. (2012) 96: 1561–76. 10.1007 / s00253-012-4138-5 [PubMed] [CrossRef] [Google Scholar] 27. Ли Й, Шимицу Т., Хосака А., Канеко Н., Оцука Ю., Ямаширо Ю. Влияние добавок Bifidobacterium breve на кишечную флору младенцев с низкой массой тела при рождении.Педиатрия Int. (2004) 46: 509–15. 10.1111 / j.1442-200x.2004.01953.x [PubMed] [CrossRef] [Google Scholar] 28. Вада М., Нагата С., Сайто М., Симидзу Т., Ямаширо Ю., Мацуки Т. и др. . Влияние энтерального введения Bifidobacterium breve на пациентов, проходящих химиотерапию по поводу детских злокачественных новообразований. Поддержите лечение рака (2010) 18: 751–9. 10.1007 / s00520-009-0711-6 [PubMed] [CrossRef] [Google Scholar] 29. Костелое К., Харди П., Ющак Э., Вилкс М., Миллар М.Р. Bifidobacterium breve BBG-001 у очень недоношенных новорожденных: рандомизированное контролируемое исследование фазы 3.Ланцет (2016) 387: 649–60. 10.1016 / s0140-6736 (15) 01027-2 [PubMed] [CrossRef] [Google Scholar] 30. Патоле С.К., Рао С.К., Кейл А.Д., Натан Э.А., Доэрти Д.А., Симмер К.Н. Преимущества добавки Bifidobacterium breve M-16V у недоношенных новорожденных - ретроспективное когортное исследование. PLoS ONE (2016) 11: e0150775. 10.1371 / journal.pone.0150775 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 31. Могна Л., Дель Пиано М., Могна Г. Способность двух микроорганизмов Bifidobacterium breve B632 и Bifidobacterium breve BR03 колонизировать кишечную микробиоту детей.J Clin Gastroenterol. (2014) 48: S37–9. 10.1097 / MCG.0000000000000234 [PubMed] [CrossRef] [Google Scholar] 32. Simone M, Gozzoli C, Quartieri A, Mazzola G, Di Gioia D, Amaretti A и др. . Пробиотик Bifidobacterium breve B632 Подавлял рост Enterobacteriaceae в культурах детской микробиоты, пораженной коликами. Biomed Res Int. (2014) 2014: 1–7. 10.1155 / 2014/301053 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 33. Quagliariello A, Aloisio I, Bozzi Cionci N, Luiselli D, Auria GD, Martinez-priego L, et al.. Влияние > Bifidobacterium breve на микробиоту кишечника детей с глютеновой диете на безглютеновой диете: пилотное исследование. Питательные вещества (2016) 8: 660–76. 10.3390 / nu8100660 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 34. Малинен Э., Кассинен А., Ринттила Т., Палва А. Сравнение ПЦР в реальном времени с анализами SYBR Green I или 5 9-нуклеаз и дот-блот-гибридизацией с олигонуклеотидными зондами, нацеленными на рДНК, при количественной оценке выбранных фекальных бактерий. Микробиология (2003) 149: 269–77.10.1099 / mic.0.25975-0 [PubMed] [CrossRef] [Google Scholar] 35. Пендерс Дж., Винк С., Дриссен К., Лондон Н., Тийс С., Стобберинг Э. Количественная оценка Bifidobacterium spp., Escherichia coli и Clostridium difficile в образцах фекалий младенцев, вскармливаемых грудью и вскармливаемых смесями, с помощью ПЦР в реальном времени. FEMS Microbiol Lett. (2005) 243: 141–7. 10.1016 / j.femsle.2004.11.052 [PubMed] [CrossRef] [Google Scholar] 36. Ринттила Т., Кассинен А., Малинен Э., Крогиус Л., Палва А. Разработка обширного набора праймеров, нацеленных на 16S рДНК, для количественной оценки патогенных и аборигенных бактерий в образцах фекалий с помощью ПЦР в реальном времени.J Appl Microbiol. (2004) 97: 1166–77. 10.1111 / j.1365-2672.2004.02409.x [PubMed] [CrossRef] [Google Scholar] 37. Кастильо М., Мартин-Оруэ С.М., Мансанилла Э.Г., Бадиола И., Мартин М., Гаса Дж. Количественная оценка общего количества бактерий, энтеробактерий и лактобактерий в пищеварительном тракте свиней с помощью ПЦР в реальном времени. Vet Microbiol. (2006) 114: 165–70. 10.1016 / j.vetmic.2005.11.055 [PubMed] [CrossRef] [Google Scholar] 38. Пендерс Дж., Тийс С., Винк С., Стелма Ф.Ф., Снидерс Б., Куммелинг И., ван ден Брандт П.А., Стобберинг Э. Факторы, влияющие на состав кишечной микробиоты в раннем детстве.Педиатрия (2006) 118: 511–21. 10.1542 / peds.2005-2824 [PubMed] [CrossRef] [Google Scholar] 39. Хаарман М., Кнол Дж. Количественные ПЦР-анализы в реальном времени для идентификации и количественного определения фекальных видов Bifidobacterium у младенцев, получающих пребиотическую смесь для грудных детей. Appl Environ Microbiol. (2005) 71: 2318–24. 10.1128 / AEM.71.5.2318-2324.2005 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 40. Leser TD, Amenuvor JZ, Jensen TK, Lindecrona RH, Boye M, Møller K. Независимый от культуры анализ кишечных бактерий: повторный визит микробиоты желудочно-кишечного тракта свиней.Appl Environ Microbiol. (2002) 68: 673–90. 10.1128 / AEM.68.2.673 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 41. Барр Р.Г., Крамер М.С., Буашоли К., Маквей-Уайт Л., Плесс И.Б. родительский дневник детского крика и суетливого поведения. Arch Dis Childh. (1988) 63: 380–7. 10.1136 / adc.63.4.380 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 42. Переулок М.М., Чижевский Д.И., Мпч БПК, Шульман Р.Дж. Надежность и валидность модифицированной бристольной шкалы формы стула для детей. J Pediatr. (2011) 159: 437–41.e1. 10.1016 / j.jpeds.2011.03.002 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 43. Aloisio I, Mazzola G, Corvaglia LT, Tonti G, Faldella G, Biavati B и др. . Влияние антибиотикопрофилактики во время родов против Streptococcus группы B на ранний состав кишечника новорожденных и оценка антистрептококковой активности штаммов Bifidobacterium . Appl Microbiol Biotechnol. (2014) 98: 6051–60. 10.1007 / s00253-014-5712-9 [PubMed] [CrossRef] [Google Scholar] 44. Альтшул С.Ф., Гиш В., Миллер В., Майерс Е. В., Липман Д. Д..Базовый инструмент поиска локального выравнивания. J Mol Biol. (1990) 215: 403–10. 10.1016 / S0022-2836 (05) 80360-2 [PubMed] [CrossRef] [Google Scholar] 45. Ли ZMP, Bussema C, Schmidt TM. rrn DB: Документирование количества генов рРНК и тРНК у бактерий и архей. Nucleic Acids Res. (2009) 37: 489–93. 10.1093 / nar / gkn689 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 46. Индрио Ф., Мартини С., Франкавилла Р., Корвалья Л., Кристофори Ф., Мартини С. Эпигенетические вопросы: связь между ранним питанием, микробиомом и долгосрочным развитием здоровья.Фронт Педиатр. (2017) 5: 178. 10.3389 / fped.2017.00178 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 47. Лиепке С., Адерманн К., Райда М., Магерт Х.-Дж., Форссманн В., Цухт HD. Грудное молоко содержит пептиды, которые сильно стимулируют рост бифидобактерий. Eur J Biochem. (2002) 269: 712–8. 10.1046 / j.0014-2956.2001.02712.x [PubMed] [CrossRef] [Google Scholar] 48. Обермайер Т., Грабнар И., Бенедик Э., Тушар Т., Пикель Т.Р., Мис Н.Ф., Матияшич Б.Б., Рогель И. Микробы в развитии кишечника младенца: определение изобилия в параметрах окружающей среды, клинических условиях и росте.Научный доклад (2017) 7: 11230. 10.1038 / s41598-017-10244-x [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 50. Фавье К.Ф., Воан Э.Э., Де Вос В.М., Аккерманс АДЛ. Молекулярный мониторинг сукцессии бактериальных сообществ у новорожденных человека. Общество (2002) 68: 219–26. 10.1128 / AEM.68.1.219 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 51. Макфадден А., Гэвин А., Ренфрю М., Уэйд А., Бьюкенен П., Тейлор Дж. И др. . Поддержка здоровых кормящих матерей со здоровыми доношенными детьми. Кокрановская база данных Syst Rev.(2017) 2: 1-224. 10.1002 / 14651858.CD001141 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 52. Гарсиа Маркес С., Чильон Мартинес Р., Гонсалес Сапата С., Реболло Салас М., Хименес Реджано Х. Дж. Инструменты оценки и диагностики детских колик: систематический обзор. Child Care Health Dev. (2017) 43: 481–8. 10.1111 / cch.12454 [PubMed] [CrossRef] [Google Scholar] 53. Сюй М., Ван Дж., Ван Н., Сунь Ф., Ван Л., Лю X. Эффективность и безопасность пробиотической бактерии Lactobacillus reuteri DSM 17938 для младенческой колики: метаанализ рандомизированных контролируемых испытаний.PLoS ONE (2015) 10: 1–16. 10.1371 / journal.pone.0141445 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 54. Магне Ф., Пучи Силва А., Каравахал Б., Готтеланд М. Повышенная частота кесарева сечения и его вклад в неинфекционные хронические заболевания в Латинской Америке: растущее участие микробиоты. Фронт Педиатр. (2017) 5: 192. 10.3389 / fped.2017.00192 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 55. Kuhle S, Тонг OS, Woolcott CG. Связь детского ожирения и беременности между кесаревым сечением и детским ожирением: систематический обзор и метаанализ.Obes Rev. (2015) 16: 295–303. 10.1111 / obr.12267 [PubMed] [CrossRef] [Google Scholar] 56. Де Моура Э. Г., Лиссабон, ПК, Пассос, MCF. Неонатальное программирование нейроиммуномодуляции - роль адипоцитокинов и нейропептидов. Нейроиммуномодуляция (2008) 15: 176–88. 10.1159 / 000153422 [PubMed] [CrossRef] [Google Scholar] 58. Baldassarre ME, Di Mauro A, Mastromarino P, Fanelli M, Martinelli D, Urbano F и др. . Назначение женщинам в перинатальном периоде мультиштаммового пробиотического продукта по-разному влияет на цитокиновый профиль грудного молока и может оказывать благотворное влияние на функциональные симптомы желудочно-кишечного тракта новорожденных.рандомизированное клиническое испытание. Питательные вещества (2016) 8: 1–13. 10.3390 / nu8110677 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 59. Härtel C, Pagel J, Spiegler J, Buma J, Henneke P, Viemann D, et al. . Lactobacillus acidophilus / Bifidobacterium infantis пробиотики связаны с повышенным ростом VLBWI среди тех, кто подвергается воздействию антибиотиков. Sci Rep. (2017) 7: 1–11. 10.1038 / s41598-017-06161-8 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]

Интеграция трехмесячного кормления со штаммами бифидобактерий предотвращает желудочно-кишечные симптомы у здоровых новорожденных

, 1, , 2, 3, , 2 , 1 , 2 , 2, 3 , 1 , 4 , 4 , 2 , *

Ирен Алоизио

1 Кафедра сельскохозяйственных и пищевых наук, Болонский университет, Болонья, Италия

Флавия Продам

2 Кафедра медицинских наук, Università degli Studi del Piemonte Orientale, Новара, Италия

3 Междисциплинарный исследовательский центр аутоиммунных заболеваний (IRCAD), Università degli Studi del Piemonte Orientale, Новара, Италия

Enza Giglione

2 Департамент медицинских наук, университеты ità degli Studi del Piemonte Orientale, Новара, Италия

Николь Боцци Чиончи

1 Кафедра сельскохозяйственных и пищевых наук, Болонский университет, Болонья, Италия

Арианна Солито

2 Департамент медицинских наук, Università degli Studi del Piemonte Orientale, Новара, Италия

Симонетта Беллоне

2 Департамент медицинских наук, Università degli Studi del Piemonte Orientale, Новара, Италия

3 Междисциплинарный исследовательский центр изучения аутоиммунных заболеваний (IRCAD), Университет del Piemonte Orientale, Новара, Италия

Лоредана Баффони

1 Кафедра сельскохозяйственных и пищевых наук Болонского университета, Болонья, Италия

Лука Могна

4 Biolab Reserach, Новара, Италия

Марко Пане

4 Biolab Reserach, Новара, Италия

Джанни Бона

2 Департамент медицинских наук, Università degli Studi del Piemonte Orientale, Новара, Италия

Diana Di Gioia

1 Департамент сельскохозяйственных и пищевых наук Болонского университета, Болонья, Италия

1 Департамент сельского хозяйства и пищевых наук, Болонский университет, Болонья, Италия

2 Департамент медицинских наук, Università degli Studi del Piemonte Orientale, Новара, Италия

3 Междисциплинарный исследовательский центр аутоиммунных заболеваний (IRCAD), Università degli Studi del Piemonte Orientale, Новара, Италия

4 Biolab Reserach, Новара, Италия

Редактор: Надия В.Бойко, Ужгородский национальный университет, Украина

Рецензент: Брайан Д. Пикколо, Центр детского питания Арканзаса, США; Ирена Рогель, биотехнический факультет, Университет Любляны, Словения

Эта статья была отправлена ​​в раздел «Пищевая микробиология» журнала «Границы питания»

† Эти авторы внесли равный вклад в эту работу.

Поступило 30.11.2017 г .; Принято 23 апреля 2018 г..

Copyright © 2018 Алоизио, Продам, Джильоне, Боцци Чиончи, Солито, Беллоне, Баффони, Могна, Пане, Бона и Ди Джоя.

Это статья в открытом доступе, распространяемая в соответствии с условиями лицензии Creative Commons Attribution License (CC BY). Использование, распространение или воспроизведение на других форумах разрешено при условии указания автора (авторов) и правообладателя и ссылки на оригинальную публикацию в этом журнале в соответствии с принятой академической практикой. Запрещается использование, распространение или воспроизведение без соблюдения этих условий.

Эта статья цитируется в других статьях в PMC.

Abstract

Инфантильные функциональные расстройства желудочно-кишечного тракта распространены в первые месяцы жизни. Их патогенез остается неизвестным, хотя данные свидетельствуют о множестве независимых причин, включая модификации кишечной микробиоты. Тип питания, влияющий на состав кишечной микробиоты, может играть значительную роль в патогенезе. Предыдущие исследования подтвердили успех применения пробиотических добавок против колик, но в основном это были Lactobacillus spp. были протестированы.Целью этого исследования было оценить эффективность против функциональных желудочно-кишечных расстройств пробиотического состава на основе Bifidobacterium breve , включая в исследование субъектов как на грудном, так и на искусственном вскармливании. Двести шестьдесят восемь новорожденных были включены в исследование в течение 15 дней с момента рождения. Сто пятьдесят пять из них эффективно вошли в исследование и были рандомизированы в группы пробиотиков и плацебо, получавших состав в течение 90 дней. Состав пробиотика состоит из смеси 1: 1 2 штаммов B.breve готовят в виде масляной суспензии и вводят в суточной дозе 5 капель, содержащих 10 8 КОЕ каждого штамма. Абсолютное количественное определение выбранных микробных групп в фекалиях проводили с помощью КПЦР. До и после лечения оценивались антропометрические данные, ежедневные дневниковые минуты плача, количество срыгиваний, рвот и отказов, цвет и консистенция стула. Исследование подтвердило положительную роль грудного молока в влиянии на количество целевых микробных групп, в частности, сообщества бифидобактерий.Не сообщалось о побочных эффектах при введении пробиотиков, что свидетельствует о безопасности продукта в этой схеме. B. breve Количество значительно увеличилось у всех новорожденных, которым вводили вакцину ( p <0,02). Исследование демонстрирует, что трехмесячное лечение штаммами B. breve у здоровых новорожденных, находящихся на грудном вскармливании, помогает предотвратить функциональные желудочно-кишечные расстройства, в частности, снижает на 56% ежедневную частоту рвоты ( p <0,03), уменьшая 46,5% дневной нормы. эвакуация с течением времени ( p <0.03) и улучшение консистенции стула (тип 6 в таблице стула Бристоля вместо типа 5) у доношенных ( p <0,0001). Более того, наблюдалось значительное снижение (8,65 против 7,98 LogCFU / г фекалий, p <0,03) B. fragilis в группе кормления из бутылочки, получавшей пробиотический состав.

Ключевые слова: пробиотик, Bifidobacterium breve , детские колики, функциональные желудочно-кишечные расстройства, грудное вскармливание, кормление из бутылочки, микробиота

Введение

Детские колики - распространенное заболевание в первые 3 месяца детства, которое поражает до 30 лет. % новорожденных и характеризуется приступообразным, чрезмерным, неконтролируемым плачем без идентифицируемых причин (1).Wessel et al. (2) дал первое определение этого расстройства как состояние плача или беспокойства, которое длится более 3 часов в день, более 3 дней в неделю. Для клинических целей консенсусная группа Рима IV (3) недавно пересмотрела диагностические критерии, включая возраст новорожденного (<5 месяцев), придав меньшее значение продолжительности плача, учитывая длительный и неотразимый характер эпизодов плача. как раздражительность, которую не могут предотвратить или устранить лица, осуществляющие уход.Симптомы, такие как покраснение лица, метеоризм, сгибание бедер и метеоризм, начинаются на второй неделе жизни как у детей, находящихся на грудном вскармливании, так и у детей, вскармливаемых смесями, и обычно проходят спонтанно со временем (4).

Младенческие колики представляют собой серьезную проблему для семьи, потому что лица, осуществляющие уход, сталкиваются с трудностями в преодолении этих неконтролируемых кризисов, часто приводящих к стрессу и беспокойству; проспективное европейское многоцентровое исследование, проведенное Vik et al. (5) показали, что детские колики и продолжительный плач связаны с высокими показателями материнской депрессии.Точно так же срыгивание, рвота и запор часто требуют посещения педиатра в течение первых 6 месяцев жизни и часто являются причиной смены кормления и использования медицинских методов лечения (6, 7). Более того, наличие колик на раннем этапе жизни было связано с несколькими последствиями: у детей с коликами в анамнезе выше частота функциональных желудочно-кишечных расстройств в более позднем возрасте (8), а у детей с мигренью чаще возникают младенческие колики. чем у людей без мигрени (7).Таким образом, предусмотрена эффективная профилактическая стратегия против функциональных желудочно-кишечных расстройств.

Несмотря на 40 лет исследований, этиология колических кризов и других функциональных желудочно-кишечных расстройств до конца не выяснена. Было высказано предположение, что ряд поведенческих факторов (психологических и социальных), факторов питания (пищевая гиперчувствительность или аллергия), нарушение моторики кишечника и слабое воспаление кишечника могут способствовать его возникновению (6, 9). Неудивительно, что, будучи типичным заболеванием желудочно-кишечного тракта, дисбаланс в составе микробиоты кишечника играет роль в патогенезе этих состояний.Микробиота кишечника очень тесно связана с хозяином, что способствует нормальной физиологии человека: она может служить барьером для колонизации патогенов, синтезировать витамины и другие полезные соединения и стимулировать иммунную систему (10). Неонатальный период является решающим этапом для колонизации желудочно-кишечного тракта, сбалансированного состава кишечной микробиоты, что положительно влияет на здоровье хозяина (11). Младенцы с коликами имеют меньшее фекально-бактериальное разнообразие и стабильность по сравнению со здоровыми.Они также показывают более высокую распространенность грамотрицательных бактерий, особенно колиформ, и меньшее количество полезных бактерий, таких как лактобациллы и бифидобактерии (12).

Диета играет доминирующую роль в формировании микробиоты кишечника, поэтому тип кормления новорожденных оказывает определенное влияние на оценку микробных групп кишечника. Заметные различия показали Lee et al. (13): Актинобактерии были преобладающим филумом у новорожденных, находящихся на грудном вскармливании, за ними следовали Firmicutes и Proteobacteria; Напротив, у младенцев, вскармливаемых смесью, пропорции Actinobacteria и Firmicutes были одинаковыми, за ними следовали Proteobacteria.Кроме того, микробиота кишечника детей, находящихся на искусственном вскармливании, содержит значительное количество родов Escherichia, Veillonella, Enterococcus и Enterobacter , тогда как содержание Lactobacillus было низким. В той же работе сообщается, что основным родом младенцев, вскармливаемых грудью и искусственными смесями, является Bifidobacterium , но эта пропорция значительно выше у младенцев, вскармливаемых грудью. Исследование Mazzola et al. (14) также показали снижение содержания Bifidobacterium spp.у детей, находящихся на смешанном вскармливании (вскармливаемых не менее 50% молочной смеси), по сравнению с грудным вскармливанием. Напротив, дифференциальная представленность рода Bifidobacterium не была обнаружена у младенцев, находящихся на грудном вскармливании, по сравнению с детьми, вскармливаемыми смесью, хотя различия в микробиоте кишечника наблюдались в двух группах (15). Более того, эти исследования выявили более низкое бактериальное богатство и разнообразие на грудном вскармливании, вероятно, из-за наличия уникальных олигосахаридов в грудном молоке, которые служат селективными метаболическими субстратами для ограниченного числа кишечных микробов (16).

Тип питания, влияющий на состав кишечной микробиоты, может играть значительную роль в патогенезе детских колик, хотя после первого года жизни эти различия теряются (17). Недавнее исследование, сфокусированное на младенцах, вскармливаемых смесями и не страдающих коликами, проведенное с использованием FISH в качестве метода подсчета бактерий, выявило более низкую концентрацию общих бактерий и более высокое содержание энтеробактерий у детей, вскармливаемых смесями (18).

Несколько исследований поддерживают использование пробиотиков в качестве терапевтических или профилактических средств против различных заболеваний, в частности кишечных расстройств, а также патологий человека, которые явно не связаны с микробным составом кишечника, таких как аллергии и аутоиммунные заболевания (19, 20).Лечение пробиотиками, благотворное влияние которых на нарушения микробиоты кишечника и на здоровье человека хорошо известно, может иметь защитный эффект от желудочно-кишечных расстройств, включая колики, и уменьшать связанные с ними симптомы, что приводит к правильной микробной колонизации в раннем младенчестве, когда микробиота все еще находится в стадии адаптации.

Многие исследования были сосредоточены на введении Lactobacillus reuteri DSM 17938 в качестве пробиотика для профилактики или уменьшения симптомов функциональных желудочно-кишечных расстройств, включая колики, срыгивание, рвоту и запор, с успешными результатами (6, 21, 22).В частности, Savino et al. (23) показали меньшее количество анаэробных грамотрицательных бактерий, энтеробактерий и энтерококков у новорожденных с коликами, которые получали L. reuteri , по сравнению с детьми, не получавшими лечения. Однако другие виды Lactobacillus , такие как L. delbrueckii subsp. delbruekii DSM 20074 и L. plantarum MB 456 продемонстрировали ингибирующую активность в отношении газообразующих колиформных бактерий и могут быть использованы при лечении детских колик (24).Иными словами, применение бифидобактерий для лечения этих кишечных расстройств остается малоизученным, хотя их роль в здоровой микробиоте кишечника новорожденных была продемонстрирована в обзоре Di Gioia et al. (25). Предыдущее исследование in vitro описало способность некоторых штаммов, принадлежащих к роду Bifidobacterium , включая штаммы Bifidobacterium breve , ингибировать in vitro рост патогенов, типичных для желудочно-кишечного тракта младенцев, включая колиформ, выделенных из новорожденных с коликозной болезнью. 26).Другие исследования продемонстрировали эффективность штамма B. breve для лечения различных детских заболеваний: Li et al. (27) показали полезность в содействии колонизации B. breve и формированию нормальной кишечной биоты у младенцев с низкой массой тела при рождении, Wada et al. (28) описали положительные эффекты этого вида у детей с ослабленным иммунитетом при химиотерапии. Более того, недавние исследования доказали эффективность B. breve для снижения риска некротического энтероколита у недоношенных детей (29, 30).Кроме того, два штамма B. breve, , B632 и BR03 были исследованы на предмет их способности колонизировать кишечник человека, стимулировать иммунный ответ, конкурировать с патогенами, а также были продемонстрированы их оценки безопасности (26, 31, 32). Недавнее исследование также показало способность этих штаммов B. breve , используемых в качестве пробиотиков для детей с глютеновой болезнью, действовать в качестве «пускового» элемента для увеличения других полезных бактериальных родов или типов, таких как Firmicutes (33).

Целью данного исследования было описать эффективность пробиотической композиции на основе B. breve , вводимой новорожденным как на грудном вскармливании, так и на искусственном вскармливании, в: 1) изменении количества целевых групп фекальных микробов; 2) профилактика колик и функциональных желудочно-кишечных расстройств в когорте здоровых новорожденных.

Материалы и методы

Дизайн исследования и сбор образцов

Это было двойное слепое рандомизированное плацебо-контролируемое клиническое испытание ({"type": "клиническое испытание", "attrs": {"text": " NCT03219931 "," term_id ":" NCT03219931 "}} NCT03219931) одобрено этическим комитетом больницы Маджоре делла Карита (CE 63/13).Новорожденные были зачислены в отделение педиатрии факультета медицинских наук Восточного университета Пьемонта им. Авогадро »в период с ноября 2013 г. по сентябрь 2016 г. Новорожденных набирали при рождении и регистрировали в течение 15 дней с момента рождения во время первого посещения (T0). Информированное согласие было получено родителями при зачислении в соответствии с критериями местного этического комитета и критериями Хельсинки. Пациентов попросили выполнить второй визит (Т1) через 90 дней лечения. Число новорожденных, оцененных на соответствие критериям [268], рандомизированных [155] и отнесенных к группе плацебо или пробиотиков, показано на рисунке.Их набирали, если они были здоровы в течение 15 дней после рождения и родились адекватно гестационному возрасту. Критерии исключения: 1) новорожденные-близнецы; 2) лечение любым лекарственным препаратом в рамках набора; 3) лечение пробиотиками; 4) курящие матери; 5) семейный анамнез врожденных заболеваний; 6) длительная желтуха в анамнезе. Матери не рекомендовали никаких особых диетических ограничений во время кормления грудью, за исключением других продуктов, содержащих пробиотики. Пациенты были рандомизированы с использованием компьютерной последовательности распределения в группы плацебо или пробиотиков (1: 1).Персонал исследования и родители были замаскированы для распределения группы исследования. Первоначальная идея исследования заключалась в том, чтобы набрать равное количество новорожденных, находящихся на грудном вскармливании и на искусственном вскармливании, но, учитывая трудности с набором новорожденных, находящихся на искусственном вскармливании, мы решили продолжить с другим количеством новорожденных, принадлежащих к этим двум группы (рисунок).

Группа пробиотиков получала коммерческий пробиотический состав Bifibaby® (Probiotical S.p.A., Новара, Италия), содержащий B. breve в течение 90 дней (T1), а группа плацебо получала состав плацебо на тот же период.Состав пробиотика представлял собой смесь 1: 1 из 2 штаммов, B. breve BR03 (DSM 16604) и B. breve B632 (DSM 24706), приготовленных в масляной суспензии, вводимой в суточной дозе 5 капель, содержащих 10 . 8 КОЕ каждого штамма. Плацебо готовили с теми же эксципиентами без пробиотических штаммов с использованием идентичной формы упаковки.

Клинический мониторинг

Данные о родах были собраны во время первого посещения. Антропометрические данные (вес, рост, окружность головы) и информация о типе кормления собирались как при первом (T0), так и во втором посещении (T1).

Родителей попросили записывать в ежедневный дневник минуты безутешного плача в соответствии с утвержденной анкетой (41). Они также регистрировали ежедневное количество срыгиваний, рвот и опорожнений, а также цвет и консистенцию стула. Бристольская шкала формы стула для детей была передана родителям (42). Колики диагностировали согласно группе консенсуса Рима IV (3).

Родителей также попросили сообщать о любых побочных эффектах (в частности, запорах, рвоте, аллергических реакциях, заболеваниях), лечении, количестве и типах инфекций или боли в животе, имевших место в течение испытательного периода.Соблюдение режима лечения контролировалось телефонными звонками раз в две недели, подсчетом пустых флаконов и ежедневной проверкой молочных заводов.

Сбор образцов кала

Образцы фекалий новорожденных собирали дважды: при зачислении (T0) и в конце вмешательства с пробиотиком / плацебо (T1). Таким образом, проанализированы группы: пробиотик T0, плацебо T0, пробиотик T1, плацебо T1. Образцы фекалий замораживали сразу после сбора при -80 ° C в пронумерованных пластиковых контейнерах с завинчивающейся крышкой, пока они не были обработаны для выделения ДНК.Исследователи, выполняющие экстракцию ДНК и молекулярные анализы (кПЦР), не знали о групповой принадлежности пациентов (группа пробиотиков или плацебо).

Экстракция ДНК из образцов фекалий

ДНК была извлечена из 200 мг фекалий (сохраненных при -80 ° C после сбора) с использованием набора QIAamp DNA Stool Mini (Qiagen, West Sussex, UK) с небольшой модификацией стандартного протокола : дополнительная инкубация при 95 ° C в течение 10 мин образца стула с буфером для лизиса была добавлена ​​для усиления разрыва бактериальных клеток (43).Экстрагированную ДНК хранили при -80 ° C. Чистоту ДНК определяли путем измерения отношения оптической плотности при 260 и 280 нм (Infinite®200 PRO NanoQuant, Tecan, Mannedorf, Швейцария), а концентрацию оценивали с помощью флуорометра Qubit® 3.0 (Invitrogen, Life Technologies, CA, США). ).

Абсолютная количественная оценка выбранных микробных групп с помощью количественной ПЦР (qPCR)

Количественная оценка выбранных микробных групп или видов, обычно отслеживаемых в исследованиях, относящихся к младенцам (38, 43), т.е.е., Bidobacterium spp., Lactobacillus spp., Группа Bacteroides fragilis (включающая наиболее распространенные виды у человека B. fragilis, B. distasonis, B. ovatus, B. thetaiotaomicron, B. vulgatus ) , B. breve, Clostridium difficile, Escherichia coli и общее количество энтеробактерий выполняли с помощью ПЦР в реальном времени на ДНК, выделенной из образцов стула. Анализы проводили с 20 мкл смеси для ПЦР-амплификации, содержащей 10 мкл Fast SYBR® Green Master Mix (Applied Biosystems, Foster city, CA, USA) с оптимизированными концентрациями праймеров (Таблицы), молекулярной степени чистоты H 2 O и 2 мкл ДНК, полученной из проб фекалий в концентрации 2.5 нг / мкл. B. breve анализ выполняли с использованием анализа TaqMan, содержащего 12,5 мкл мастер-микса Universal TaqMan (Applied Biosystems, Foster city, CA, USA), 300 нМ каждого праймера и 100 нМ зонда, меченного 5'-репортерным красителем 6- карбоксифлуоресцеин и 3'-гаситель NFQ-MGB (Applied Biosystems, Nieuwerkerk a / d IJssel, Нидерланды). Число циклов ПЦР составляло 40.

Таблица 1

Последовательности праймеров и условия кПЦР, использованные в различных анализах.

difficile

Микроорганизм-мишень Праймер Последовательность (5'-3 ') Длина ампликона (п.о.) col13 col13 1

Eco-F GTTAATACCTTTGCTCATTGA 340 (34)
Eco-R ACCAGGGTATCTAATCCTGTT Cdiff-F TTGAGCGATTTACTTCGGTAAAGA 114 (35)
Cdiff-R TGTACTG16CTCAC329 903 903 ATTACTG163CTCACCTTTG 903 Bif-F TCGCGTCYGGTGTGAAAG 243 (36)
Bif-R CCACATCCAGCRTCCAC Лак-F GCAGCAGTAGGGAATCTTCCA 349 (37)
Лак-R GCATTYCACCGCTACACATG
Bacteroides ломкая группа Bfra-F CGGAGGATCCGAGCGTTA 92 (38)
Bfra-R CCGCAAACTTTCACAACTGACTTA
B.BREVE F _IS GTGGTGGCTTGAGAACTGGAT А.Г. 118 (39)
R_IS CAAAACGATCGAAACAAACACTAAA
P_IS TGATTCCTCGTTCTTGCTGT
Энтеробактерии Ent-F ATGGCTGTCGTCAGCTCGT 385 (40)
Ent-R CCTACTTCTTTTGCAACCCACTC CCTACTTCTTTTGCAACCCACTC Протоколы

9028 45 Лактобациллы виды .
Целевые бактерии Начальная денатурация Денатурация Отжиг Н.циклы

9029 9029 nM
E. coli
Eco-F / Eco-R 95 ° C - 20 с 95 ° C - 3 с 60 ° C - 30 с 40 400 400
С.difficile
Cdiff-F / Cdiff-R 95 ° C - 20 с 95 ° C - 3 с 60 ° C - 30 с 40 250 250
Бифидобактерии виды .
BifTOT-F / BifTOT-R 95 ° C - 20 с 95 ° C - 3 с 60 ° C - 35 с 40 200 300
Lac-F / Lac-R 95 ° C - 20 с 95 ° C - 3 с 63,5 ° C - 30 с 40 200 200

Концентрации праймеров были оптимизированы с помощью матриц оптимизации праймеров в 48-луночном планшете и оценки наилучшего отношения Ct / ΔRn. Различные праймеры также были проверены на их специфичность с использованием программы поиска сходства нуклеотидов-нуклеотидов в базе данных BLAST (44). Кроме того, для оценки специфичности амплификации анализ кривой плавления продукта проводили после последнего цикла каждой амплификации.Затем данные, полученные в результате амплификации, были преобразованы для получения количества бактериальных клеток (Log КОЕ / г фекалий) в соответствии с количеством копий рРНК, доступным в базе данных количества копий рРНК (45). Стандартные кривые были построены с использованием продуктов ПЦР 16S рРНК типовых штаммов каждого микроорганизма-мишени; использовались стандартные микроорганизмы: B. breve ReO2, Lactobacillus plantarum ATCC 14917, B. fragilis DSM 2151, B. breve B632 DSM 20213, Clostridium sporogenes ATCC 319, coli ATCC 8739. Продукты ПЦР очищали с помощью коммерческой системы очистки ДНК (набор NucleoSpin® Extract II, MACHEREY-NAGEL GmbH & Co. KG, Германия) и концентрацию измеряли спектрофотометрически при 260 нм. Были выполнены серийные разведения, и для калибровки использовали 10 2 , 10 3 , 10 4 , 10 5 , 10 6 , 10 7 копий гена на реакцию. Реакции с образцами проводили трижды, с отрицательным контролем для каждой реакции.

Статистический анализ

Данные выражены как среднее ± стандартное отклонение. Перекошенные переменные были преобразованы в журнал. Ежедневные данные были разделены на 9 категорий, представляющих среднее значение за 10 последовательных дней (от 0 до 90 дней).

Согласно первичному результату, выборка из 58 человек в группе была оценена как достаточная, чтобы продемонстрировать разницу между плацебо и пробиотиками в 0,70 Log КОЕ / г бифидобактерий со стандартным отклонением 1,6, степенью 90% и уровень значимости 95% и процент выбывания 20% согласно опубликованным данным, уже имеющимся во время разработки протокола (32).Согласно вторичному результату выборка из 55 человек в группе была оценена достаточной для снижения на 30% доли желудочно-кишечных расстройств (колики, срыгивание, рвота, запор) с предполагаемой распространенностью 40%, согласно данным литературы (1, 6).

Данные подсчета микробов были подвергнуты тесту Шапиро и тесту Бартлетта для проверки нормального распределения данных и однородности дисперсий. Базовые характеристики сравнивались с точным критерием Фишера для категориальных переменных и двухвыборочным тестом t или тестом Велча t , когда это необходимо для непрерывных переменных.Двухфакторный повторный анализ ANOVA был выполнен для оценки временного эффекта, лечебного эффекта и эффектов взаимодействия (модель 1) на зависимые переменные (минуты плача, характеристики стула, эпизоды рвоты и срыгивания, количество микробов). Использовалась сумма квадратов III типа. Впоследствии были введены следующие ковариаты: пол, тип родов (вагинальные, кесарево, оперативные), антибиотикопрофилактика во время родов (IAP), гестационный возраст, вес новорожденного (модель 2). Модель 3 также включала тип кормления в течение 90 дней (грудное вскармливание, искусственное вскармливание, смешанное вскармливание).Кроме того, в модели 2 и 3 вес, длина и окружность головы также были скорректированы с учетом соответствующей переменной при рождении. Все статистические анализы были выполнены с использованием статистического программного обеспечения R и SPSS для Windows версии 17.0 (SPSS Inc., Чикаго, Иллинойс, США).

Результаты

Исходные характеристики включенных новорожденных

При рождении 268 новорожденных были оценены на соответствие критериям, и их родители приняли участие в исследовании. Сто десять не вошли в исследование, потому что не явились на прием (46), отказались от исследования в тот же день (47) или были исключены из-за лечения антибиотиками после рождения (5).158 субъектов были случайным образом распределены в группу плацебо или пробиотиков. Три из них были потеряны при последующем наблюдении и были исключены (рисунок). Из 155 новорожденных, включенных в протокол, 130 находились на грудном вскармливании (59 плацебо, 71 пробиотик) и 25 находились на искусственном вскармливании (14 плацебо, 11 пробиотиков). Восемьдесят один мужчина и 74 женщины. Кроме того, 139 новорожденных родились вагинально, 10 - кесаревым и 6 - оперативным путем. Все матери были здоровы, не страдали хроническими заболеваниями. Пятнадцать матерей получили ИАП.Во время исследования у трех матерей был эпизод гриппа (2 субъекта в группе кормления грудью и 1 субъект в группе кормления смесью). Ни одна мать не получала лечение антибиотиками во время кормления грудью.

В таблице представлены клинические данные и микробиологические показатели кала на исходном уровне в двух группах распределения (новорожденные, получавшие плацебо и пробиотики). Только Lactobacillus spp. количество было выше в группе плацебо, чем в группе пробиотиков на исходном уровне.

Таблица 3

Ауксологические характеристики всей когорты на исходном уровне (T0) в соответствии с обработкой распределения.

± 901 1,2 (окружность головы ) см)
Плацебо Пробиотик
Пол (М / Ж) 34/39 47/35 903 недель 39,3 ± 1,0
Масса новорожденного (г) 3307,9 ± 397,5 3298,5 ± 362,7
Длина (см) 50,1 ± 2,0 9 Окружность головы 34.2 ± 1,4 33,9 ± 1,1
Рождение (V / C / O) 63/7/3 76/3/3
Дни жизни 10,6 ± 1,9 10,4 ± 2,4
Кормление грудью / из бутылочки 59/14 71/11
Ежедневный плач (мин) 25,5 ± 28,8 28,8 ± 37,7
Частота стула 3,8 ± 16 1,8 4,1 ± 1,9
Эпизоды срыгивания 1.7 ± 1,8 1,6 ± 1,4
Эпизоды рвоты 0,1 ± 0,2 0,2 ± 0,4

Поскольку хорошо известно, что кормление влияет на микробный состав кишечника, а также на клинические проявления у новорожденных, мы исследовали, отличались ли младенцы на грудном и искусственном вскармливании в начале исследования. В дополнительной таблице 1 представлены клинические данные и микробиологические показатели кала на исходном уровне в двух группах (новорожденные на грудном и искусственном вскармливании).Время плача ( p <0,05) и частота стула были выше ( p <0,04), а эпизоды срыгивания были менее частыми ( p <0,05) у младенцев, находящихся на грудном вскармливании. Общее количество энтеробактерий ( p <0,004), E. coli ( p <0,03) и B. fragilis в группе ( p <0,01) было ниже у новорожденных, находящихся на грудном вскармливании, чем у новорожденных, находящихся на искусственном вскармливании. с поправкой на искажающие факторы (пол, гестационный возраст, вес новорожденного, тип родов, ВБД и дни жизни на дату поступления).

Микробиологические результаты во всей когорте после введения пробиотика и плацебо

В таблице показано среднее общее количество микробов, полученное в двух группах образцов: пробиотика и плацебо. Этот анализ показал значительное увеличение количества B. breve на на через 3 месяца. Остальные микробные группы не показали значительной разницы.

Таблица 4

Среднее количество (Log КОЕ / г фекалий) различных микробных групп, проанализированных в образцах стула всей когорты.

90 ± 1,5 ± 1,36
Target Пробиотик T0 Пробиотик T1 Плацебо T0 Плацебо T1
7,00 ± 1,41 7,51 ± 0,88 6,88 ± 1,14 7,29 ± 1,06
B. breve 4,45 ± 1,85 6,40 ± 1,31 162 * 5,33 ± 1,5
Энтеробактерии 6,54 ± 1,23 6,38 ± 1,14 6,02 ± 1,4 6,5 ± 1,02
E. coli 6,72 6,35 ± 2,07 7,42 ± 1,24
Lactobacillus spp. 6,56 ± 1,28 5,60 ± 1,23 6,22 ± 1,06 5,28 ± 1,48
B.fragilis группа 7,44 ± 2,14 7,62 ± 1,97 6,79 ± 2,19 7,23 ± 2,00
C. difficile 2,66 ± 1,48 2,82 ± 1,5 ± 1,58

После этой первой оценки и с учетом различных размеров образцов новорожденных, находящихся на грудном и искусственном вскармливании, а также различий в исходном количестве микробов в этих двух группах, был проведен анализ, разделяющий новорожденных на грудном вскармливании и новорожденных, вскармливаемых из бутылочки. .

Оценка данных лечения пробиотиками новорожденных на грудном вскармливании

На исходном уровне в группе плацебо была меньшая частота стула ( p <0,03) и меньшее количество энтеробактерий, чем в группе пробиотиков ( p <0,01), также с поправкой на искажающие факторы (пол, гестационный возраст, вес новорожденного, тип родов и дни жизни на дату поступления). Предельные средние значения частоты стула и количества энтеробактерий: 3,2 ± 0,4 против 4,3 ± 0,3 ( p <0.01) и 5,86 ± 0,36 против 6,01 ± 0,38 Log КОЕ / г ( p <0,03) соответственно.

Комплаентность к лечению высокая. Все родители ответили на телефонные звонки. 98,7% из них правильно вернули пустые флаконы. О нежелательных явлениях не сообщалось. Трое младенцев (1 в группе плацебо и 2 в группе пробиотика) получали симетикон в течение нескольких дней (<30 дней) из-за срыгивания.

Через 90 дней 100 (43 в группе плацебо, 57 в группе пробиотиков) из 130 новорожденных все еще находились на грудном вскармливании.Из оставшихся 30 младенцев 7 находились на искусственном вскармливании (5 в плацебо, 2 в пробиотике), а остальные 23 находились на смешанном вскармливании (11 в плацебо, 12 в пробиотике).

Клинические данные

Учитывая клинические данные, количество минут плача ( p <0,005) уменьшалось с течением времени без эффекта лечения также в скорректированных моделях.

Число эвакуаций уменьшалось с течением времени ( p <0,0001) с эффектом лечения у тех, кто родился после 40 недель гестационного возраста ( p <0.03). Консистенция стула была больше 5-го типа по Бристольской диаграмме стула ( p <0,03) с течением времени. Дети, рожденные после 40 недель гестационного возраста, чаще имели тип 6 по Бристольской таблице стула у детей, получавших пробиотики ( p <0,0001).

Количество эпизодов срыгивания постоянно уменьшалось с течением времени ( p <0,01) в группе пробиотиков в зависимости от группы плацебо в зависимости от типа кормления ( p <0,03, рисунок).

Количество ежедневных срыгиваний.Группа пробиотиков (сплошная линия) и группа плацебо (пунктирная линия). Новорожденные на грудном вскармливании (A) ; Новорожденные на искусственном вскармливании (B) ; Новорожденные на смешанном вскармливании (С) . Данные выражены как предельное среднее значение ± стандартная ошибка среднего. Данные значимы во взаимодействии ( p <0,04; модель 3). Остатки неоднородны по группам.

Эпизоды рвоты значительно уменьшились со временем в группе пробиотиков, но не в группе плацебо ( p <0,03). Более того, в течение 90 дней частота колик у младенцев была аналогичной в группе плацебо (4 пациента, 6.8%) и пробиотической группе (6 субъектов, 8,5%).

Интересно, что были изменены и ауксологические переменные. Младенцы, получавшие пробиотики, имели меньшую прибавку в весе во время исследования у тех, кто родился с кесаревым сечением ( p <0,03; рисунок), и у тех, кто все еще находился на грудном вскармливании или перешел на искусственное вскармливание во время исследования ( p <0,005) . Разнообразно, младенцы, получавшие пробиотики, имели большее увеличение окружности головы у детей, находящихся на искусственном вскармливании или при смешанном вскармливании ( p <0.01).

Изменение веса за 90 дней. Группа пробиотиков (серая полоса) и группа плацебо (черная полоса). Новорожденные, рожденные естественным путем (A) ; Новорожденные, рожденные путем кесарева сечения (B) ; Новорожденные в результате оперативных родов (С) . Данные выражены как предельное среднее значение ± стандартная ошибка среднего. Данные значимы во взаимодействии ( p <0,03; модель 2). T0: исходный. T1: после 90 дней приема плацебо / пробиотика.

В таблице описаны предельные средние модели 1. В дополнительной таблице 2 описаны также скорректированные модели.

Таблица 5

Клинические и антропометрические вариации в группе грудного вскармливания, полученные с помощью многофакторного анализа повторных измерений.

903,9
Target Пробиотик T0 Пробиотик T1 Плацебо T0 Плацебо T1

1 903 903 903 903 903 903 903 ± 2,9
32,1 ± 5,6 20.5 ± 3,7
Частота стула 4,3 ± 0,2 2,1 ± 0,1 3,9 ± 0,2 2,0 ± 0,1
Цвет стула 6,0 ± 0,1 5,7 ± 0,1 6,0 6,0 ± 0,1
Консистенция стула 5,8 ± 0,1 5,7 ± 0,1 6,0 ± 0,1 5,6 ± 0,1
Регургитация 2,0 ± 0,2 1,6 ± 0,28 ± 0,2 2,0 ± 0,3
Рвота 0,25 ± 0,05 0,11 ± 0,06 * 0,10 ± 0,05 0,20 ± 0,07
3465,6 ± 57,4 3321,5 ± 48,0 3452,2 ± 62,9
Длина (см) 50,1 ± 0,2 51,5 ± 0,2 50,2 ± 0,2 51,5 ± 0,2
33.9 ± 0,1 34,9 ± 0,1 34,3 ± 0,1 35,0 ± 0,1
Микробные данные

Общие энтеробактерии ( p <0,005), Bifidobacterium spp. ( p <0,001) и E. coli ( p <0,001) изменились со временем, но значимость была потеряна при корректировке на искажающие факторы. C. difficile не изменился.

У тех, кто лечился пробиотиками, B. fragilis членов группы уменьшилось с течением времени у рожденных естественным путем, тогда как у других младенцев увеличилось ( p <0.04). Более того, B. breve увеличивалось со временем у тех, кто лечился пробиотиками ( p <0,04). Микробиологические данные представлены в таблице.

Таблица 6

Среднее количество (Log КОЕ / г фекалий) различных микробных групп, проанализированных в образцах стула новорожденных, вскармливаемых грудью.

90
Target Пробиотик T0 Пробиотик T1 Плацебо T0 Плацебо T1
7,11 ± 0,38 7,91 ± 0,27 6,59 ± 0,34 7,78 ± 0,24
B. breve 4,64 ± 0,50 6,10 ± 0,47
62 * 5,8 ± 0,46
Энтеробактерии 6,01 ± 0,38 6,55 ± 0,35 5,86 ± 0,36 6,46 ± 0,34
E. coli 6,70 ± 0,57 6,70 ± 0,5751 6,40 ± 0,54 7,06 ± 0,48
Lactobacillus spp. 6,22 ± 0,33 5,55 ± 0,33 6,28 ± 0,29 6,27 ± 0,35
Группа B. fragilis 6,34 ± 0,64 7,33 ± 0,61 6,4
C. difficile 2,70 ± 0,42 2,89 ± 0,48 2,82 ± 0,37 3.01 ± 0,42

Оценка данных лечения пробиотиками новорожденных на искусственном вскармливании

Исходно в группе плацебо было меньше Lactobacillus spp. больше, чем пробиотический ( p <0,008). При корректировке на факторы, влияющие на факторы (пол, гестационный возраст, вес новорожденного и количество дней жизни на дату поступления), статистическая значимость была потеряна, тогда как количество групп B. fragilis было выше в группе пробиотиков (предельное среднее значение 6,62 ± 0). .53 против 8,62 ± 0,67 Log КОЕ / г, p <0,02).

Клинические данные

Принимая во внимание клинические данные как грубого, так и скорректированного анализа, не было обнаружено никаких изменений в минутах плача, частоте и плотности стула, эпизодах рвоты или срыгивания. Ни у одного ребенка в обеих группах не было коликов. Вес ( p <0,0006), длина ( p <0,01) и окружность головы ( p <0,005) увеличивались со временем без эффекта лечения.

Микробные данные

Всего энтеробактерий и E.coli не менялась со временем. Bifidobacterium spp. ( p <0,02) и C. difficile увеличивались ( p <0,04) со временем без эффекта лечения. В группе, получавшей пробиотики, B. fragilis ( p <0,03) снизились, а B. breve увеличились ( p <0,03) со временем соответственно. Микробиологические данные представлены в таблице.

Таблица 7

Среднее количество (Log КОЕ / г лиц) различных микробных групп, проанализированных в образцах стула новорожденных, вскармливаемых из бутылочки.

90
Target Пробиотик T0 Пробиотик T1 Плацебо T0 Плацебо T1
6,80 ± 0,36 7,56 ± 0,36 6,79 ± 0,30 7,35 ± 0,30
B. breve 4,20 ± 0,35 6,42 ± 0,37 162 * 90.11 ± 0,31 5,09 ± 0,33
Энтеробактерии 7,30 ± 0,41 6,97 ± 0,34 6,75 ± 0,36 7,14 ± 0,30
E. coli ± 0,62 6,67 ± 0,66 7,51 ± 0,54
Lactobacillus spp. 6,81 ± 0,29 6,00 ± 0,35 6,05 ± 0,26 6,39 ± 0,31
B.fragilis группа 8,65 ± 0,61 7,98 ± 1,84 * 7,56 ± 0,56 8,33 ± 0,51
C. difficile 2,54 ± 0,43 903,16 3,35 ± 0,46

Обсуждение

Использование бифидобактерий в качестве пробиотиков у младенцев установлено при некоторых кишечных заболеваниях, наиболее частым из которых является диарея (25). Однако, хотя исследований in vitro и подтверждают использование бифидобактерий против газообразующих колиформ (26), до сих пор не проводилось клинических испытаний их использования против детских колик.Эта работа была сосредоточена на оценке влияния на функциональные желудочно-кишечные симптомы, включая колики, интеграции детского питания с пробиотическим составом на основе B. breve .

Исследование ясно показало способность введенных штаммов B. breve выживать после желудочного транзита и достигать кишечника новорожденного. Фактически, хотя B. breve был обнаружен во всех образцах фекалий, при введении штамма было показано значительное увеличение.В согласии с Lee et al. (13), снижение количества Lactobacillus на , с течением времени наблюдалось во всех группах новорожденных, и это особенно очевидно в группе, получавшей пробиотики. Это может быть связано с высокой способностью Bifidobacterium spp. влиять на состав микробиоты кишечника, усиливая цветение одних видов и уменьшая количество других, как это наблюдалось в других исследованиях, касающихся введения Bifidobacterium (25).

Известно, что тип кормления играет решающую роль в формировании микробиоты кишечника младенца (25, 48).Наше исследование показывает, что при зачислении, когда уже проводилось 7–15 дней кормления грудью или из бутылочки, некоторые различия присутствовали в группах с разным типом кормления: общее количество энтеробактерий и E. coli было выше в группах. на искусственном вскармливании, чем у новорожденных, находящихся на грудном вскармливании, также с поправкой на мешающие факторы. Кроме того, на исходном уровне у младенцев, находящихся на искусственном вскармливании, было обнаружено более высокое количество B. fragilis , что согласуется с более высоким риском инфекции, обычно наблюдаемым у младенцев, не находящихся на грудном вскармливании (49).Это более высокое количество также было очевидным после лечения, как в группе пробиотиков, так и в группе плацебо, подтверждая абсолютную важность начального типа кормления для формирования микробиоты кишечника и, в частности, для уменьшения количества грамотрицательных бактерий. Однако у младенцев, находящихся на искусственном вскармливании, среднее количество B. fragilis было выше в конце лечения в группе плацебо по сравнению с пробиотической, что указывает на возможный положительный эффект от введения B. breve . по крайней мере, до отлучения от груди.Увеличение B. breve также наблюдается у новорожденных на грудном вскармливании, не получавших пробиотики, и это, как уже упоминалось ранее, еще раз подчеркивает положительную роль грудного молока в формировании сообщества бифидобактерий, также учитывая, что B. breve - один из самых распространенных видов в кишечнике новорожденных (50). Это увеличение также подтверждается присутствием в грудном молоке пептидов и олигосахаридов, которые стимулируют рост бифидобактерий (47).

В дополнение к данным о микробах, это исследование направлено на мониторинг типичных желудочно-кишечных симптомов колик, то есть срыгивания, рвоты и запора, с которыми трудно справиться для лиц, осуществляющих уход. Результаты, полученные на применяемых моделях, показали уменьшение количества эвакуаций и улучшение консистенции стула у новорожденных, находящихся на грудном вскармливании, после 90 дней приема пробиотиков. Кроме того, у новорожденных, находящихся на искусственном вскармливании, отмечалось улучшение цвета стула. Эти данные свидетельствуют об улучшении желудочно-кишечного транзита, что может быть связано с приемом пробиотиков.Более того, количество срыгиваний и эпизодов рвоты уменьшилось после лечения пробиотиками. Подобные результаты уже были продемонстрированы с добавлением L. reuteri (6). Уменьшение этих симптомов особенно важно, поскольку они также уменьшают беспокойство родителей и связанные с этим последствия.

Уменьшение срыгивания и рвоты не было показано в группе новорожденных, находящихся на искусственном вскармливании. На этот результат может повлиять небольшой размер группы новорожденных, находящихся на искусственном вскармливании.Исследование не было разработано для оценки различий между двумя режимами кормления, и авторы осведомлены о том, что группа, получавшая искусственное вскармливание, была недостаточна для достижения клинических результатов. Однако данные, относящиеся к разному кормлению, следует анализировать отдельно из-за неожиданных существенных различий в микробном составе на исходном уровне. С другой стороны, у тех, кто находился на грудном вскармливании при наборе, которые перешли на искусственное или смешанное вскармливание, наблюдалось улучшение с уменьшением эпизодов срыгивания. Это важное достижение также с учетом того, что количество новорожденных, находящихся на искусственном вскармливании с самого начала жизни, как правило, невелико, поскольку обычно применяется начало кормления грудным молоком (51).

В этом исследовании продолжительность ежедневного плача младенцев не показала каких-либо различий между группами пробиотиков и плацебо, несмотря на улучшение желудочного транзита из-за введения пробиотиков. Этот результат контрастирует с другими сообщениями в литературе. Можно рассмотреть несколько причин, в первую очередь неточность подсчета минут плача в дневниках самоотчета, хотя и подтвержденных, особенно для такого длительного времени. Было продемонстрировано, что анализ любого существующего инструмента для наблюдения за ежедневным плачем неточен, труден или не подтвержден в течение длительного периода наблюдения (52).Более того, мы оценивали эффекты в течение 3 месяцев, тогда как большинство исследований относились к лечению пробиотиками не дольше 4 недель (1, 53). Более того, после вторых месяцев жизни могут играть роль другие мешающие факторы, в частности, если мы рассматриваем их эффективность в отношении других параметров желудочно-кишечного тракта. Кроме того, частота колик у младенцев была одинаковой, но очень низкой как в группах плацебо, так и в группах пробиотиков. Это следствие рассмотрения в исследовании здоровых новорожденных. В будущем необходимы исследования, включающие только младенцев с коликами.

Главный неожиданный и интересный результат исследования был связан с ауксологическими параметрами. Клинические испытания влияния пробиотиков на параметры роста новорожденных немногочисленны. В нашей популяции младенцы, рожденные с помощью кесарева сечения, имели более низкий догоняющий прирост веса, если их лечили пробиотиком. Этот результат имеет решающее значение для планирования дальнейших интервенционных исследований. Колонизация кишечника микроорганизмами окружающей среды происходит во время или сразу после рождения, тогда как у младенцев, рожденных с помощью кесарева сечения, колонизация кишечника задерживается и часто изменяется, в частности, с изменением количества Bifidobacterium и Lactobacillus (25).Растущие эпидемиологические данные свидетельствуют о том, что дети, рожденные путем кесарева сечения, имеют повышенный риск развития ожирения в более позднем возрасте (54, 55). Как генетический фон и окружающая среда влияют на механизмы, контролирующие аппетит, регуляцию веса и метаболические нарушения, связанные с избыточным весом, а также на иммунное образование, изучены недостаточно. Беременность, роды, послеродовое питание (лактация и отлучение от груди) были определены как критические периоды для программирования питания и гормонального контроля потомства.Некоторые авторы предполагают, что внезапное изменение начальных условий может нарушить физиологический процесс, предрасполагающий к определенным заболеваниям (46, 56, 57), и изменения в преждевременной колонизации играют определенную роль (54, 55). Наши данные предполагают, что лечение штаммами B. breve в первые 3 месяца жизни может влиять на состав микробиоты, и это связано с сопутствующим меньшим набором веса у населения с более высоким риском метаболических нарушений в более позднем возрасте.Другим авторам не удалось показать изменения веса новорожденных, получавших другие пробиотики (53, 58). Различия должны быть вторичными по отношению к штаммам или, что более вероятно, к срокам лечения, согласно нашему протоколу, рассчитанному на 3 месяца, в отличие от большинства исследований, в которых наблюдали младенцев в течение 1 месяца. В нашем исследовании влияние на вес было связано с увеличением окружности головы. Эти данные предполагают, что лечение пробиотиками защищает от нарушения роста, как недавно было продемонстрировано для мультиштаммового пробиотика, содержащего бифидобактерии, у детей с очень низкой массой тела при рождении, подвергшихся воздействию антибиотиков (59).

Основное ограничение этого исследования связано с небольшим размером выборки населения, находящегося на искусственном вскармливании. Однако это является следствием критериев включения (здоровые новорожденные) в состояние, при котором грудное вскармливание должно быть первым выбором (51). Кроме того, хотя мы использовали проверенный опросник для ежедневного плача младенца, другие опросники, используемые для регистрации других желудочно-кишечных симптомов, не прошли проверку. Напротив, сильные стороны нашего исследования - это лечение, продленное более чем на 4 недели, включение новорожденных, не подвергавшихся воздействию антибиотиков, оценка многих факторов, мешающих рождению, и изменений в кормлении с течением времени.

В заключение, наше исследование демонстрирует, что введенные штаммы B. breve могут достигать кишечника здоровых новорожденных, предотвращая функциональные желудочно-кишечные расстройства и снижая преждевременную прибавку в весе, по крайней мере, при отсутствии антибиотиков. О нежелательных явлениях не сообщалось, что свидетельствует о безопасности продукта в этой схеме. Перспективные продольные оценки должны быть полезны для дальнейшего изучения того, имеет ли преждевременное краткосрочное лечение в этом критическом окне преимущества в дальнейшей жизни.

Вклад авторов

DD и GB разработали и разработали исследование. EG и AS отвечали за набор пациентов и сбор клинических данных. IA и NB выполнили эксперименты по количественной ПЦР и внесли свой вклад в написание статьи. FP провела статистический анализ, интерпретировала результаты и способствовала написанию статьи. DD, SB, LB и FP критически отредактировали и одобрили окончательную рукопись. LM и MP разработали пробиотическую добавку.

Заявление о конфликте интересов

Авторы LM и MP были наняты компанией Biolab Research Srl, Новара, Италия, и выполняли все исследования и разработки для Probiotical SpA, Новара, Италия.Другие авторы заявляют, что исследование проводилось в отсутствие каких-либо коммерческих или финансовых отношений, которые могли бы быть истолкованы как потенциальный конфликт интересов.

Благодарности

Авторы выражают благодарность Роберте Рикотти, Элизабетте Мингоа, Эмануэле Монес, Франческе Арчеро и Мауро Заффарони за их техническую поддержку. Эта статья посвящена доктору Джованни Могна, который решительно поддержал описанное исследование.

Ссылки

1. Савино Ф, Пелле Э, Палумери Э, Оггеро Р., Миньеро Р. Lactobacillus reuteri (штамм 55730 американской коллекции типовых культур) по сравнению с симетиконом в лечении детских колик: проспективное рандомизированное исследование. Педиатрия (2007) 119: e124–30. 10.1542 / peds.2006-1222 [PubMed] [CrossRef] [Google Scholar] 2. Wessel MA, Cobb JC, Jackson EB, Harris GSJ, Detwiler AC. Приступы суеты в младенчестве, иногда называемые «коликами». Педиатрия (1954) 14: 421–35. [PubMed] [Google Scholar] 3. Zeevenhooven J, Koppen IJN, Benninga MA. Критерии Нового Рима IV для функциональных желудочно-кишечных расстройств у младенцев и детей ясельного возраста.Педиатр Гастроэнтерол Гепатол Нутр. (2017) 20: 1–13. 10.5223 / pghn.2017.20.1.1 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 4. Лукас А., Робертс ISJ. Плач, беспокойство и колики у младенцев, находящихся на грудном и искусственном вскармливании. Early Hum Dev. (1998) 53: 9–18. 10.1016 / S0378-3782 (98) 00032-2 [PubMed] [CrossRef] [Google Scholar] 5. Вик Т., Гроте В., Эскрибано Дж., Соха Дж., Вердучи Э., Фритч М. и др. . Детские колики, продолжительный плач и послеродовая депрессия у матери. Acta Paediatr. (2009) 98: 1344–8. 10.1111 / j.1651-2227.2009.01317.x [PubMed] [CrossRef] [Google Scholar] 6. Индрио Ф., Ди Мауро А., Риеццо Дж., Чиварди Е., Интини С., Корвалья Л. и др. . Профилактическое использование пробиотика для предотвращения колик, срыгивания и функциональных запоров - рандомизированное клиническое испытание. JAMA Pediatr. (2014) 168: 228–33. 10.1001 / jamapediatrics.2013.4367 [PubMed] [CrossRef] [Google Scholar] 7. Романелло С., Спири Д., Маркуцци Э., Занин А., Буазо П. и др. . Связь между детской мигренью и детской коликой в ​​анамнезе.JAMA J Am Med Assoc. (2013) 309: 1607–12. 10.1001 / jama.2013.747 [PubMed] [CrossRef] [Google Scholar] 8. Индрио Ф., Мауро А Ди, Риеццо Дж., Кавалло Л., Франкавилла Р. Детские колики, срыгивание и запор: ранний травматический инсульт в развитии функциональных желудочно-кишечных расстройств у детей? Eur J Pediatr. (2015) 174: 841–2. 10.1186 / 1824-7288-39-15 [PubMed] [CrossRef] [Google Scholar] 9. Бэнкс С., Томас М., Гордон М., Уоллес С., Акобенг А. Пробиотики для предотвращения детских колик. Кокрановская база данных Syst Rev.(2016) 12: 1–19. 10.1002 / 14651858.CD012473 [CrossRef] [Google Scholar] 10. Кандела М., Бьяджи Э., Маккаферри С., Туррони С., Бриджиди П. Микробиота кишечника - это пластический фактор, реагирующий на изменения окружающей среды. Trends Microbiol. (2012) 20: 385–91. 10.1016 / j.tim.2012.05.003 [PubMed] [CrossRef] [Google Scholar] 11. Секиров И., Рассел С.Л., Antunes LCM, Финлей ББ. Микробиота кишечника в здоровье и болезнях. Physiol Rev. (2010) 90: 859–904. 10.1152 / Physrev.00045.2009. [PubMed] [CrossRef] [Google Scholar] 12. Дюбуа NE, Грегори KE.Характеристика кишечного микробиома при детских коликах: результаты, основанные на интегративном обзоре литературы. Biol Res Nurs. (2016) 18: 307–15. 10.1177 / 10915620840 [PubMed] [CrossRef] [Google Scholar] 13. Lee SA, Lim JY, Kim B, Cho SJ, Kim NY, Bin Kim O, Kim Y. Сравнение профиля кишечной микробиоты у корейских младенцев, вскармливаемых грудью и вскармливаемыми смесями, с использованием пиросеквенирования. Nutr Res Pract. (2015) 9: 242–8. 10.4162 / nrp.2015.9.3.242 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 14. Маццола Дж., Мерфи К., Росс Р.П., Ди Джоя Д., Биавати Б.Ранние нарушения микробиоты кишечника после внутриродовой антибиотикопрофилактики для предотвращения стрептококковой инфекции группы B. PLoS ONE (2016) 11: e0157527. 10.1371 / journal.pone.0157527 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 15. Azad MB, Mph TK, Maughan H, Guttman DS, Field CJ, Chari RS и др. . Микробиота кишечника здоровых канадских младенцев: профили в зависимости от способа родов и питания младенцев в 4 месяца. CMAJ (2013) 185: 385–94. 10.1503 / cmaj.130147 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 16.Abrahamsson TR, Jakobsson HE, Andersson AF, Engstrand L, Jenmalm MC. Низкое разнообразие микробиоты кишечника у младенцев с атопической экземой. J Allergy Clin Immunol. (2005) 129: 434–40. 10.1016 / j.jaci.2011.10.025 [PubMed] [CrossRef] [Google Scholar] 17. Гуаральди Ф., Сальватори Г. Влияние грудного вскармливания и искусственного вскармливания на формирование кишечной микробиоты у новорожденных. Front Cell Infect Microbiol. (2012) 2:94. 10.3389 / fcimb.2012.00094 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 18. Савино Ф., Куартьери А., Де Марко А., Гарро М., Амаретти А., Раймонди С. и др.. Сравнение младенцев на искусственном вскармливании с коликами и без них выявило значительные различия в количестве бактерий, энтеробактерий и аммиака в фекалиях. Acta Paediatr. (2017) 106: 573–8. 10.1111 / apa.13642 [PubMed] [CrossRef] [Google Scholar] 19. Тейлор А.Л., Хейл Дж., Вильчут Дж., Леманн Х., Данстан Дж. А., Прескотт С.Л. Влияние пробиотических добавок в течение первых 6 месяцев жизни на аллергеноспецифичные иммунные реакции. Clin Exp Allergy (2006) 36: 1227–35. 10.1111 / j.1365-2222.2006.02553.x [PubMed] [CrossRef] [Google Scholar] 20.Ресслер А., Фридрих У., Фогельсанг Х., Бауэр А., Каатц М., Хиплер Калифорнийский университет и др. . Пробиотическое вмешательство, по-видимому, по-разному влияет на иммунную систему здоровых взрослых и пациентов с атопическим дерматитом. Clin Exp Allergy (2007) 38: 93–102. 10.1111 / j.1365-2222.2007.02876.x [PubMed] [CrossRef] [Google Scholar] 21. Szajewska H, ​​Gyrczuk E, Horvath A. Lactobacillus reuteri DSM 17938 для лечения младенческих колик у младенцев на грудном вскармливании: рандомизированное двойное слепое плацебо-контролируемое исследование.J Pediatr. (2013) 162: 257–62. 10.1016 / j.jpeds.2012.08.004 [PubMed] [CrossRef] [Google Scholar] 22. Чау К., Лау Е., Гринберг С., Якобсон С., Яздани-Брожени П., Верма Н. и др. . Пробиотики для лечения детских колик: рандомизированное двойное слепое плацебо-контролируемое исследование, изучающее Lactobacillus reuteri DSM 17938. J Pediatr. (2015) 166: 74–8.e1. 10.1016 / j.jpeds.2014.09.020 [PubMed] [CrossRef] [Google Scholar] 23. Савино Ф., Форнасеро С., Сератто С., Де Марко А., Мандрас Н., Роана Дж. И др. . Пробиотики и здоровье кишечника у младенцев: предварительное обсервационное исследование случай - контроль по раннему лечению с помощью Lactobacillus reuter i DSM 17938.Clin Chim Acta (2015) 451: 82–7. 10.1016 / j.cca.2015.02.027 [PubMed] [CrossRef] [Google Scholar] 24. Савино Ф., Кордиско Л., Тараско В., Локателли Е., Ди Джоя Д., Оггеро Р. и др. . Антагонистический эффект штаммов Lactobacillus против газообразующих колиформ, выделенных у младенцев, страдающих коликами. BMC Microbiol. (2011) 11: 157. 10.1186 / 1471-2180-11-157 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 25. Di Gioia D, Aloisio I, Mazzola G. Бифидобактерии: их влияние на состав микробиоты кишечника и их применение в качестве пробиотиков у младенцев.Appl Microbiol Biotechnol. (2014) 98: 563–77. 10.1007 / s00253-013-5405-9 [PubMed] [CrossRef] [Google Scholar] 26. Алоизио I, Сантини С., Биавати Б., Динелли Г., Ченчи А., Чингвару В. и др. . Характеристика Bifidobacterium spp. штаммы для лечения кишечных расстройств у новорожденных. Appl Microbiol Biotechnol. (2012) 96: 1561–76. 10.1007 / s00253-012-4138-5 [PubMed] [CrossRef] [Google Scholar] 27. Ли Й, Шимицу Т., Хосака А., Канеко Н., Оцука Ю., Ямаширо Ю. Влияние добавок Bifidobacterium breve на кишечную флору младенцев с низкой массой тела при рождении.Педиатрия Int. (2004) 46: 509–15. 10.1111 / j.1442-200x.2004.01953.x [PubMed] [CrossRef] [Google Scholar] 28. Вада М., Нагата С., Сайто М., Симидзу Т., Ямаширо Ю., Мацуки Т. и др. . Влияние энтерального введения Bifidobacterium breve на пациентов, проходящих химиотерапию по поводу детских злокачественных новообразований. Поддержите лечение рака (2010) 18: 751–9. 10.1007 / s00520-009-0711-6 [PubMed] [CrossRef] [Google Scholar] 29. Костелое К., Харди П., Ющак Э., Вилкс М., Миллар М.Р. Bifidobacterium breve BBG-001 у очень недоношенных новорожденных: рандомизированное контролируемое исследование фазы 3.Ланцет (2016) 387: 649–60. 10.1016 / s0140-6736 (15) 01027-2 [PubMed] [CrossRef] [Google Scholar] 30. Патоле С.К., Рао С.К., Кейл А.Д., Натан Э.А., Доэрти Д.А., Симмер К.Н. Преимущества добавки Bifidobacterium breve M-16V у недоношенных новорожденных - ретроспективное когортное исследование. PLoS ONE (2016) 11: e0150775. 10.1371 / journal.pone.0150775 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 31. Могна Л., Дель Пиано М., Могна Г. Способность двух микроорганизмов Bifidobacterium breve B632 и Bifidobacterium breve BR03 колонизировать кишечную микробиоту детей.J Clin Gastroenterol. (2014) 48: S37–9. 10.1097 / MCG.0000000000000234 [PubMed] [CrossRef] [Google Scholar] 32. Simone M, Gozzoli C, Quartieri A, Mazzola G, Di Gioia D, Amaretti A и др. . Пробиотик Bifidobacterium breve B632 Подавлял рост Enterobacteriaceae в культурах детской микробиоты, пораженной коликами. Biomed Res Int. (2014) 2014: 1–7. 10.1155 / 2014/301053 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 33. Quagliariello A, Aloisio I, Bozzi Cionci N, Luiselli D, Auria GD, Martinez-priego L, et al.. Влияние > Bifidobacterium breve на микробиоту кишечника детей с глютеновой диете на безглютеновой диете: пилотное исследование. Питательные вещества (2016) 8: 660–76. 10.3390 / nu8100660 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 34. Малинен Э., Кассинен А., Ринттила Т., Палва А. Сравнение ПЦР в реальном времени с анализами SYBR Green I или 5 9-нуклеаз и дот-блот-гибридизацией с олигонуклеотидными зондами, нацеленными на рДНК, при количественной оценке выбранных фекальных бактерий. Микробиология (2003) 149: 269–77.10.1099 / mic.0.25975-0 [PubMed] [CrossRef] [Google Scholar] 35. Пендерс Дж., Винк С., Дриссен К., Лондон Н., Тийс С., Стобберинг Э. Количественная оценка Bifidobacterium spp., Escherichia coli и Clostridium difficile в образцах фекалий младенцев, вскармливаемых грудью и вскармливаемых смесями, с помощью ПЦР в реальном времени. FEMS Microbiol Lett. (2005) 243: 141–7. 10.1016 / j.femsle.2004.11.052 [PubMed] [CrossRef] [Google Scholar] 36. Ринттила Т., Кассинен А., Малинен Э., Крогиус Л., Палва А. Разработка обширного набора праймеров, нацеленных на 16S рДНК, для количественной оценки патогенных и аборигенных бактерий в образцах фекалий с помощью ПЦР в реальном времени.J Appl Microbiol. (2004) 97: 1166–77. 10.1111 / j.1365-2672.2004.02409.x [PubMed] [CrossRef] [Google Scholar] 37. Кастильо М., Мартин-Оруэ С.М., Мансанилла Э.Г., Бадиола И., Мартин М., Гаса Дж. Количественная оценка общего количества бактерий, энтеробактерий и лактобактерий в пищеварительном тракте свиней с помощью ПЦР в реальном времени. Vet Microbiol. (2006) 114: 165–70. 10.1016 / j.vetmic.2005.11.055 [PubMed] [CrossRef] [Google Scholar] 38. Пендерс Дж., Тийс С., Винк С., Стелма Ф.Ф., Снидерс Б., Куммелинг И., ван ден Брандт П.А., Стобберинг Э. Факторы, влияющие на состав кишечной микробиоты в раннем детстве.Педиатрия (2006) 118: 511–21. 10.1542 / peds.2005-2824 [PubMed] [CrossRef] [Google Scholar] 39. Хаарман М., Кнол Дж. Количественные ПЦР-анализы в реальном времени для идентификации и количественного определения фекальных видов Bifidobacterium у младенцев, получающих пребиотическую смесь для грудных детей. Appl Environ Microbiol. (2005) 71: 2318–24. 10.1128 / AEM.71.5.2318-2324.2005 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 40. Leser TD, Amenuvor JZ, Jensen TK, Lindecrona RH, Boye M, Møller K. Независимый от культуры анализ кишечных бактерий: повторный визит микробиоты желудочно-кишечного тракта свиней.Appl Environ Microbiol. (2002) 68: 673–90. 10.1128 / AEM.68.2.673 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 41. Барр Р.Г., Крамер М.С., Буашоли К., Маквей-Уайт Л., Плесс И.Б. родительский дневник детского крика и суетливого поведения. Arch Dis Childh. (1988) 63: 380–7. 10.1136 / adc.63.4.380 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 42. Переулок М.М., Чижевский Д.И., Мпч БПК, Шульман Р.Дж. Надежность и валидность модифицированной бристольной шкалы формы стула для детей. J Pediatr. (2011) 159: 437–41.e1. 10.1016 / j.jpeds.2011.03.002 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 43. Aloisio I, Mazzola G, Corvaglia LT, Tonti G, Faldella G, Biavati B и др. . Влияние антибиотикопрофилактики во время родов против Streptococcus группы B на ранний состав кишечника новорожденных и оценка антистрептококковой активности штаммов Bifidobacterium . Appl Microbiol Biotechnol. (2014) 98: 6051–60. 10.1007 / s00253-014-5712-9 [PubMed] [CrossRef] [Google Scholar] 44. Альтшул С.Ф., Гиш В., Миллер В., Майерс Е. В., Липман Д. Д..Базовый инструмент поиска локального выравнивания. J Mol Biol. (1990) 215: 403–10. 10.1016 / S0022-2836 (05) 80360-2 [PubMed] [CrossRef] [Google Scholar] 45. Ли ZMP, Bussema C, Schmidt TM. rrn DB: Документирование количества генов рРНК и тРНК у бактерий и архей. Nucleic Acids Res. (2009) 37: 489–93. 10.1093 / nar / gkn689 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 46. Индрио Ф., Мартини С., Франкавилла Р., Корвалья Л., Кристофори Ф., Мартини С. Эпигенетические вопросы: связь между ранним питанием, микробиомом и долгосрочным развитием здоровья.Фронт Педиатр. (2017) 5: 178. 10.3389 / fped.2017.00178 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 47. Лиепке С., Адерманн К., Райда М., Магерт Х.-Дж., Форссманн В., Цухт HD. Грудное молоко содержит пептиды, которые сильно стимулируют рост бифидобактерий. Eur J Biochem. (2002) 269: 712–8. 10.1046 / j.0014-2956.2001.02712.x [PubMed] [CrossRef] [Google Scholar] 48. Обермайер Т., Грабнар И., Бенедик Э., Тушар Т., Пикель Т.Р., Мис Н.Ф., Матияшич Б.Б., Рогель И. Микробы в развитии кишечника младенца: определение изобилия в параметрах окружающей среды, клинических условиях и росте.Научный доклад (2017) 7: 11230. 10.1038 / s41598-017-10244-x [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 50. Фавье К.Ф., Воан Э.Э., Де Вос В.М., Аккерманс АДЛ. Молекулярный мониторинг сукцессии бактериальных сообществ у новорожденных человека. Общество (2002) 68: 219–26. 10.1128 / AEM.68.1.219 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 51. Макфадден А., Гэвин А., Ренфрю М., Уэйд А., Бьюкенен П., Тейлор Дж. И др. . Поддержка здоровых кормящих матерей со здоровыми доношенными детьми. Кокрановская база данных Syst Rev.(2017) 2: 1-224. 10.1002 / 14651858.CD001141 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 52. Гарсиа Маркес С., Чильон Мартинес Р., Гонсалес Сапата С., Реболло Салас М., Хименес Реджано Х. Дж. Инструменты оценки и диагностики детских колик: систематический обзор. Child Care Health Dev. (2017) 43: 481–8. 10.1111 / cch.12454 [PubMed] [CrossRef] [Google Scholar] 53. Сюй М., Ван Дж., Ван Н., Сунь Ф., Ван Л., Лю X. Эффективность и безопасность пробиотической бактерии Lactobacillus reuteri DSM 17938 для младенческой колики: метаанализ рандомизированных контролируемых испытаний.PLoS ONE (2015) 10: 1–16. 10.1371 / journal.pone.0141445 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 54. Магне Ф., Пучи Силва А., Каравахал Б., Готтеланд М. Повышенная частота кесарева сечения и его вклад в неинфекционные хронические заболевания в Латинской Америке: растущее участие микробиоты. Фронт Педиатр. (2017) 5: 192. 10.3389 / fped.2017.00192 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 55. Kuhle S, Тонг OS, Woolcott CG. Связь детского ожирения и беременности между кесаревым сечением и детским ожирением: систематический обзор и метаанализ.Obes Rev. (2015) 16: 295–303. 10.1111 / obr.12267 [PubMed] [CrossRef] [Google Scholar] 56. Де Моура Э. Г., Лиссабон, ПК, Пассос, MCF. Неонатальное программирование нейроиммуномодуляции - роль адипоцитокинов и нейропептидов. Нейроиммуномодуляция (2008) 15: 176–88. 10.1159 / 000153422 [PubMed] [CrossRef] [Google Scholar] 58. Baldassarre ME, Di Mauro A, Mastromarino P, Fanelli M, Martinelli D, Urbano F и др. . Назначение женщинам в перинатальном периоде мультиштаммового пробиотического продукта по-разному влияет на цитокиновый профиль грудного молока и может оказывать благотворное влияние на функциональные симптомы желудочно-кишечного тракта новорожденных.рандомизированное клиническое испытание. Питательные вещества (2016) 8: 1–13. 10.3390 / nu8110677 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 59. Härtel C, Pagel J, Spiegler J, Buma J, Henneke P, Viemann D, et al. . Lactobacillus acidophilus / Bifidobacterium infantis пробиотики связаны с повышенным ростом VLBWI среди тех, кто подвергается воздействию антибиотиков. Sci Rep. (2017) 7: 1–11. 10.1038 / s41598-017-06161-8 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]

Интеграция трехмесячного кормления со штаммами бифидобактерий предотвращает желудочно-кишечные симптомы у здоровых новорожденных

, 1, , 2, 3, , 2 , 1 , 2 , 2, 3 , 1 , 4 , 4 , 2 , *

Ирен Алоизио

1 Кафедра сельскохозяйственных и пищевых наук, Болонский университет, Болонья, Италия

Флавия Продам

2 Кафедра медицинских наук, Università degli Studi del Piemonte Orientale, Новара, Италия

3 Междисциплинарный исследовательский центр аутоиммунных заболеваний (IRCAD), Università degli Studi del Piemonte Orientale, Новара, Италия

Enza Giglione

2 Департамент медицинских наук, университеты ità degli Studi del Piemonte Orientale, Новара, Италия

Николь Боцци Чиончи

1 Кафедра сельскохозяйственных и пищевых наук, Болонский университет, Болонья, Италия

Арианна Солито

2 Департамент медицинских наук, Università degli Studi del Piemonte Orientale, Новара, Италия

Симонетта Беллоне

2 Департамент медицинских наук, Università degli Studi del Piemonte Orientale, Новара, Италия

3 Междисциплинарный исследовательский центр изучения аутоиммунных заболеваний (IRCAD), Университет del Piemonte Orientale, Новара, Италия

Лоредана Баффони

1 Кафедра сельскохозяйственных и пищевых наук Болонского университета, Болонья, Италия

Лука Могна

4 Biolab Reserach, Новара, Италия

Марко Пане

4 Biolab Reserach, Новара, Италия

Джанни Бона

2 Департамент медицинских наук, Università degli Studi del Piemonte Orientale, Новара, Италия

Diana Di Gioia

1 Департамент сельскохозяйственных и пищевых наук Болонского университета, Болонья, Италия

1 Департамент сельского хозяйства и пищевых наук, Болонский университет, Болонья, Италия

2 Департамент медицинских наук, Università degli Studi del Piemonte Orientale, Новара, Италия

3 Междисциплинарный исследовательский центр аутоиммунных заболеваний (IRCAD), Università degli Studi del Piemonte Orientale, Новара, Италия

4 Biolab Reserach, Новара, Италия

Редактор: Надия В.Бойко, Ужгородский национальный университет, Украина

Рецензент: Брайан Д. Пикколо, Центр детского питания Арканзаса, США; Ирена Рогель, биотехнический факультет, Университет Любляны, Словения

Эта статья была отправлена ​​в раздел «Пищевая микробиология» журнала «Границы питания»

† Эти авторы внесли равный вклад в эту работу.

Поступило 30.11.2017 г .; Принято 23 апреля 2018 г..

Copyright © 2018 Алоизио, Продам, Джильоне, Боцци Чиончи, Солито, Беллоне, Баффони, Могна, Пане, Бона и Ди Джоя.

Это статья в открытом доступе, распространяемая в соответствии с условиями лицензии Creative Commons Attribution License (CC BY). Использование, распространение или воспроизведение на других форумах разрешено при условии указания автора (авторов) и правообладателя и ссылки на оригинальную публикацию в этом журнале в соответствии с принятой академической практикой. Запрещается использование, распространение или воспроизведение без соблюдения этих условий.

Эта статья цитируется в других статьях в PMC.

Abstract

Инфантильные функциональные расстройства желудочно-кишечного тракта распространены в первые месяцы жизни. Их патогенез остается неизвестным, хотя данные свидетельствуют о множестве независимых причин, включая модификации кишечной микробиоты. Тип питания, влияющий на состав кишечной микробиоты, может играть значительную роль в патогенезе. Предыдущие исследования подтвердили успех применения пробиотических добавок против колик, но в основном это были Lactobacillus spp. были протестированы.Целью этого исследования было оценить эффективность против функциональных желудочно-кишечных расстройств пробиотического состава на основе Bifidobacterium breve , включая в исследование субъектов как на грудном, так и на искусственном вскармливании. Двести шестьдесят восемь новорожденных были включены в исследование в течение 15 дней с момента рождения. Сто пятьдесят пять из них эффективно вошли в исследование и были рандомизированы в группы пробиотиков и плацебо, получавших состав в течение 90 дней. Состав пробиотика состоит из смеси 1: 1 2 штаммов B.breve готовят в виде масляной суспензии и вводят в суточной дозе 5 капель, содержащих 10 8 КОЕ каждого штамма. Абсолютное количественное определение выбранных микробных групп в фекалиях проводили с помощью КПЦР. До и после лечения оценивались антропометрические данные, ежедневные дневниковые минуты плача, количество срыгиваний, рвот и отказов, цвет и консистенция стула. Исследование подтвердило положительную роль грудного молока в влиянии на количество целевых микробных групп, в частности, сообщества бифидобактерий.Не сообщалось о побочных эффектах при введении пробиотиков, что свидетельствует о безопасности продукта в этой схеме. B. breve Количество значительно увеличилось у всех новорожденных, которым вводили вакцину ( p <0,02). Исследование демонстрирует, что трехмесячное лечение штаммами B. breve у здоровых новорожденных, находящихся на грудном вскармливании, помогает предотвратить функциональные желудочно-кишечные расстройства, в частности, снижает на 56% ежедневную частоту рвоты ( p <0,03), уменьшая 46,5% дневной нормы. эвакуация с течением времени ( p <0.03) и улучшение консистенции стула (тип 6 в таблице стула Бристоля вместо типа 5) у доношенных ( p <0,0001). Более того, наблюдалось значительное снижение (8,65 против 7,98 LogCFU / г фекалий, p <0,03) B. fragilis в группе кормления из бутылочки, получавшей пробиотический состав.

Ключевые слова: пробиотик, Bifidobacterium breve , детские колики, функциональные желудочно-кишечные расстройства, грудное вскармливание, кормление из бутылочки, микробиота

Введение

Детские колики - распространенное заболевание в первые 3 месяца детства, которое поражает до 30 лет. % новорожденных и характеризуется приступообразным, чрезмерным, неконтролируемым плачем без идентифицируемых причин (1).Wessel et al. (2) дал первое определение этого расстройства как состояние плача или беспокойства, которое длится более 3 часов в день, более 3 дней в неделю. Для клинических целей консенсусная группа Рима IV (3) недавно пересмотрела диагностические критерии, включая возраст новорожденного (<5 месяцев), придав меньшее значение продолжительности плача, учитывая длительный и неотразимый характер эпизодов плача. как раздражительность, которую не могут предотвратить или устранить лица, осуществляющие уход.Симптомы, такие как покраснение лица, метеоризм, сгибание бедер и метеоризм, начинаются на второй неделе жизни как у детей, находящихся на грудном вскармливании, так и у детей, вскармливаемых смесями, и обычно проходят спонтанно со временем (4).

Младенческие колики представляют собой серьезную проблему для семьи, потому что лица, осуществляющие уход, сталкиваются с трудностями в преодолении этих неконтролируемых кризисов, часто приводящих к стрессу и беспокойству; проспективное европейское многоцентровое исследование, проведенное Vik et al. (5) показали, что детские колики и продолжительный плач связаны с высокими показателями материнской депрессии.Точно так же срыгивание, рвота и запор часто требуют посещения педиатра в течение первых 6 месяцев жизни и часто являются причиной смены кормления и использования медицинских методов лечения (6, 7). Более того, наличие колик на раннем этапе жизни было связано с несколькими последствиями: у детей с коликами в анамнезе выше частота функциональных желудочно-кишечных расстройств в более позднем возрасте (8), а у детей с мигренью чаще возникают младенческие колики. чем у людей без мигрени (7).Таким образом, предусмотрена эффективная профилактическая стратегия против функциональных желудочно-кишечных расстройств.

Несмотря на 40 лет исследований, этиология колических кризов и других функциональных желудочно-кишечных расстройств до конца не выяснена. Было высказано предположение, что ряд поведенческих факторов (психологических и социальных), факторов питания (пищевая гиперчувствительность или аллергия), нарушение моторики кишечника и слабое воспаление кишечника могут способствовать его возникновению (6, 9). Неудивительно, что, будучи типичным заболеванием желудочно-кишечного тракта, дисбаланс в составе микробиоты кишечника играет роль в патогенезе этих состояний.Микробиота кишечника очень тесно связана с хозяином, что способствует нормальной физиологии человека: она может служить барьером для колонизации патогенов, синтезировать витамины и другие полезные соединения и стимулировать иммунную систему (10). Неонатальный период является решающим этапом для колонизации желудочно-кишечного тракта, сбалансированного состава кишечной микробиоты, что положительно влияет на здоровье хозяина (11). Младенцы с коликами имеют меньшее фекально-бактериальное разнообразие и стабильность по сравнению со здоровыми.Они также показывают более высокую распространенность грамотрицательных бактерий, особенно колиформ, и меньшее количество полезных бактерий, таких как лактобациллы и бифидобактерии (12).

Диета играет доминирующую роль в формировании микробиоты кишечника, поэтому тип кормления новорожденных оказывает определенное влияние на оценку микробных групп кишечника. Заметные различия показали Lee et al. (13): Актинобактерии были преобладающим филумом у новорожденных, находящихся на грудном вскармливании, за ними следовали Firmicutes и Proteobacteria; Напротив, у младенцев, вскармливаемых смесью, пропорции Actinobacteria и Firmicutes были одинаковыми, за ними следовали Proteobacteria.Кроме того, микробиота кишечника детей, находящихся на искусственном вскармливании, содержит значительное количество родов Escherichia, Veillonella, Enterococcus и Enterobacter , тогда как содержание Lactobacillus было низким. В той же работе сообщается, что основным родом младенцев, вскармливаемых грудью и искусственными смесями, является Bifidobacterium , но эта пропорция значительно выше у младенцев, вскармливаемых грудью. Исследование Mazzola et al. (14) также показали снижение содержания Bifidobacterium spp.у детей, находящихся на смешанном вскармливании (вскармливаемых не менее 50% молочной смеси), по сравнению с грудным вскармливанием. Напротив, дифференциальная представленность рода Bifidobacterium не была обнаружена у младенцев, находящихся на грудном вскармливании, по сравнению с детьми, вскармливаемыми смесью, хотя различия в микробиоте кишечника наблюдались в двух группах (15). Более того, эти исследования выявили более низкое бактериальное богатство и разнообразие на грудном вскармливании, вероятно, из-за наличия уникальных олигосахаридов в грудном молоке, которые служат селективными метаболическими субстратами для ограниченного числа кишечных микробов (16).

Тип питания, влияющий на состав кишечной микробиоты, может играть значительную роль в патогенезе детских колик, хотя после первого года жизни эти различия теряются (17). Недавнее исследование, сфокусированное на младенцах, вскармливаемых смесями и не страдающих коликами, проведенное с использованием FISH в качестве метода подсчета бактерий, выявило более низкую концентрацию общих бактерий и более высокое содержание энтеробактерий у детей, вскармливаемых смесями (18).

Несколько исследований поддерживают использование пробиотиков в качестве терапевтических или профилактических средств против различных заболеваний, в частности кишечных расстройств, а также патологий человека, которые явно не связаны с микробным составом кишечника, таких как аллергии и аутоиммунные заболевания (19, 20).Лечение пробиотиками, благотворное влияние которых на нарушения микробиоты кишечника и на здоровье человека хорошо известно, может иметь защитный эффект от желудочно-кишечных расстройств, включая колики, и уменьшать связанные с ними симптомы, что приводит к правильной микробной колонизации в раннем младенчестве, когда микробиота все еще находится в стадии адаптации.

Многие исследования были сосредоточены на введении Lactobacillus reuteri DSM 17938 в качестве пробиотика для профилактики или уменьшения симптомов функциональных желудочно-кишечных расстройств, включая колики, срыгивание, рвоту и запор, с успешными результатами (6, 21, 22).В частности, Savino et al. (23) показали меньшее количество анаэробных грамотрицательных бактерий, энтеробактерий и энтерококков у новорожденных с коликами, которые получали L. reuteri , по сравнению с детьми, не получавшими лечения. Однако другие виды Lactobacillus , такие как L. delbrueckii subsp. delbruekii DSM 20074 и L. plantarum MB 456 продемонстрировали ингибирующую активность в отношении газообразующих колиформных бактерий и могут быть использованы при лечении детских колик (24).Иными словами, применение бифидобактерий для лечения этих кишечных расстройств остается малоизученным, хотя их роль в здоровой микробиоте кишечника новорожденных была продемонстрирована в обзоре Di Gioia et al. (25). Предыдущее исследование in vitro описало способность некоторых штаммов, принадлежащих к роду Bifidobacterium , включая штаммы Bifidobacterium breve , ингибировать in vitro рост патогенов, типичных для желудочно-кишечного тракта младенцев, включая колиформ, выделенных из новорожденных с коликозной болезнью. 26).Другие исследования продемонстрировали эффективность штамма B. breve для лечения различных детских заболеваний: Li et al. (27) показали полезность в содействии колонизации B. breve и формированию нормальной кишечной биоты у младенцев с низкой массой тела при рождении, Wada et al. (28) описали положительные эффекты этого вида у детей с ослабленным иммунитетом при химиотерапии. Более того, недавние исследования доказали эффективность B. breve для снижения риска некротического энтероколита у недоношенных детей (29, 30).Кроме того, два штамма B. breve, , B632 и BR03 были исследованы на предмет их способности колонизировать кишечник человека, стимулировать иммунный ответ, конкурировать с патогенами, а также были продемонстрированы их оценки безопасности (26, 31, 32). Недавнее исследование также показало способность этих штаммов B. breve , используемых в качестве пробиотиков для детей с глютеновой болезнью, действовать в качестве «пускового» элемента для увеличения других полезных бактериальных родов или типов, таких как Firmicutes (33).

Целью данного исследования было описать эффективность пробиотической композиции на основе B. breve , вводимой новорожденным как на грудном вскармливании, так и на искусственном вскармливании, в: 1) изменении количества целевых групп фекальных микробов; 2) профилактика колик и функциональных желудочно-кишечных расстройств в когорте здоровых новорожденных.

Материалы и методы

Дизайн исследования и сбор образцов

Это было двойное слепое рандомизированное плацебо-контролируемое клиническое испытание ({"type": "клиническое испытание", "attrs": {"text": " NCT03219931 "," term_id ":" NCT03219931 "}} NCT03219931) одобрено этическим комитетом больницы Маджоре делла Карита (CE 63/13).Новорожденные были зачислены в отделение педиатрии факультета медицинских наук Восточного университета Пьемонта им. Авогадро »в период с ноября 2013 г. по сентябрь 2016 г. Новорожденных набирали при рождении и регистрировали в течение 15 дней с момента рождения во время первого посещения (T0). Информированное согласие было получено родителями при зачислении в соответствии с критериями местного этического комитета и критериями Хельсинки. Пациентов попросили выполнить второй визит (Т1) через 90 дней лечения. Число новорожденных, оцененных на соответствие критериям [268], рандомизированных [155] и отнесенных к группе плацебо или пробиотиков, показано на рисунке.Их набирали, если они были здоровы в течение 15 дней после рождения и родились адекватно гестационному возрасту. Критерии исключения: 1) новорожденные-близнецы; 2) лечение любым лекарственным препаратом в рамках набора; 3) лечение пробиотиками; 4) курящие матери; 5) семейный анамнез врожденных заболеваний; 6) длительная желтуха в анамнезе. Матери не рекомендовали никаких особых диетических ограничений во время кормления грудью, за исключением других продуктов, содержащих пробиотики. Пациенты были рандомизированы с использованием компьютерной последовательности распределения в группы плацебо или пробиотиков (1: 1).Персонал исследования и родители были замаскированы для распределения группы исследования. Первоначальная идея исследования заключалась в том, чтобы набрать равное количество новорожденных, находящихся на грудном вскармливании и на искусственном вскармливании, но, учитывая трудности с набором новорожденных, находящихся на искусственном вскармливании, мы решили продолжить с другим количеством новорожденных, принадлежащих к этим двум группы (рисунок).

Группа пробиотиков получала коммерческий пробиотический состав Bifibaby® (Probiotical S.p.A., Новара, Италия), содержащий B. breve в течение 90 дней (T1), а группа плацебо получала состав плацебо на тот же период.Состав пробиотика представлял собой смесь 1: 1 из 2 штаммов, B. breve BR03 (DSM 16604) и B. breve B632 (DSM 24706), приготовленных в масляной суспензии, вводимой в суточной дозе 5 капель, содержащих 10 . 8 КОЕ каждого штамма. Плацебо готовили с теми же эксципиентами без пробиотических штаммов с использованием идентичной формы упаковки.

Клинический мониторинг

Данные о родах были собраны во время первого посещения. Антропометрические данные (вес, рост, окружность головы) и информация о типе кормления собирались как при первом (T0), так и во втором посещении (T1).

Родителей попросили записывать в ежедневный дневник минуты безутешного плача в соответствии с утвержденной анкетой (41). Они также регистрировали ежедневное количество срыгиваний, рвот и опорожнений, а также цвет и консистенцию стула. Бристольская шкала формы стула для детей была передана родителям (42). Колики диагностировали согласно группе консенсуса Рима IV (3).

Родителей также попросили сообщать о любых побочных эффектах (в частности, запорах, рвоте, аллергических реакциях, заболеваниях), лечении, количестве и типах инфекций или боли в животе, имевших место в течение испытательного периода.Соблюдение режима лечения контролировалось телефонными звонками раз в две недели, подсчетом пустых флаконов и ежедневной проверкой молочных заводов.

Сбор образцов кала

Образцы фекалий новорожденных собирали дважды: при зачислении (T0) и в конце вмешательства с пробиотиком / плацебо (T1). Таким образом, проанализированы группы: пробиотик T0, плацебо T0, пробиотик T1, плацебо T1. Образцы фекалий замораживали сразу после сбора при -80 ° C в пронумерованных пластиковых контейнерах с завинчивающейся крышкой, пока они не были обработаны для выделения ДНК.Исследователи, выполняющие экстракцию ДНК и молекулярные анализы (кПЦР), не знали о групповой принадлежности пациентов (группа пробиотиков или плацебо).

Экстракция ДНК из образцов фекалий

ДНК была извлечена из 200 мг фекалий (сохраненных при -80 ° C после сбора) с использованием набора QIAamp DNA Stool Mini (Qiagen, West Sussex, UK) с небольшой модификацией стандартного протокола : дополнительная инкубация при 95 ° C в течение 10 мин образца стула с буфером для лизиса была добавлена ​​для усиления разрыва бактериальных клеток (43).Экстрагированную ДНК хранили при -80 ° C. Чистоту ДНК определяли путем измерения отношения оптической плотности при 260 и 280 нм (Infinite®200 PRO NanoQuant, Tecan, Mannedorf, Швейцария), а концентрацию оценивали с помощью флуорометра Qubit® 3.0 (Invitrogen, Life Technologies, CA, США). ).

Абсолютная количественная оценка выбранных микробных групп с помощью количественной ПЦР (qPCR)

Количественная оценка выбранных микробных групп или видов, обычно отслеживаемых в исследованиях, относящихся к младенцам (38, 43), т.е.е., Bidobacterium spp., Lactobacillus spp., Группа Bacteroides fragilis (включающая наиболее распространенные виды у человека B. fragilis, B. distasonis, B. ovatus, B. thetaiotaomicron, B. vulgatus ) , B. breve, Clostridium difficile, Escherichia coli и общее количество энтеробактерий выполняли с помощью ПЦР в реальном времени на ДНК, выделенной из образцов стула. Анализы проводили с 20 мкл смеси для ПЦР-амплификации, содержащей 10 мкл Fast SYBR® Green Master Mix (Applied Biosystems, Foster city, CA, USA) с оптимизированными концентрациями праймеров (Таблицы), молекулярной степени чистоты H 2 O и 2 мкл ДНК, полученной из проб фекалий в концентрации 2.5 нг / мкл. B. breve анализ выполняли с использованием анализа TaqMan, содержащего 12,5 мкл мастер-микса Universal TaqMan (Applied Biosystems, Foster city, CA, USA), 300 нМ каждого праймера и 100 нМ зонда, меченного 5'-репортерным красителем 6- карбоксифлуоресцеин и 3'-гаситель NFQ-MGB (Applied Biosystems, Nieuwerkerk a / d IJssel, Нидерланды). Число циклов ПЦР составляло 40.

Таблица 1

Последовательности праймеров и условия кПЦР, использованные в различных анализах.

difficile

Микроорганизм-мишень Праймер Последовательность (5'-3 ') Длина ампликона (п.о.) col13 col13 1

Eco-F GTTAATACCTTTGCTCATTGA 340 (34)
Eco-R ACCAGGGTATCTAATCCTGTT Cdiff-F TTGAGCGATTTACTTCGGTAAAGA 114 (35)
Cdiff-R TGTACTG16CTCAC329 903 903 ATTACTG163CTCACCTTTG 903 Bif-F TCGCGTCYGGTGTGAAAG 243 (36)
Bif-R CCACATCCAGCRTCCAC Лак-F GCAGCAGTAGGGAATCTTCCA 349 (37)
Лак-R GCATTYCACCGCTACACATG
Bacteroides ломкая группа Bfra-F CGGAGGATCCGAGCGTTA 92 (38)
Bfra-R CCGCAAACTTTCACAACTGACTTA
B.BREVE F _IS GTGGTGGCTTGAGAACTGGAT А.Г. 118 (39)
R_IS CAAAACGATCGAAACAAACACTAAA
P_IS TGATTCCTCGTTCTTGCTGT
Энтеробактерии Ent-F ATGGCTGTCGTCAGCTCGT 385 (40)
Ent-R CCTACTTCTTTTGCAACCCACTC CCTACTTCTTTTGCAACCCACTC Протоколы

9028 45 Лактобациллы виды .
Целевые бактерии Начальная денатурация Денатурация Отжиг Н.циклы

9029 9029 nM
E. coli
Eco-F / Eco-R 95 ° C - 20 с 95 ° C - 3 с 60 ° C - 30 с 40 400 400
С.difficile
Cdiff-F / Cdiff-R 95 ° C - 20 с 95 ° C - 3 с 60 ° C - 30 с 40 250 250
Бифидобактерии виды .
BifTOT-F / BifTOT-R 95 ° C - 20 с 95 ° C - 3 с 60 ° C - 35 с 40 200 300
Lac-F / Lac-R 95 ° C - 20 с 95 ° C - 3 с 63,5 ° C - 30 с 40 200 200

Концентрации праймеров были оптимизированы с помощью матриц оптимизации праймеров в 48-луночном планшете и оценки наилучшего отношения Ct / ΔRn. Различные праймеры также были проверены на их специфичность с использованием программы поиска сходства нуклеотидов-нуклеотидов в базе данных BLAST (44). Кроме того, для оценки специфичности амплификации анализ кривой плавления продукта проводили после последнего цикла каждой амплификации.Затем данные, полученные в результате амплификации, были преобразованы для получения количества бактериальных клеток (Log КОЕ / г фекалий) в соответствии с количеством копий рРНК, доступным в базе данных количества копий рРНК (45). Стандартные кривые были построены с использованием продуктов ПЦР 16S рРНК типовых штаммов каждого микроорганизма-мишени; использовались стандартные микроорганизмы: B. breve ReO2, Lactobacillus plantarum ATCC 14917, B. fragilis DSM 2151, B. breve B632 DSM 20213, Clostridium sporogenes ATCC 319, coli ATCC 8739. Продукты ПЦР очищали с помощью коммерческой системы очистки ДНК (набор NucleoSpin® Extract II, MACHEREY-NAGEL GmbH & Co. KG, Германия) и концентрацию измеряли спектрофотометрически при 260 нм. Были выполнены серийные разведения, и для калибровки использовали 10 2 , 10 3 , 10 4 , 10 5 , 10 6 , 10 7 копий гена на реакцию. Реакции с образцами проводили трижды, с отрицательным контролем для каждой реакции.

Статистический анализ

Данные выражены как среднее ± стандартное отклонение. Перекошенные переменные были преобразованы в журнал. Ежедневные данные были разделены на 9 категорий, представляющих среднее значение за 10 последовательных дней (от 0 до 90 дней).

Согласно первичному результату, выборка из 58 человек в группе была оценена как достаточная, чтобы продемонстрировать разницу между плацебо и пробиотиками в 0,70 Log КОЕ / г бифидобактерий со стандартным отклонением 1,6, степенью 90% и уровень значимости 95% и процент выбывания 20% согласно опубликованным данным, уже имеющимся во время разработки протокола (32).Согласно вторичному результату выборка из 55 человек в группе была оценена достаточной для снижения на 30% доли желудочно-кишечных расстройств (колики, срыгивание, рвота, запор) с предполагаемой распространенностью 40%, согласно данным литературы (1, 6).

Данные подсчета микробов были подвергнуты тесту Шапиро и тесту Бартлетта для проверки нормального распределения данных и однородности дисперсий. Базовые характеристики сравнивались с точным критерием Фишера для категориальных переменных и двухвыборочным тестом t или тестом Велча t , когда это необходимо для непрерывных переменных.Двухфакторный повторный анализ ANOVA был выполнен для оценки временного эффекта, лечебного эффекта и эффектов взаимодействия (модель 1) на зависимые переменные (минуты плача, характеристики стула, эпизоды рвоты и срыгивания, количество микробов). Использовалась сумма квадратов III типа. Впоследствии были введены следующие ковариаты: пол, тип родов (вагинальные, кесарево, оперативные), антибиотикопрофилактика во время родов (IAP), гестационный возраст, вес новорожденного (модель 2). Модель 3 также включала тип кормления в течение 90 дней (грудное вскармливание, искусственное вскармливание, смешанное вскармливание).Кроме того, в модели 2 и 3 вес, длина и окружность головы также были скорректированы с учетом соответствующей переменной при рождении. Все статистические анализы были выполнены с использованием статистического программного обеспечения R и SPSS для Windows версии 17.0 (SPSS Inc., Чикаго, Иллинойс, США).

Результаты

Исходные характеристики включенных новорожденных

При рождении 268 новорожденных были оценены на соответствие критериям, и их родители приняли участие в исследовании. Сто десять не вошли в исследование, потому что не явились на прием (46), отказались от исследования в тот же день (47) или были исключены из-за лечения антибиотиками после рождения (5).158 субъектов были случайным образом распределены в группу плацебо или пробиотиков. Три из них были потеряны при последующем наблюдении и были исключены (рисунок). Из 155 новорожденных, включенных в протокол, 130 находились на грудном вскармливании (59 плацебо, 71 пробиотик) и 25 находились на искусственном вскармливании (14 плацебо, 11 пробиотиков). Восемьдесят один мужчина и 74 женщины. Кроме того, 139 новорожденных родились вагинально, 10 - кесаревым и 6 - оперативным путем. Все матери были здоровы, не страдали хроническими заболеваниями. Пятнадцать матерей получили ИАП.Во время исследования у трех матерей был эпизод гриппа (2 субъекта в группе кормления грудью и 1 субъект в группе кормления смесью). Ни одна мать не получала лечение антибиотиками во время кормления грудью.

В таблице представлены клинические данные и микробиологические показатели кала на исходном уровне в двух группах распределения (новорожденные, получавшие плацебо и пробиотики). Только Lactobacillus spp. количество было выше в группе плацебо, чем в группе пробиотиков на исходном уровне.

Таблица 3

Ауксологические характеристики всей когорты на исходном уровне (T0) в соответствии с обработкой распределения.

± 901 1,2 (окружность головы ) см)
Плацебо Пробиотик
Пол (М / Ж) 34/39 47/35 903 недель 39,3 ± 1,0
Масса новорожденного (г) 3307,9 ± 397,5 3298,5 ± 362,7
Длина (см) 50,1 ± 2,0 9 Окружность головы 34.2 ± 1,4 33,9 ± 1,1
Рождение (V / C / O) 63/7/3 76/3/3
Дни жизни 10,6 ± 1,9 10,4 ± 2,4
Кормление грудью / из бутылочки 59/14 71/11
Ежедневный плач (мин) 25,5 ± 28,8 28,8 ± 37,7
Частота стула 3,8 ± 16 1,8 4,1 ± 1,9
Эпизоды срыгивания 1.7 ± 1,8 1,6 ± 1,4
Эпизоды рвоты 0,1 ± 0,2 0,2 ± 0,4

Поскольку хорошо известно, что кормление влияет на микробный состав кишечника, а также на клинические проявления у новорожденных, мы исследовали, отличались ли младенцы на грудном и искусственном вскармливании в начале исследования. В дополнительной таблице 1 представлены клинические данные и микробиологические показатели кала на исходном уровне в двух группах (новорожденные на грудном и искусственном вскармливании).Время плача ( p <0,05) и частота стула были выше ( p <0,04), а эпизоды срыгивания были менее частыми ( p <0,05) у младенцев, находящихся на грудном вскармливании. Общее количество энтеробактерий ( p <0,004), E. coli ( p <0,03) и B. fragilis в группе ( p <0,01) было ниже у новорожденных, находящихся на грудном вскармливании, чем у новорожденных, находящихся на искусственном вскармливании. с поправкой на искажающие факторы (пол, гестационный возраст, вес новорожденного, тип родов, ВБД и дни жизни на дату поступления).

Микробиологические результаты во всей когорте после введения пробиотика и плацебо

В таблице показано среднее общее количество микробов, полученное в двух группах образцов: пробиотика и плацебо. Этот анализ показал значительное увеличение количества B. breve на на через 3 месяца. Остальные микробные группы не показали значительной разницы.

Таблица 4

Среднее количество (Log КОЕ / г фекалий) различных микробных групп, проанализированных в образцах стула всей когорты.

90 ± 1,5 ± 1,36
Target Пробиотик T0 Пробиотик T1 Плацебо T0 Плацебо T1
7,00 ± 1,41 7,51 ± 0,88 6,88 ± 1,14 7,29 ± 1,06
B. breve 4,45 ± 1,85 6,40 ± 1,31 162 * 5,33 ± 1,5
Энтеробактерии 6,54 ± 1,23 6,38 ± 1,14 6,02 ± 1,4 6,5 ± 1,02
E. coli 6,72 6,35 ± 2,07 7,42 ± 1,24
Lactobacillus spp. 6,56 ± 1,28 5,60 ± 1,23 6,22 ± 1,06 5,28 ± 1,48
B.fragilis группа 7,44 ± 2,14 7,62 ± 1,97 6,79 ± 2,19 7,23 ± 2,00
C. difficile 2,66 ± 1,48 2,82 ± 1,5 ± 1,58

После этой первой оценки и с учетом различных размеров образцов новорожденных, находящихся на грудном и искусственном вскармливании, а также различий в исходном количестве микробов в этих двух группах, был проведен анализ, разделяющий новорожденных на грудном вскармливании и новорожденных, вскармливаемых из бутылочки. .

Оценка данных лечения пробиотиками новорожденных на грудном вскармливании

На исходном уровне в группе плацебо была меньшая частота стула ( p <0,03) и меньшее количество энтеробактерий, чем в группе пробиотиков ( p <0,01), также с поправкой на искажающие факторы (пол, гестационный возраст, вес новорожденного, тип родов и дни жизни на дату поступления). Предельные средние значения частоты стула и количества энтеробактерий: 3,2 ± 0,4 против 4,3 ± 0,3 ( p <0.01) и 5,86 ± 0,36 против 6,01 ± 0,38 Log КОЕ / г ( p <0,03) соответственно.

Комплаентность к лечению высокая. Все родители ответили на телефонные звонки. 98,7% из них правильно вернули пустые флаконы. О нежелательных явлениях не сообщалось. Трое младенцев (1 в группе плацебо и 2 в группе пробиотика) получали симетикон в течение нескольких дней (<30 дней) из-за срыгивания.

Через 90 дней 100 (43 в группе плацебо, 57 в группе пробиотиков) из 130 новорожденных все еще находились на грудном вскармливании.Из оставшихся 30 младенцев 7 находились на искусственном вскармливании (5 в плацебо, 2 в пробиотике), а остальные 23 находились на смешанном вскармливании (11 в плацебо, 12 в пробиотике).

Клинические данные

Учитывая клинические данные, количество минут плача ( p <0,005) уменьшалось с течением времени без эффекта лечения также в скорректированных моделях.

Число эвакуаций уменьшалось с течением времени ( p <0,0001) с эффектом лечения у тех, кто родился после 40 недель гестационного возраста ( p <0.03). Консистенция стула была больше 5-го типа по Бристольской диаграмме стула ( p <0,03) с течением времени. Дети, рожденные после 40 недель гестационного возраста, чаще имели тип 6 по Бристольской таблице стула у детей, получавших пробиотики ( p <0,0001).

Количество эпизодов срыгивания постоянно уменьшалось с течением времени ( p <0,01) в группе пробиотиков в зависимости от группы плацебо в зависимости от типа кормления ( p <0,03, рисунок).

Количество ежедневных срыгиваний.Группа пробиотиков (сплошная линия) и группа плацебо (пунктирная линия). Новорожденные на грудном вскармливании (A) ; Новорожденные на искусственном вскармливании (B) ; Новорожденные на смешанном вскармливании (С) . Данные выражены как предельное среднее значение ± стандартная ошибка среднего. Данные значимы во взаимодействии ( p <0,04; модель 3). Остатки неоднородны по группам.

Эпизоды рвоты значительно уменьшились со временем в группе пробиотиков, но не в группе плацебо ( p <0,03). Более того, в течение 90 дней частота колик у младенцев была аналогичной в группе плацебо (4 пациента, 6.8%) и пробиотической группе (6 субъектов, 8,5%).

Интересно, что были изменены и ауксологические переменные. Младенцы, получавшие пробиотики, имели меньшую прибавку в весе во время исследования у тех, кто родился с кесаревым сечением ( p <0,03; рисунок), и у тех, кто все еще находился на грудном вскармливании или перешел на искусственное вскармливание во время исследования ( p <0,005) . Разнообразно, младенцы, получавшие пробиотики, имели большее увеличение окружности головы у детей, находящихся на искусственном вскармливании или при смешанном вскармливании ( p <0.01).

Изменение веса за 90 дней. Группа пробиотиков (серая полоса) и группа плацебо (черная полоса). Новорожденные, рожденные естественным путем (A) ; Новорожденные, рожденные путем кесарева сечения (B) ; Новорожденные в результате оперативных родов (С) . Данные выражены как предельное среднее значение ± стандартная ошибка среднего. Данные значимы во взаимодействии ( p <0,03; модель 2). T0: исходный. T1: после 90 дней приема плацебо / пробиотика.

В таблице описаны предельные средние модели 1. В дополнительной таблице 2 описаны также скорректированные модели.

Таблица 5

Клинические и антропометрические вариации в группе грудного вскармливания, полученные с помощью многофакторного анализа повторных измерений.

903,9
Target Пробиотик T0 Пробиотик T1 Плацебо T0 Плацебо T1

1 903 903 903 903 903 903 903 ± 2,9
32,1 ± 5,6 20.5 ± 3,7
Частота стула 4,3 ± 0,2 2,1 ± 0,1 3,9 ± 0,2 2,0 ± 0,1
Цвет стула 6,0 ± 0,1 5,7 ± 0,1 6,0 6,0 ± 0,1
Консистенция стула 5,8 ± 0,1 5,7 ± 0,1 6,0 ± 0,1 5,6 ± 0,1
Регургитация 2,0 ± 0,2 1,6 ± 0,28 ± 0,2 2,0 ± 0,3
Рвота 0,25 ± 0,05 0,11 ± 0,06 * 0,10 ± 0,05 0,20 ± 0,07
3465,6 ± 57,4 3321,5 ± 48,0 3452,2 ± 62,9
Длина (см) 50,1 ± 0,2 51,5 ± 0,2 50,2 ± 0,2 51,5 ± 0,2
33.9 ± 0,1 34,9 ± 0,1 34,3 ± 0,1 35,0 ± 0,1
Микробные данные

Общие энтеробактерии ( p <0,005), Bifidobacterium spp. ( p <0,001) и E. coli ( p <0,001) изменились со временем, но значимость была потеряна при корректировке на искажающие факторы. C. difficile не изменился.

У тех, кто лечился пробиотиками, B. fragilis членов группы уменьшилось с течением времени у рожденных естественным путем, тогда как у других младенцев увеличилось ( p <0.04). Более того, B. breve увеличивалось со временем у тех, кто лечился пробиотиками ( p <0,04). Микробиологические данные представлены в таблице.

Таблица 6

Среднее количество (Log КОЕ / г фекалий) различных микробных групп, проанализированных в образцах стула новорожденных, вскармливаемых грудью.

90
Target Пробиотик T0 Пробиотик T1 Плацебо T0 Плацебо T1
7,11 ± 0,38 7,91 ± 0,27 6,59 ± 0,34 7,78 ± 0,24
B. breve 4,64 ± 0,50 6,10 ± 0,47
62 * 5,8 ± 0,46
Энтеробактерии 6,01 ± 0,38 6,55 ± 0,35 5,86 ± 0,36 6,46 ± 0,34
E. coli 6,70 ± 0,57 6,70 ± 0,5751 6,40 ± 0,54 7,06 ± 0,48
Lactobacillus spp. 6,22 ± 0,33 5,55 ± 0,33 6,28 ± 0,29 6,27 ± 0,35
Группа B. fragilis 6,34 ± 0,64 7,33 ± 0,61 6,4
C. difficile 2,70 ± 0,42 2,89 ± 0,48 2,82 ± 0,37 3.01 ± 0,42

Оценка данных лечения пробиотиками новорожденных на искусственном вскармливании

Исходно в группе плацебо было меньше Lactobacillus spp. больше, чем пробиотический ( p <0,008). При корректировке на факторы, влияющие на факторы (пол, гестационный возраст, вес новорожденного и количество дней жизни на дату поступления), статистическая значимость была потеряна, тогда как количество групп B. fragilis было выше в группе пробиотиков (предельное среднее значение 6,62 ± 0). .53 против 8,62 ± 0,67 Log КОЕ / г, p <0,02).

Клинические данные

Принимая во внимание клинические данные как грубого, так и скорректированного анализа, не было обнаружено никаких изменений в минутах плача, частоте и плотности стула, эпизодах рвоты или срыгивания. Ни у одного ребенка в обеих группах не было коликов. Вес ( p <0,0006), длина ( p <0,01) и окружность головы ( p <0,005) увеличивались со временем без эффекта лечения.

Микробные данные

Всего энтеробактерий и E.coli не менялась со временем. Bifidobacterium spp. ( p <0,02) и C. difficile увеличивались ( p <0,04) со временем без эффекта лечения. В группе, получавшей пробиотики, B. fragilis ( p <0,03) снизились, а B. breve увеличились ( p <0,03) со временем соответственно. Микробиологические данные представлены в таблице.

Таблица 7

Среднее количество (Log КОЕ / г лиц) различных микробных групп, проанализированных в образцах стула новорожденных, вскармливаемых из бутылочки.

90
Target Пробиотик T0 Пробиотик T1 Плацебо T0 Плацебо T1
6,80 ± 0,36 7,56 ± 0,36 6,79 ± 0,30 7,35 ± 0,30
B. breve 4,20 ± 0,35 6,42 ± 0,37 162 * 90.11 ± 0,31 5,09 ± 0,33
Энтеробактерии 7,30 ± 0,41 6,97 ± 0,34 6,75 ± 0,36 7,14 ± 0,30
E. coli ± 0,62 6,67 ± 0,66 7,51 ± 0,54
Lactobacillus spp. 6,81 ± 0,29 6,00 ± 0,35 6,05 ± 0,26 6,39 ± 0,31
B.fragilis группа 8,65 ± 0,61 7,98 ± 1,84 * 7,56 ± 0,56 8,33 ± 0,51
C. difficile 2,54 ± 0,43 903,16 3,35 ± 0,46

Обсуждение

Использование бифидобактерий в качестве пробиотиков у младенцев установлено при некоторых кишечных заболеваниях, наиболее частым из которых является диарея (25). Однако, хотя исследований in vitro и подтверждают использование бифидобактерий против газообразующих колиформ (26), до сих пор не проводилось клинических испытаний их использования против детских колик.Эта работа была сосредоточена на оценке влияния на функциональные желудочно-кишечные симптомы, включая колики, интеграции детского питания с пробиотическим составом на основе B. breve .

Исследование ясно показало способность введенных штаммов B. breve выживать после желудочного транзита и достигать кишечника новорожденного. Фактически, хотя B. breve был обнаружен во всех образцах фекалий, при введении штамма было показано значительное увеличение.В согласии с Lee et al. (13), снижение количества Lactobacillus на , с течением времени наблюдалось во всех группах новорожденных, и это особенно очевидно в группе, получавшей пробиотики. Это может быть связано с высокой способностью Bifidobacterium spp. влиять на состав микробиоты кишечника, усиливая цветение одних видов и уменьшая количество других, как это наблюдалось в других исследованиях, касающихся введения Bifidobacterium (25).

Известно, что тип кормления играет решающую роль в формировании микробиоты кишечника младенца (25, 48).Наше исследование показывает, что при зачислении, когда уже проводилось 7–15 дней кормления грудью или из бутылочки, некоторые различия присутствовали в группах с разным типом кормления: общее количество энтеробактерий и E. coli было выше в группах. на искусственном вскармливании, чем у новорожденных, находящихся на грудном вскармливании, также с поправкой на мешающие факторы. Кроме того, на исходном уровне у младенцев, находящихся на искусственном вскармливании, было обнаружено более высокое количество B. fragilis , что согласуется с более высоким риском инфекции, обычно наблюдаемым у младенцев, не находящихся на грудном вскармливании (49).Это более высокое количество также было очевидным после лечения, как в группе пробиотиков, так и в группе плацебо, подтверждая абсолютную важность начального типа кормления для формирования микробиоты кишечника и, в частности, для уменьшения количества грамотрицательных бактерий. Однако у младенцев, находящихся на искусственном вскармливании, среднее количество B. fragilis было выше в конце лечения в группе плацебо по сравнению с пробиотической, что указывает на возможный положительный эффект от введения B. breve . по крайней мере, до отлучения от груди.Увеличение B. breve также наблюдается у новорожденных на грудном вскармливании, не получавших пробиотики, и это, как уже упоминалось ранее, еще раз подчеркивает положительную роль грудного молока в формировании сообщества бифидобактерий, также учитывая, что B. breve - один из самых распространенных видов в кишечнике новорожденных (50). Это увеличение также подтверждается присутствием в грудном молоке пептидов и олигосахаридов, которые стимулируют рост бифидобактерий (47).

В дополнение к данным о микробах, это исследование направлено на мониторинг типичных желудочно-кишечных симптомов колик, то есть срыгивания, рвоты и запора, с которыми трудно справиться для лиц, осуществляющих уход. Результаты, полученные на применяемых моделях, показали уменьшение количества эвакуаций и улучшение консистенции стула у новорожденных, находящихся на грудном вскармливании, после 90 дней приема пробиотиков. Кроме того, у новорожденных, находящихся на искусственном вскармливании, отмечалось улучшение цвета стула. Эти данные свидетельствуют об улучшении желудочно-кишечного транзита, что может быть связано с приемом пробиотиков.Более того, количество срыгиваний и эпизодов рвоты уменьшилось после лечения пробиотиками. Подобные результаты уже были продемонстрированы с добавлением L. reuteri (6). Уменьшение этих симптомов особенно важно, поскольку они также уменьшают беспокойство родителей и связанные с этим последствия.

Уменьшение срыгивания и рвоты не было показано в группе новорожденных, находящихся на искусственном вскармливании. На этот результат может повлиять небольшой размер группы новорожденных, находящихся на искусственном вскармливании.Исследование не было разработано для оценки различий между двумя режимами кормления, и авторы осведомлены о том, что группа, получавшая искусственное вскармливание, была недостаточна для достижения клинических результатов. Однако данные, относящиеся к разному кормлению, следует анализировать отдельно из-за неожиданных существенных различий в микробном составе на исходном уровне. С другой стороны, у тех, кто находился на грудном вскармливании при наборе, которые перешли на искусственное или смешанное вскармливание, наблюдалось улучшение с уменьшением эпизодов срыгивания. Это важное достижение также с учетом того, что количество новорожденных, находящихся на искусственном вскармливании с самого начала жизни, как правило, невелико, поскольку обычно применяется начало кормления грудным молоком (51).

В этом исследовании продолжительность ежедневного плача младенцев не показала каких-либо различий между группами пробиотиков и плацебо, несмотря на улучшение желудочного транзита из-за введения пробиотиков. Этот результат контрастирует с другими сообщениями в литературе. Можно рассмотреть несколько причин, в первую очередь неточность подсчета минут плача в дневниках самоотчета, хотя и подтвержденных, особенно для такого длительного времени. Было продемонстрировано, что анализ любого существующего инструмента для наблюдения за ежедневным плачем неточен, труден или не подтвержден в течение длительного периода наблюдения (52).Более того, мы оценивали эффекты в течение 3 месяцев, тогда как большинство исследований относились к лечению пробиотиками не дольше 4 недель (1, 53). Более того, после вторых месяцев жизни могут играть роль другие мешающие факторы, в частности, если мы рассматриваем их эффективность в отношении других параметров желудочно-кишечного тракта. Кроме того, частота колик у младенцев была одинаковой, но очень низкой как в группах плацебо, так и в группах пробиотиков. Это следствие рассмотрения в исследовании здоровых новорожденных. В будущем необходимы исследования, включающие только младенцев с коликами.

Главный неожиданный и интересный результат исследования был связан с ауксологическими параметрами. Клинические испытания влияния пробиотиков на параметры роста новорожденных немногочисленны. В нашей популяции младенцы, рожденные с помощью кесарева сечения, имели более низкий догоняющий прирост веса, если их лечили пробиотиком. Этот результат имеет решающее значение для планирования дальнейших интервенционных исследований. Колонизация кишечника микроорганизмами окружающей среды происходит во время или сразу после рождения, тогда как у младенцев, рожденных с помощью кесарева сечения, колонизация кишечника задерживается и часто изменяется, в частности, с изменением количества Bifidobacterium и Lactobacillus (25).Растущие эпидемиологические данные свидетельствуют о том, что дети, рожденные путем кесарева сечения, имеют повышенный риск развития ожирения в более позднем возрасте (54, 55). Как генетический фон и окружающая среда влияют на механизмы, контролирующие аппетит, регуляцию веса и метаболические нарушения, связанные с избыточным весом, а также на иммунное образование, изучены недостаточно. Беременность, роды, послеродовое питание (лактация и отлучение от груди) были определены как критические периоды для программирования питания и гормонального контроля потомства.Некоторые авторы предполагают, что внезапное изменение начальных условий может нарушить физиологический процесс, предрасполагающий к определенным заболеваниям (46, 56, 57), и изменения в преждевременной колонизации играют определенную роль (54, 55). Наши данные предполагают, что лечение штаммами B. breve в первые 3 месяца жизни может влиять на состав микробиоты, и это связано с сопутствующим меньшим набором веса у населения с более высоким риском метаболических нарушений в более позднем возрасте.Другим авторам не удалось показать изменения веса новорожденных, получавших другие пробиотики (53, 58). Различия должны быть вторичными по отношению к штаммам или, что более вероятно, к срокам лечения, согласно нашему протоколу, рассчитанному на 3 месяца, в отличие от большинства исследований, в которых наблюдали младенцев в течение 1 месяца. В нашем исследовании влияние на вес было связано с увеличением окружности головы. Эти данные предполагают, что лечение пробиотиками защищает от нарушения роста, как недавно было продемонстрировано для мультиштаммового пробиотика, содержащего бифидобактерии, у детей с очень низкой массой тела при рождении, подвергшихся воздействию антибиотиков (59).

Основное ограничение этого исследования связано с небольшим размером выборки населения, находящегося на искусственном вскармливании. Однако это является следствием критериев включения (здоровые новорожденные) в состояние, при котором грудное вскармливание должно быть первым выбором (51). Кроме того, хотя мы использовали проверенный опросник для ежедневного плача младенца, другие опросники, используемые для регистрации других желудочно-кишечных симптомов, не прошли проверку. Напротив, сильные стороны нашего исследования - это лечение, продленное более чем на 4 недели, включение новорожденных, не подвергавшихся воздействию антибиотиков, оценка многих факторов, мешающих рождению, и изменений в кормлении с течением времени.

В заключение, наше исследование демонстрирует, что введенные штаммы B. breve могут достигать кишечника здоровых новорожденных, предотвращая функциональные желудочно-кишечные расстройства и снижая преждевременную прибавку в весе, по крайней мере, при отсутствии антибиотиков. О нежелательных явлениях не сообщалось, что свидетельствует о безопасности продукта в этой схеме. Перспективные продольные оценки должны быть полезны для дальнейшего изучения того, имеет ли преждевременное краткосрочное лечение в этом критическом окне преимущества в дальнейшей жизни.

Вклад авторов

DD и GB разработали и разработали исследование. EG и AS отвечали за набор пациентов и сбор клинических данных. IA и NB выполнили эксперименты по количественной ПЦР и внесли свой вклад в написание статьи. FP провела статистический анализ, интерпретировала результаты и способствовала написанию статьи. DD, SB, LB и FP критически отредактировали и одобрили окончательную рукопись. LM и MP разработали пробиотическую добавку.

Заявление о конфликте интересов

Авторы LM и MP были наняты компанией Biolab Research Srl, Новара, Италия, и выполняли все исследования и разработки для Probiotical SpA, Новара, Италия.Другие авторы заявляют, что исследование проводилось в отсутствие каких-либо коммерческих или финансовых отношений, которые могли бы быть истолкованы как потенциальный конфликт интересов.

Благодарности

Авторы выражают благодарность Роберте Рикотти, Элизабетте Мингоа, Эмануэле Монес, Франческе Арчеро и Мауро Заффарони за их техническую поддержку. Эта статья посвящена доктору Джованни Могна, который решительно поддержал описанное исследование.

Ссылки

1. Савино Ф, Пелле Э, Палумери Э, Оггеро Р., Миньеро Р. Lactobacillus reuteri (штамм 55730 американской коллекции типовых культур) по сравнению с симетиконом в лечении детских колик: проспективное рандомизированное исследование. Педиатрия (2007) 119: e124–30. 10.1542 / peds.2006-1222 [PubMed] [CrossRef] [Google Scholar] 2. Wessel MA, Cobb JC, Jackson EB, Harris GSJ, Detwiler AC. Приступы суеты в младенчестве, иногда называемые «коликами». Педиатрия (1954) 14: 421–35. [PubMed] [Google Scholar] 3. Zeevenhooven J, Koppen IJN, Benninga MA. Критерии Нового Рима IV для функциональных желудочно-кишечных расстройств у младенцев и детей ясельного возраста.Педиатр Гастроэнтерол Гепатол Нутр. (2017) 20: 1–13. 10.5223 / pghn.2017.20.1.1 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 4. Лукас А., Робертс ISJ. Плач, беспокойство и колики у младенцев, находящихся на грудном и искусственном вскармливании. Early Hum Dev. (1998) 53: 9–18. 10.1016 / S0378-3782 (98) 00032-2 [PubMed] [CrossRef] [Google Scholar] 5. Вик Т., Гроте В., Эскрибано Дж., Соха Дж., Вердучи Э., Фритч М. и др. . Детские колики, продолжительный плач и послеродовая депрессия у матери. Acta Paediatr. (2009) 98: 1344–8. 10.1111 / j.1651-2227.2009.01317.x [PubMed] [CrossRef] [Google Scholar] 6. Индрио Ф., Ди Мауро А., Риеццо Дж., Чиварди Е., Интини С., Корвалья Л. и др. . Профилактическое использование пробиотика для предотвращения колик, срыгивания и функциональных запоров - рандомизированное клиническое испытание. JAMA Pediatr. (2014) 168: 228–33. 10.1001 / jamapediatrics.2013.4367 [PubMed] [CrossRef] [Google Scholar] 7. Романелло С., Спири Д., Маркуцци Э., Занин А., Буазо П. и др. . Связь между детской мигренью и детской коликой в ​​анамнезе.JAMA J Am Med Assoc. (2013) 309: 1607–12. 10.1001 / jama.2013.747 [PubMed] [CrossRef] [Google Scholar] 8. Индрио Ф., Мауро А Ди, Риеццо Дж., Кавалло Л., Франкавилла Р. Детские колики, срыгивание и запор: ранний травматический инсульт в развитии функциональных желудочно-кишечных расстройств у детей? Eur J Pediatr. (2015) 174: 841–2. 10.1186 / 1824-7288-39-15 [PubMed] [CrossRef] [Google Scholar] 9. Бэнкс С., Томас М., Гордон М., Уоллес С., Акобенг А. Пробиотики для предотвращения детских колик. Кокрановская база данных Syst Rev.(2016) 12: 1–19. 10.1002 / 14651858.CD012473 [CrossRef] [Google Scholar] 10. Кандела М., Бьяджи Э., Маккаферри С., Туррони С., Бриджиди П. Микробиота кишечника - это пластический фактор, реагирующий на изменения окружающей среды. Trends Microbiol. (2012) 20: 385–91. 10.1016 / j.tim.2012.05.003 [PubMed] [CrossRef] [Google Scholar] 11. Секиров И., Рассел С.Л., Antunes LCM, Финлей ББ. Микробиота кишечника в здоровье и болезнях. Physiol Rev. (2010) 90: 859–904. 10.1152 / Physrev.00045.2009. [PubMed] [CrossRef] [Google Scholar] 12. Дюбуа NE, Грегори KE.Характеристика кишечного микробиома при детских коликах: результаты, основанные на интегративном обзоре литературы. Biol Res Nurs. (2016) 18: 307–15. 10.1177 / 10915620840 [PubMed] [CrossRef] [Google Scholar] 13. Lee SA, Lim JY, Kim B, Cho SJ, Kim NY, Bin Kim O, Kim Y. Сравнение профиля кишечной микробиоты у корейских младенцев, вскармливаемых грудью и вскармливаемыми смесями, с использованием пиросеквенирования. Nutr Res Pract. (2015) 9: 242–8. 10.4162 / nrp.2015.9.3.242 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 14. Маццола Дж., Мерфи К., Росс Р.П., Ди Джоя Д., Биавати Б.Ранние нарушения микробиоты кишечника после внутриродовой антибиотикопрофилактики для предотвращения стрептококковой инфекции группы B. PLoS ONE (2016) 11: e0157527. 10.1371 / journal.pone.0157527 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 15. Azad MB, Mph TK, Maughan H, Guttman DS, Field CJ, Chari RS и др. . Микробиота кишечника здоровых канадских младенцев: профили в зависимости от способа родов и питания младенцев в 4 месяца. CMAJ (2013) 185: 385–94. 10.1503 / cmaj.130147 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 16.Abrahamsson TR, Jakobsson HE, Andersson AF, Engstrand L, Jenmalm MC. Низкое разнообразие микробиоты кишечника у младенцев с атопической экземой. J Allergy Clin Immunol. (2005) 129: 434–40. 10.1016 / j.jaci.2011.10.025 [PubMed] [CrossRef] [Google Scholar] 17. Гуаральди Ф., Сальватори Г. Влияние грудного вскармливания и искусственного вскармливания на формирование кишечной микробиоты у новорожденных. Front Cell Infect Microbiol. (2012) 2:94. 10.3389 / fcimb.2012.00094 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 18. Савино Ф., Куартьери А., Де Марко А., Гарро М., Амаретти А., Раймонди С. и др.. Сравнение младенцев на искусственном вскармливании с коликами и без них выявило значительные различия в количестве бактерий, энтеробактерий и аммиака в фекалиях. Acta Paediatr. (2017) 106: 573–8. 10.1111 / apa.13642 [PubMed] [CrossRef] [Google Scholar] 19. Тейлор А.Л., Хейл Дж., Вильчут Дж., Леманн Х., Данстан Дж. А., Прескотт С.Л. Влияние пробиотических добавок в течение первых 6 месяцев жизни на аллергеноспецифичные иммунные реакции. Clin Exp Allergy (2006) 36: 1227–35. 10.1111 / j.1365-2222.2006.02553.x [PubMed] [CrossRef] [Google Scholar] 20.Ресслер А., Фридрих У., Фогельсанг Х., Бауэр А., Каатц М., Хиплер Калифорнийский университет и др. . Пробиотическое вмешательство, по-видимому, по-разному влияет на иммунную систему здоровых взрослых и пациентов с атопическим дерматитом. Clin Exp Allergy (2007) 38: 93–102. 10.1111 / j.1365-2222.2007.02876.x [PubMed] [CrossRef] [Google Scholar] 21. Szajewska H, ​​Gyrczuk E, Horvath A. Lactobacillus reuteri DSM 17938 для лечения младенческих колик у младенцев на грудном вскармливании: рандомизированное двойное слепое плацебо-контролируемое исследование.J Pediatr. (2013) 162: 257–62. 10.1016 / j.jpeds.2012.08.004 [PubMed] [CrossRef] [Google Scholar] 22. Чау К., Лау Е., Гринберг С., Якобсон С., Яздани-Брожени П., Верма Н. и др. . Пробиотики для лечения детских колик: рандомизированное двойное слепое плацебо-контролируемое исследование, изучающее Lactobacillus reuteri DSM 17938. J Pediatr. (2015) 166: 74–8.e1. 10.1016 / j.jpeds.2014.09.020 [PubMed] [CrossRef] [Google Scholar] 23. Савино Ф., Форнасеро С., Сератто С., Де Марко А., Мандрас Н., Роана Дж. И др. . Пробиотики и здоровье кишечника у младенцев: предварительное обсервационное исследование случай - контроль по раннему лечению с помощью Lactobacillus reuter i DSM 17938.Clin Chim Acta (2015) 451: 82–7. 10.1016 / j.cca.2015.02.027 [PubMed] [CrossRef] [Google Scholar] 24. Савино Ф., Кордиско Л., Тараско В., Локателли Е., Ди Джоя Д., Оггеро Р. и др. . Антагонистический эффект штаммов Lactobacillus против газообразующих колиформ, выделенных у младенцев, страдающих коликами. BMC Microbiol. (2011) 11: 157. 10.1186 / 1471-2180-11-157 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 25. Di Gioia D, Aloisio I, Mazzola G. Бифидобактерии: их влияние на состав микробиоты кишечника и их применение в качестве пробиотиков у младенцев.Appl Microbiol Biotechnol. (2014) 98: 563–77. 10.1007 / s00253-013-5405-9 [PubMed] [CrossRef] [Google Scholar] 26. Алоизио I, Сантини С., Биавати Б., Динелли Г., Ченчи А., Чингвару В. и др. . Характеристика Bifidobacterium spp. штаммы для лечения кишечных расстройств у новорожденных. Appl Microbiol Biotechnol. (2012) 96: 1561–76. 10.1007 / s00253-012-4138-5 [PubMed] [CrossRef] [Google Scholar] 27. Ли Й, Шимицу Т., Хосака А., Канеко Н., Оцука Ю., Ямаширо Ю. Влияние добавок Bifidobacterium breve на кишечную флору младенцев с низкой массой тела при рождении.Педиатрия Int. (2004) 46: 509–15. 10.1111 / j.1442-200x.2004.01953.x [PubMed] [CrossRef] [Google Scholar] 28. Вада М., Нагата С., Сайто М., Симидзу Т., Ямаширо Ю., Мацуки Т. и др. . Влияние энтерального введения Bifidobacterium breve на пациентов, проходящих химиотерапию по поводу детских злокачественных новообразований. Поддержите лечение рака (2010) 18: 751–9. 10.1007 / s00520-009-0711-6 [PubMed] [CrossRef] [Google Scholar] 29. Костелое К., Харди П., Ющак Э., Вилкс М., Миллар М.Р. Bifidobacterium breve BBG-001 у очень недоношенных новорожденных: рандомизированное контролируемое исследование фазы 3.Ланцет (2016) 387: 649–60. 10.1016 / s0140-6736 (15) 01027-2 [PubMed] [CrossRef] [Google Scholar] 30. Патоле С.К., Рао С.К., Кейл А.Д., Натан Э.А., Доэрти Д.А., Симмер К.Н. Преимущества добавки Bifidobacterium breve M-16V у недоношенных новорожденных - ретроспективное когортное исследование. PLoS ONE (2016) 11: e0150775. 10.1371 / journal.pone.0150775 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 31. Могна Л., Дель Пиано М., Могна Г. Способность двух микроорганизмов Bifidobacterium breve B632 и Bifidobacterium breve BR03 колонизировать кишечную микробиоту детей.J Clin Gastroenterol. (2014) 48: S37–9. 10.1097 / MCG.0000000000000234 [PubMed] [CrossRef] [Google Scholar] 32. Simone M, Gozzoli C, Quartieri A, Mazzola G, Di Gioia D, Amaretti A и др. . Пробиотик Bifidobacterium breve B632 Подавлял рост Enterobacteriaceae в культурах детской микробиоты, пораженной коликами. Biomed Res Int. (2014) 2014: 1–7. 10.1155 / 2014/301053 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 33. Quagliariello A, Aloisio I, Bozzi Cionci N, Luiselli D, Auria GD, Martinez-priego L, et al.. Влияние > Bifidobacterium breve на микробиоту кишечника детей с глютеновой диете на безглютеновой диете: пилотное исследование. Питательные вещества (2016) 8: 660–76. 10.3390 / nu8100660 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 34. Малинен Э., Кассинен А., Ринттила Т., Палва А. Сравнение ПЦР в реальном времени с анализами SYBR Green I или 5 9-нуклеаз и дот-блот-гибридизацией с олигонуклеотидными зондами, нацеленными на рДНК, при количественной оценке выбранных фекальных бактерий. Микробиология (2003) 149: 269–77.10.1099 / mic.0.25975-0 [PubMed] [CrossRef] [Google Scholar] 35. Пендерс Дж., Винк С., Дриссен К., Лондон Н., Тийс С., Стобберинг Э. Количественная оценка Bifidobacterium spp., Escherichia coli и Clostridium difficile в образцах фекалий младенцев, вскармливаемых грудью и вскармливаемых смесями, с помощью ПЦР в реальном времени. FEMS Microbiol Lett. (2005) 243: 141–7. 10.1016 / j.femsle.2004.11.052 [PubMed] [CrossRef] [Google Scholar] 36. Ринттила Т., Кассинен А., Малинен Э., Крогиус Л., Палва А. Разработка обширного набора праймеров, нацеленных на 16S рДНК, для количественной оценки патогенных и аборигенных бактерий в образцах фекалий с помощью ПЦР в реальном времени.J Appl Microbiol. (2004) 97: 1166–77. 10.1111 / j.1365-2672.2004.02409.x [PubMed] [CrossRef] [Google Scholar] 37. Кастильо М., Мартин-Оруэ С.М., Мансанилла Э.Г., Бадиола И., Мартин М., Гаса Дж. Количественная оценка общего количества бактерий, энтеробактерий и лактобактерий в пищеварительном тракте свиней с помощью ПЦР в реальном времени. Vet Microbiol. (2006) 114: 165–70. 10.1016 / j.vetmic.2005.11.055 [PubMed] [CrossRef] [Google Scholar] 38. Пендерс Дж., Тийс С., Винк С., Стелма Ф.Ф., Снидерс Б., Куммелинг И., ван ден Брандт П.А., Стобберинг Э. Факторы, влияющие на состав кишечной микробиоты в раннем детстве.Педиатрия (2006) 118: 511–21. 10.1542 / peds.2005-2824 [PubMed] [CrossRef] [Google Scholar] 39. Хаарман М., Кнол Дж. Количественные ПЦР-анализы в реальном времени для идентификации и количественного определения фекальных видов Bifidobacterium у младенцев, получающих пребиотическую смесь для грудных детей. Appl Environ Microbiol. (2005) 71: 2318–24. 10.1128 / AEM.71.5.2318-2324.2005 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 40. Leser TD, Amenuvor JZ, Jensen TK, Lindecrona RH, Boye M, Møller K. Независимый от культуры анализ кишечных бактерий: повторный визит микробиоты желудочно-кишечного тракта свиней.Appl Environ Microbiol. (2002) 68: 673–90. 10.1128 / AEM.68.2.673 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 41. Барр Р.Г., Крамер М.С., Буашоли К., Маквей-Уайт Л., Плесс И.Б. родительский дневник детского крика и суетливого поведения. Arch Dis Childh. (1988) 63: 380–7. 10.1136 / adc.63.4.380 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 42. Переулок М.М., Чижевский Д.И., Мпч БПК, Шульман Р.Дж. Надежность и валидность модифицированной бристольной шкалы формы стула для детей. J Pediatr. (2011) 159: 437–41.e1. 10.1016 / j.jpeds.2011.03.002 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 43. Aloisio I, Mazzola G, Corvaglia LT, Tonti G, Faldella G, Biavati B и др. . Влияние антибиотикопрофилактики во время родов против Streptococcus группы B на ранний состав кишечника новорожденных и оценка антистрептококковой активности штаммов Bifidobacterium . Appl Microbiol Biotechnol. (2014) 98: 6051–60. 10.1007 / s00253-014-5712-9 [PubMed] [CrossRef] [Google Scholar] 44. Альтшул С.Ф., Гиш В., Миллер В., Майерс Е. В., Липман Д. Д..Базовый инструмент поиска локального выравнивания. J Mol Biol. (1990) 215: 403–10. 10.1016 / S0022-2836 (05) 80360-2 [PubMed] [CrossRef] [Google Scholar] 45. Ли ZMP, Bussema C, Schmidt TM. rrn DB: Документирование количества генов рРНК и тРНК у бактерий и архей. Nucleic Acids Res. (2009) 37: 489–93. 10.1093 / nar / gkn689 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 46. Индрио Ф., Мартини С., Франкавилла Р., Корвалья Л., Кристофори Ф., Мартини С. Эпигенетические вопросы: связь между ранним питанием, микробиомом и долгосрочным развитием здоровья.Фронт Педиатр. (2017) 5: 178. 10.3389 / fped.2017.00178 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 47. Лиепке С., Адерманн К., Райда М., Магерт Х.-Дж., Форссманн В., Цухт HD. Грудное молоко содержит пептиды, которые сильно стимулируют рост бифидобактерий. Eur J Biochem. (2002) 269: 712–8. 10.1046 / j.0014-2956.2001.02712.x [PubMed] [CrossRef] [Google Scholar] 48. Обермайер Т., Грабнар И., Бенедик Э., Тушар Т., Пикель Т.Р., Мис Н.Ф., Матияшич Б.Б., Рогель И. Микробы в развитии кишечника младенца: определение изобилия в параметрах окружающей среды, клинических условиях и росте.Научный доклад (2017) 7: 11230. 10.1038 / s41598-017-10244-x [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 50. Фавье К.Ф., Воан Э.Э., Де Вос В.М., Аккерманс АДЛ. Молекулярный мониторинг сукцессии бактериальных сообществ у новорожденных человека. Общество (2002) 68: 219–26. 10.1128 / AEM.68.1.219 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 51. Макфадден А., Гэвин А., Ренфрю М., Уэйд А., Бьюкенен П., Тейлор Дж. И др. . Поддержка здоровых кормящих матерей со здоровыми доношенными детьми. Кокрановская база данных Syst Rev.(2017) 2: 1-224. 10.1002 / 14651858.CD001141 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 52. Гарсиа Маркес С., Чильон Мартинес Р., Гонсалес Сапата С., Реболло Салас М., Хименес Реджано Х. Дж. Инструменты оценки и диагностики детских колик: систематический обзор. Child Care Health Dev. (2017) 43: 481–8. 10.1111 / cch.12454 [PubMed] [CrossRef] [Google Scholar] 53. Сюй М., Ван Дж., Ван Н., Сунь Ф., Ван Л., Лю X. Эффективность и безопасность пробиотической бактерии Lactobacillus reuteri DSM 17938 для младенческой колики: метаанализ рандомизированных контролируемых испытаний.PLoS ONE (2015) 10: 1–16. 10.1371 / journal.pone.0141445 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 54. Магне Ф., Пучи Силва А., Каравахал Б., Готтеланд М. Повышенная частота кесарева сечения и его вклад в неинфекционные хронические заболевания в Латинской Америке: растущее участие микробиоты. Фронт Педиатр. (2017) 5: 192. 10.3389 / fped.2017.00192 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 55. Kuhle S, Тонг OS, Woolcott CG. Связь детского ожирения и беременности между кесаревым сечением и детским ожирением: систематический обзор и метаанализ.Obes Rev. (2015) 16: 295–303. 10.1111 / obr.12267 [PubMed] [CrossRef] [Google Scholar] 56. Де Моура Э. Г., Лиссабон, ПК, Пассос, MCF. Неонатальное программирование нейроиммуномодуляции - роль адипоцитокинов и нейропептидов. Нейроиммуномодуляция (2008) 15: 176–88. 10.1159 / 000153422 [PubMed] [CrossRef] [Google Scholar] 58. Baldassarre ME, Di Mauro A, Mastromarino P, Fanelli M, Martinelli D, Urbano F и др. . Назначение женщинам в перинатальном периоде мультиштаммового пробиотического продукта по-разному влияет на цитокиновый профиль грудного молока и может оказывать благотворное влияние на функциональные симптомы желудочно-кишечного тракта новорожденных.рандомизированное клиническое испытание. Питательные вещества (2016) 8: 1–13. 10.3390 / nu8110677 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar] 59. Härtel C, Pagel J, Spiegler J, Buma J, Henneke P, Viemann D, et al. . Lactobacillus acidophilus / Bifidobacterium infantis пробиотики связаны с повышенным ростом VLBWI среди тех, кто подвергается воздействию антибиотиков. Sci Rep. (2017) 7: 1–11. 10.1038 / s41598-017-06161-8 [Бесплатная статья PMC] [PubMed] [CrossRef] [Google Scholar]

Терапевтическая эффективность Bifidobacterium animalis subsp.lactis BB-12 ® при коликах у младенцев: рандомизированное двойное слепое плацебо-контролируемое исследование

Задний план: Патогенез детской колики недостаточно изучен. Кажется, что в этом участвует кишечная микробиота, что подтверждает потенциальную терапевтическую роль пробиотиков.

Цели: Чтобы оценить частоту младенцев со снижением средней суточной продолжительности плача на ≥50% после 28 дней применения пробиотика Bifidobacterium animalis subsp.lactis BB-12 ® (BB-12). Вторичными результатами были ежедневное количество приступов плача, время сна, количество дефекаций и консистенция стула.

Методы: Рандомизированное контролируемое исследование (РКИ) с участием здоровых детей, находящихся на исключительно грудном вскармливании, с младенческими коликами, случайным образом распределенных для получения BB-12 (1 × 10 9 КОЕ / день) или плацебо в течение 28 дней. Были оценены структура кишечной микробиоты и уровни бутирата, бета-дефенсина-2 (HBD-2), кателицидина (LL-37), секреторного IgA (sIgA) и фекального кальпротектина.

Полученные результаты: Было рандомизировано 80 младенцев, по 40 на группу. Доля младенцев со снижением средней продолжительности плача на ≥50% была выше у младенцев, получавших ВВ-12, начиная с конца 2-й недели. На момент прекращения лечения ни у одного ребенка не было рецидива. Среднее количество приступов плача уменьшилось в обеих группах, но с более высоким эффектом в группе BB-12 (-4,7 ± 3,4 против -2,3 ± 2.2, P <0,05). Средняя частота ежедневного стула снизилась в обеих группах, но эффект был значительно выше в группе BB-12; консистенция стула была одинаковой в двух группах. В группе BB-12 наблюдалось увеличение численности Bifidobacterium (со значительной корреляцией с сокращением времени плача), бутирата и уровней HBD-2, LL-37, sIgA, связанных со снижением уровня кальпротектина в фекалиях.

Выводы: Добавка с BB-12 эффективна при младенческих коликах.Эффект может быть связан с иммунными и неиммунными механизмами, связанными с модуляцией структуры и функции кишечной микробиоты.

Пробиотик

может помочь в лечении колик у младенцев - ScienceDaily

Пробиотики - или «хорошие бактерии» - с переменным успехом использовались для лечения младенческих колик. В новом исследовании, опубликованном в журнале Alimentary Pharmacology & Therapeutics , исследователи показали, что капли, содержащие определенный пробиотический штамм ( Bifidobacterium animalis subsp.lactis BB-12) сократил продолжительность ежедневного плача более чем на 50% у 80% из 40 младенцев, получавших пробиотик один раз в день в течение 28 дней, что положительно повлияло на продолжительность сна, частоту и консистенцию стула. Это по сравнению с 32,5% из 40 младенцев, получавших плацебо.

Детские колики - очень распространенное желудочно-кишечное расстройство, которым страдают до 25% младенцев в первые 3 месяца жизни, и хотя это доброкачественное заболевание, оно является источником серьезных страданий для младенцев и их семей.Это связано с послеродовой депрессией у матери, преждевременным прекращением грудного вскармливания, чувством вины и разочарования родителей, синдромом сотрясения ребенка, многократными посещениями врача, употреблением наркотиков, сменой смеси и долгосрочными неблагоприятными исходами, такими как аллергия, проблемы с поведением и сном.

Эффект, наблюдаемый в исследовании, был связан с положительной модуляцией микробиома кишечника, с увеличением бактериальной продукции бутирата, короткоцепочечной жирной кислоты, которая способна положительно регулировать время прохождения через кишечник, восприятие боли, ось кишечник-мозг и воспаление.

«Наше исследование предоставляет доказательства важной роли кишечной микробиоты как объекта вмешательства против детских колик», - сказал старший автор исследования Роберто Берни Канани, доктор медицины, доктор философии Неаполитанского университета «Федерико II» в Италии. «Уместно подчеркнуть, что это испытание изучало конкретный хорошо охарактеризованный пробиотический штамм, и что эти результаты не могут быть экстраполированы на другие пробиотические штаммы».

История Источник:

Материалы предоставлены Wiley . Примечание. Содержимое можно редактировать по стилю и длине.

.

Добавить комментарий

Ваш адрес email не будет опубликован. Обязательные поля помечены *

*