Бифидумбактерин при лактозной недостаточности у грудничка: Так называемая лактазная недостаточность. Непереносимость лактозы у ребенка

Содержание

Так называемая лактазная недостаточность. Непереносимость лактозы у ребенка

Нет и не может быть никакого сомнения, что лучшей пищей для грудного младенца является материнское молоко. Искусственная смесь не в состоянии даже близко сравниться с ним по питательным свойствам. Оно усваивается в организме ребенка лучше любых заменителей. Однако широко распространено ошибочное мнение, что при любом желудочно-кишечном расстройстве у ребенка причину надо искать в неполноценности материнского молока, наличии в молоке болезнетворных микробов или в каком-то заболевании.

Бывает, что мама жалуется врачу: у малыша пенистый, водянистый и частый стул с кислым запахом, со слизью, зеленью и непереваренными комочками, а от этого — раздражение вокруг заднего прохода. Она говорит, что малыш беспокоится во время кормления, а живот у него болит иногда настолько сильно, что он отказывается от груди.

Несмотря на то, что ребенок хорошо прибавляет в весе, мама считает, что у нее плохое молоко. Врач, не знакомый с физиологией грудного вскармливания, только подтверждает ее сомнения: "У вас, наверное,

лактазная недостаточность, а может, и дисбактериоз. Надо проверить ваше молоко на стерильность". И начинаются нескончаемые дорогостоящие и ненужные анализы (кал на дисбактериоз, углеводы, копрограмма, посев молока и пр.). В молоке мамы обнаруживается стафилококк. Ребенка начинают лечить, заменяют материнское молоко суррогатом — безлактозной смесью. Все тревожные симптомы уходят. И все вздыхают с облегчением. В сознании укрепляется миф о том, что материнское молоко может быть плохим. Но такое даже в принципе невозможно!

Давайте разберемся, что же происходит на самом деле. Девяти месяцев внутриутробной жизни недостаточно для того, чтобы у новорожденного ребенка полностью созрели органы и системы. Молоко матери дает ему такую возможность. Состав молока меняется по мере роста младенца. В первые 3-4 дня жизни ребенок получает молозиво, затем переходное молоко.

Молозиво, несмотря на небольшое его количество, по своему составу более соответствует потребностям новорожденного ребенка, поэтому легко усваивается его организмом. По сравнению со зрелым грудным молоком оно содержит больше белков. В молозиве также меньше молочного сахара —

лактозы, жиров и водорастворимых витаминов, чем в зрелом грудном молоке. Однако в нем больше жирорастворимых витаминов и некоторых минеральных веществ, гормонов, иммунных и других защитных факторов.

Молозиво осуществляет местную защиту слизистой оболочки желудочно-кишечного тракта младенцев. Это позволяет рассматривать его не только как пищу, но и как биологически активный продукт, необходимый для нормального развития новорожденного в первые дни жизни. Вот почему так важно приложить новорожденного к груди уже через 20-30 минут после родов. А как часто этот важный момент упускается в роддоме!

Только со 2-3-й недели после родов грудное молоко женщины становится зрелым и приобретает относительно постоянный состав. В это время и начинают проявляться основные желудочно-кишечные расстройства у младенца.

Сейчас уже все знают, что зрелое молоко неоднородно. "Передняя" порция молока более водяниста (поэтому младенец в дополнительной воде не нуждается). В этой порции много лактозы (основного углевода женского молока), витаминов, минеральных веществ, иммуноглобулинов, которые защищают малыша. Ну, а в "задней" порции больше жиров и ферментов, помогающих переваривать молоко.

Лактоза усваивается в тонкой кишке под влиянием фермента лактазы. У младенца до 3 месяцев имеется физиологический дефицит этого фермента, и поэтому часть неусвоенной лактозы попадает в толстую кишку. Но это так и должно быть, ведь там под влиянием бактерий лактоза превращается в лактат и жирные кислоты с короткой цепью, а они являются источником энергии для нервных клеток и толстого кишечника. Кроме того, увеличивается кислотность кишечного содержимого, создавая неблагоприятную среду для болезнетворных микробов и способствуя росту полезных для пищеварения лактобактерий. Улучшается также всасывание кальция, железа, цинка и фосфора. Однако побочным продуктом происходящего в кишечнике малыша брожения являются газы.

Обилие газов у грудных детей является нормой и определяется интенсивностью бродильных процессов.

У некоторых детей фермент лактаза созревает позже обычного, но истинная лактазная недостаточность, обусловленная генетически и связанная с полным отсутствием или серьезным недостатком этого фермента, встречается крайне редко.

Почему же педиатры находят лактазную недостаточность чуть ли не у каждого второго ребенка? Как смогло бы выжить человечество, если это заболевание, приводящее к истощению и гибели (при отсутствии лечения), встречается, по их мнению, у половины младенцев?

А все дело в том, что описанные болезненные явления — это следствие ошибочных рекомендаций по вскармливанию. Ребенка неправильно кормят, он получает много богатого лактозой "переднего" молока, но "заднего", более жирного, не получает.

Незнание физиологии грудного вскармливания — это не вина педиатров, а скорее их беда. Ведь в последние 25 лет врачи имели дело преимущественно с детьми, вскормленными искусственными смесями. Сегодня в Москве до года грудью кормят всего 12% женщин, тогда как в начале прошлого века грудью вскармливались почти 100% малышей. Соответственно, многие знания врачей и лабораторные тесты применимы только к "искусственникам".

Так, ученые НИИ эпидемиологии и микробиологии им. Г.Н. Габричевского предлагают пересмотреть нормы содержания углеводов в кале у ребенка, находящегося на грудном вскармливании (до 1 мес. — 1%, 1-2 мес. — 0,8%, 2-4 мес. — 0,6%, 4-6 мес. — 0,45%, старше 6 мес. — принятые и ныне 0,25%). А по словам профессора Hernell O. из Швеции, у них углеводы в кале просто не ищут!

Итак, наличие сахара в стуле ребенка на грудном вскармливании — норма! А вот сахар в стуле ребенка на искусственном вскармливании — патология! Если у вашего ребенка зеленый, пенистый стул с непереваренными комочками, боли в животе, вздутие кишечника и он плохо прибавляет в весе, обратите внимание, прежде всего, на то, как вы его кормите.

Не торопитесь обследовать его кал и свое молоко, а тем более переводить малыша на искусственные смеси.

Грудное вскармливание — процесс очень простой, если не сказать элементарный. Но! Только в том случае, если вы выполняете несколько простых правил, без знания которых оно не может состояться:

  • Правильно прикладывайте ребенка к груди, иначе не будет ее достаточной стимуляции для выработки необходимого количества молока. Даже при частых кормлениях ребенку с неправильным прикладыванием трудно извлекать из груди "заднее", жирное молоко;
  • До полного созревания лактазы (3-4 месяца) кормите малыша не менее 10-12 раз в сутки, позволяя ему находится у груди столько, сколько он захочет;
  • Следите за тем, чтобы ребенок не просто сосал грудь, но еще и глотал молоко;
  • Не сцеживайтесь, так как это стимулирует выработку преимущественно "переднего молока";
  • Обязательно кормите младенца ночью, питание тогда получится более сбалансированным — ведь именно ночью вырабатывается больше "заднего" молока.

Если вы будете следовать этим правилам, то вам, скорее всего, не потребуется обследовать и лечить ребенка, применять лактазу, а тем более переводить малыша на искусственное вскармливание. Не нужно будет также ограничивать ваше питание, за исключением молока и сладостей. Не потребуются и биопрепараты.

Кстати, всегда читайте аннотации. Плантекс и бифидумбактерин, которые часто назначают малышам при жалобах на животик, содержат лактозу — следовательно, их применять нельзя. Абомин здесь совершенно не поможет, а только навредит.

Итак, прежде всего мы самостоятельно или с помощью консультанта по грудному вскармливанию налаживаем эффективное кормление малыша. А уже потом, если, несмотря на правильно организованное грудное вскармливание, ребенок продолжает мучиться от боли и терять вес, обращаемся к педиатру, который — за грудное вскармливание.

Бифидумбактерин при запорах у детей: как принимать

У детей при запорах Бифидумбактерин поможет нормализовать стул благодаря благоприятному воздействию на микрофлору кишечника.

Содержащиеся в лекарстве бифидобактерии подавляют патогенные микроорганизмы и восстанавливают нормальную работу пищеварительного тракта.

Применять его следует в соответствии с дозировкой, рекомендованной педиатром.

Показания для использования

Бифидумбактерин содержит бактерии, которые необходимы для нормальной работы пищеварительного тракта. Микроорганизмы, попадая в кишечник, создают неблагоприятную среду для роста и размножения патогенных микроорганизмов. Средство назначается детям, если:

Бифидумбактерин при запорах у детей не только устраняет проблему, но и повышает местный иммунитет.

Принцип работы Бифидумбактерина

Все формы лекарства в своем составе содержат бифидо- и лактобактерии в высушенном состоянии, но вполне жизнеспособные. Это желанные обитатели кишечного тракта человека, и после их попадания внутрь организма можно ожидать следующие эффекты:

  • Активизируется процесс пищеварения.
  • Восстанавливается моторика кишечника.
  • Стимулируются обменные процессы.
  • Нейтрализуются токсины, скопившиеся в результате задержки стула.
  • Укрепляется местный иммунитет.
  • Проходят тяжесть и вздутие.
  • Нормализуется микрофлора кишечника.

У недоношенных детей часто наблюдается нехватка собственной полезной микрофлоры, что влечет за собой нарушение стула, вздутие живота и другие неприятные симптомы. Поэтому педиатры назначают Бифидумбактерин при запорах у грудничков.

Если слабительные медикаментозные средства просто помогают избавиться от запоров, то Бифидумбактерин нормализует работу кишечника и естественным образом устраняет проблему задержки стула.

Инструкция по применению при запорах у детей

При хронической форме патологии лучше принимать Бифидумбактерин форте, эта форма более эффективна, так как бактерии защищены активированным углем. Это гарантирует быстрое прикрепление к стенкам кишечника.

Учитывая, что главная цель приема пробиотика – восстановить микрофлору и привести процесс дефекации в норму, то во время лечения малышей Бифидумбактерином важно соблюдать следующие рекомендации:

  1. Не получится устранить проблему за один прием. Давайте грудничку препарат курсами, длительность которых подскажет педиатр.
  2. Перед приемом бифидобактерий используйте глицериновые свечи грудничкам при запоре, чтобы освободить кишечник от токсинов.
  3. Лекарственное средство устранит проблему запора, если вы будете соблюдать рекомендации доктора по приему препарата.
  4. Через некоторое время обязательно повторите курс приема Бифидумбактерина, чтобы поддерживать на нормальном уровне количество полезных микроорганизмов.

Несмотря на безопасность препарата, всегда давайте его малышу в дозировке с учетом возраста. Схема лечения поэтому будет в разных возрастных группах отличаться.

Возрастная группа

Дозировка препарата

Длительность курса

Особенности применения

Новорожденные

Для новорожденных дозировка составляет 2,5 дозы (половина пакетика) два раза в день в первые три дня. Далее кратность можно повысить до 6 раз в сутки

Продолжительность приема – не менее двух недель

Давайте лекарство во время кормления.

Бифидумбактерин для новорожденных при запорах разбавляйте с грудным молоком или водой.

Используйте лекарство для лечения дисбактериоза

Груднички

До полугодовалого возраста ребенку давать три раза в день по 3 дозы препарата

Длительность терапии составляет около трех недель

Препарат давайте младенцам во время кормления

Дети от года и старше

До 3 лет Бифидумбактерин форте при запорах у детей рекомендуется давать по 1 пакетику три раза в день.

До 7 лет кратность приема повышается до 5 раз.

Детям старше семи лет разрешена дозировка по 2 пакетика 3-4 раза в день

Продолжительность лечения составляет не менее 3 недель, но индивидуально ее устанавливает врач с учетом состояния малыша и сложности проблемы. Наилучшая эффективность достигается при неоднократном применении курса

Средство давайте перед приемом пищи, желательно с кисломолочными продуктами, так оно лучше усваивается

При лечении констипации для разбавления порошка используйте только теплую воду, предварительно прокипяченную. В горячей бифидобактерии погибнут. Готовый раствор давайте малышу сразу, хранению он не подлежит.

Если использовать массаж при запоре у грудничка и проводить лечение пробиотиком, то справиться с проблемой можно гораздо быстрее.

Побочные эффекты

Препарат переносится детьми хорошо, только в единичных случаях он вызывает:

  • высыпания на коже;
  • зуд;
  • крапивницу.

Эти симптомы носят временный характер и исчезают после прекращения курса лечения. Если проявления доставляют грудничку сильный дискомфорт, то можно использовать Аципол при запорах у детей. Но есть одно уточнение, его разрешено применять только по достижении малышом трехмесячного возраста.

Противопоказания: когда нельзя давать препарат

Лекарство не рекомендуется пить детям, если имеется непереносимость лактозы или повышенная чувствительность к компонентам средства. В таких случаях используйте Хилак форте при запорах у детей. Его разрешено использовать даже при лечении новорожденных.

Ответы на популярные вопросы

С какого возраста можно давать Бифидумбактерин? Можно ли это лекарство новорожденным?

Препарат разрешен к использованию с рождения, но давая лекарство ребенку, строго соблюдайте дозировку.

Как быстро действует Бифидумбактерин?

Лекарство не является слабительным средством, поэтому не ожидайте мгновенного эффекта. Бифидобактерии нормализуют работу желудочно-кишечного тракта, подавляя патогенные микроорганизмы и усиливая перистальтику. Первые результаты терапии можно ожидать через неделю регулярного приема.

Какие существуют аналоги у препарата?

К таковым можно отнести несколько лекарственных средств с похожим терапевтическим эффектом:

  • Бифинорм. Средство ускоряет рост полезных микроорганизмов и уничтожает болезнетворные, помогает улучшить процесс пищеварения.
  • Лактобактерин. Отлично борется с запорами, устраняет повышенное газообразование.
  • Пробифор. Подходит для любой возрастной группы благодаря выпуску в разных лекарственных формах. Нормализует работу желудочно-кишечного тракта, поэтому может использоваться как при трудностях с дефекацией, так и при диарее.

Бифидумбактерин крепит или слабит стул?

Препарат не является слабительным или противодиарейным средством. В нем содержатся бактерии, которые мягко и постепенно приводят в норму соотношение полезных и вредных микроорганизмов, восстанавливая нормальный ритм опорожнения кишечника.

Может ли быть запор у грудничка от Бифидумбактерина?

Лекарственное средство не может вызвать запор у малышей во время приема, исключение составляют случаи, когда имеется лактазная недостаточность.

Можно ли принимать препарат при лактазной недостаточности?

Патология характеризуется недостаточной активностью фермента, расщепляющего лактозу или молочный сахар. Бифидумбактерин при такой патологии разрешено принимать, но лечение может вызвать задержку стула у ребенка.

Отзывы родителей

Учитывая, что каждый организм неоднозначно реагирует на прием лекарственных препаратов, отзывы на прием пробиотика можно встретить разные, но чаще положительные.

Наталья: «Малыш с рождения находился на искусственном вскармливании и запоры беспокоили постоянно. После начала приема препарата уже через несколько дней грудничок стал спокойнее, улучшился сон, аппетит, нормализовался стул. Но дозировку обязательно нужно согласовывать с врачом, чтобы не причинить вред малышу».

Евгения: «Начала давать препарат малышу по рекомендации педиатра. Младенец с трудом опорожнял кишечник, часто плакал от колик в животе. После начала приема Бифидумбактерина уже через три дня грудничок первый раз спокойно спал всю ночь. После недельного курса проблема больше не возникала».

Заключение

Бифидумбактерин поможет не только избавиться от запора у детей, но и улучшить состояние при других патологиях:

  • Инфекционные заболевания желудочно-кишечного тракта.
  • Отравление.
  • Заболевания органов пищеварительной системы.

Препарат поможет безболезненно перейти с кормления грудным молоком на питание молочными смесями.

Лечение трудностей с дефекацией у грудничков требует комплексного подхода, поэтому при появлении проблемы обсудите ее с педиатром, а не занимайтесь самолечением.

что нужно знать, какие симптомы проявляются, какой анализ должен назначить врач

От лактазной недостаточности в России сегодня лечат каждого пятого ребенка. Этот диагноз, который еще полтора десятилетия назад считался лишь научным термином, имеющим мало чего общего с практикой, сейчас стал более чем популярен.

Однако педиатры к единому мнению так и не пришли, а потому более спорный и непонятный вопрос, касающийся здоровья младенцев, найти сложно. Своим мнением о лактазной недостаточности делится и известный детский врач и автор книг, статей Евгений Олегович Комаровский.

Лактазная недостаточность — это отсутствие или временное снижение в организме специального фермента, который называется «лактаза». Она может расщеплять молочный сахар, который называется лактозой. Когда фермента мало, молочный сахар остается непереваренным, начинается его брожение в кишечнике.

Это проявляется частыми приступами диареи, коликами у младенцев, вздутием живота и повышенным газообразованием у детей постарше, болевыми ощущениями в животе, которые обычно появляются через полтора-два часа после того, как ребенок выпил молоко.

Чаще всего такой диагноз ставят детям, возраст которых – до года. Довольно редко недостаточностью лактазы страдают малыши до 6-7 лет.

После этого возраста происходит физиологическое угасание выработки фермента, поскольку природой не предусмотрено употребление молока взрослыми людьми.

Крайне редко патология сохраняется у взрослых, но это принято считать вариантом нормы, поскольку молоко для их организма не является важным продуктом.

Лактазная недостаточность может быть врожденной, первичной. Она бывает и вторичной, приобретенной. Такая недостаточность возникает в случае повреждения стенок тонкого кишечника. Это может быть следствием перенесенной инфекции (ротавирусной, энтеровирусной), токсического отравления, сильного поражения глистными инвазиями, аллергической реакции на коровий белок.

Чаще других дефицитом лактазы страдают недоношенные детки и малыши, которых перекармливают и которые получают молока больше, чем способны переварить.

В отношении этого диагноза у современной медицины вполне радужные прогнозы: в 99,9% случаев недостаточность фермента проходит самостоятельно, при устранении причин, которые ее вызвали.

Для взрослых лактазная недостаточность — не проблема, считает Евгений Комаровский. Ничего страшного не произойдет, если человек просто не будет употреблять в пищу молочные продукты. Однако для младенцев, у которых молоко — основа питания, все обстоит несколько сложнее.

Снижение уровня лактазы может быть генетически обусловленным, говорит Евгений Комаровский. Если мама или папа не переносят или в детстве не любили молоко, то вероятность рождения малыша с дефицитом лактазы довольно велика.

Однако Евгений Олегович подчеркивает, что настоящих случаев врожденной первичной недостаточности лактазы медицина знает очень мало (30-40). Это действительно очень больные дети, которые не набирают вес, постоянно обильно срыгивают, мучаются с животиком. Доля таких случаев — около 0,1%.

Во всех остальных случаях не обошлось без влияния фармацевтических магнатов, которым очень нужно продавать в больших объемах безлактозные молочные смеси для искусственного вскармливания. Стоят они значительно дороже другого питания, но родители, которых поставили в безвыходное положение, готовы заплатить сколько угодно, лишь бы младенец жил и развивался нормально.

У недоношенных детей нехватка лактазы может быть объяснена незрелостью организма, у них часто наблюдается транзиторная недостаточность. Она проходит сама — по мере созревания органов и систем. По выраженности заболевание может быть полным или частичным.

Евгений Комаровский подчеркивает, что настоящая лактазная недостаточность — случай довольно редкий. По этой причине бросать кормление грудью и переводить ребенка на безлактозные смести из-за подозрений на дефицит фермента лактазы не стоит.

Чтобы развеять сомнения или подтвердить диагноз, ставший таким популярным в последнее время, используются различные дополнительные диагностические методы:

  • определение уровня кислотности кала;
  • анализ на содержание углеводов;
  • диетические пробы.

В ходе анализов под наблюдением врача на время отменяют грудное вскармливание, адаптированные смеси.

Ребенку на протяжении 2-3 дней дают только безлактозные или соевые смеси. При снижении клинических проявлений ставят диагноз — «лактазная недостаточность».

Во всех случаях (кроме тяжелых врожденных, которые, как уже говорилось, встречаются лишь в 0,1% случаев) лактазная недостаточность носит сугубо временный характер.

Самая распространенная причина непереносимости молочного сахара у детей — банальный перекорм.

Родители так стараются накормить чадо, что дают ему количество смеси или молока, которое превышает все мыслимые нормы.

В результате ребенку, у которого с ферментами все нормально, ставят диагноз «лактазная недостаточность» только потому, что его маленьких организм не может расщепить такое большое количество молочного сахара.

Наиболее часто от перекорма страдают дети, находящиеся на искусственном вскармливании, поскольку они почти не прилагают особых усилий для того, чтобы получить питание из бутылочки.

Малышам, которые сосут грудь, молоко дается значительно труднее. Иногда мамы и папы не понимают, чего именно хочет ребенок. Чадо хочет пить и кричит, а ему дают есть, полагая, что кроха голоден. Это тоже может привести к транзиторной лактазной недостаточности.

Временная (транзиторная) нехватка фермента лактазы в лечении не нуждается, говорит Комаровский. Выработка фермента в нужном количестве восстановится сразу после того, как будет устранена причина появления нарушения (малыша перестанут перекармливать, начнут соблюдать питьевой режим).

При вторичной недостаточности лактазы, вызванной кишечными вирусными инфекциями, ребенку назначают специальные препараты. Желательно ограничить питание, сократить его объемы. Иногда уместно начать давать малышу пробиотики.

Ребенку с генетически обусловленным дефицитом лактазы дают безлактозные смеси до полугода, а затем аккуратно, постепенно начинают вводить в рацион молочные продукты.

Кормящей маме не стоит бить тревогу, увидев зеленоватый жидкий кал с кислым запахом. Это повод для обращения к педиатру, но никак не причина отлучать младенца от груди. Мамам не стоит начинать издеваться над собой.

Мнение о том, что питание матери сказывается на содержании лактозы в молоке — не более чем миф.

Лактозы в грудном молоке всегда содержится одинаковое количество, которое не зависит от гастрономических предпочтений женщины, времени суток и частоты кормлений.

  • Чтобы искусственник не переедал, нужно давать ему смесь из бутылочки с соской с маленьким отверстием. Чем труднее ему будет сосать, тем быстрее он почувствует ощущение сытости. Тем меньше вероятность того, что он съест лишнего.
  • Собираясь снижать количество лактозы в пище, нужно узнать, в каких именно продуктах ее содержится больше всего. Безусловный лидер по процентному содержанию лактозы — женское грудное молоко (7%), в коровьем и козьем молочного сахара содержится примерно равное количество (4,6% и 4,5% соответственно). В молоке кобылы и ослицы лактозы содержится почти как в женском — 6,4%.
  • Если появились мысли о приобретении безлактозной смеси, сначала стоит попробовать давать ребенку низколактозные «Нутрилон» и такой же «Нутрилак».

Источник: https://o-krohe.ru/komarovskij/laktaznaya-nedostatochnost/

Лактозная недостаточность у ребенка (анализы)

Детей с первых недель жизни часто беспокоят боли в животике, сопровождающиеся зеленым стулом и повышенным газообразованием. Чаще всего эти симптомы вызывает неспособность организма переварить лактозу, содержащуюся в грудном молоке, или лактазная недостаточность.

Лактоза и лактаза, что это такое?

Лактоза – это углевод, который содержится только в молоке млекопитающих, так называемый «молочный сахар». Прежде всего лактоза — это источник энергии для младенца.

С помощью лактозы происходит усвоение полезных микроэлементов: кальция, магния, железа, что способствует росту и укреплению костей малыша и не дает развиться рахиту. Кроме того, она является важным компонентом для формирования здоровой микрофлоры кишечника.

А самое главное – лактоза участвует в развитии центральной нервной системы и мозга ребенка.

Лактаза – это фермент, который присутствует в тонком кишечнике. Она необходима для расщипления локтазы на компоненты: глюкозу и галактозу, которые, в свою очередь всасываются стенками кишечника. Глюкоза дает ребенку энергию, а галактоза является строительным материалом для формирования клеток центральной нервной системы.

Лактоза, на которую не хватило фермента, попадает в кишечник и способствует росту кишечных бактерий Lactobacillus bifidus. Эти бактерии поддерживают кислую среду в кишечнике и подавляют рост патогенных бактерий. Побочным действием таких бактерий является образование газов. Таким образом, образование газов у здоровых младенцев не является патологией.

Что такое лактазная недостаточность?

Лактазной недостаточностью называется состояние организма, при котором в кишечнике недостаточно фермента лактазы, или он совсем не вырабатывается.

Лактозная недостаточность — это? В таком случае, лактоза не усваивается организмом, ребенок перестает набирать вес. Непереваренная лактоза попадает в прямую кишку и становится источником образования патогенных микроорганизмов, вызывающих разжижение стула, повышенное образование газов, повреждение стенок кишечника.

Причины лактазной недостаточности

В зависимости от причин снижения выработки лактазы различают первичную и вторичную лактазную недостаточность.

Если фермент лактаза не вырабатывается организмом, либо его вырабатывается очень мало – это первичная лактазная недостаточность.

Встречается в трех случаях:

  • Врожденное генетически обусловленное заболевание. Это состояние встречается очень редко. В медицине было описано всего несколько десятков таких случаев. Различают алактазию – когда лактоза не вырабатывается организмом, и гиполактазию, когда лактаза вырабатывается в недостаточном количестве.
  • Лактазная недостаточность недоношенных детей. Дело в том, что лактаза у младенцев начинает вырабатываться только к моменту рождения – на 39-40 неделе. Соответственно у детей, рожденных значительно раньше срока, выработка лактазы будет снижена.
  • Лактазная недостаточность у взрослых. Происходит в следствии того, что выработка лактазы снижается с возрастом. Встречается у 18% взрослого населения.

Вторичная лактазная недостаточность возникает после перенесения какой-либо кишечной инфекции, аллергии, при воспалении в кишечнике либо атрофических изменениях в кишечнике.

Симптомы лактазной недостаточности

На лактазную недостаточность у ребенка могут указать следующие симптомы:

  • У младенца будет повышенное газообразование, громкое урчание в животе.
  • Сильные боли в кишечнике, возникающие во время или сразу после кормления.
  • Жидкий, пенистый стул, темно-зеленого цвета, возможны комочки слизи в стуле, кислый, неприятный запах.
  • Ребенок хорошо ест, но при этом не прибавляет в весе.

При первичной лактазной недостаточности эти симптомы появляются через несколько недель после рождения, с увеличением потребления младенцем молока.

Анализ на лактазную недостаточность

Способы диагностики лактазной недостаточности у детей Чтобы начать лечение, необходимо прежде всего правильно диагностировать заболевание. Существует несколько анализов, которые могут указать на наличие у ребенка лактазной недостаточности.

  1. Самым достоверным анализом является биопсия прямой кишки. Анализ сложный, дорогостоящий, поэтому младенцам его чаще всего не делают.
  2. Анализ на лактозную кривую. Ребенку дается порция лактозы, после чего берут анализ крови. Если кривая с показателями количества лактозы меньше среднего показателя глюкозы – можно заподозрить лактазную недостаточность.
  3. Тест на водород. Пациенту дают лактозу и измеряют количество водорода в выдыхаемом воздухе. Дело в том, что лактоза, попадая в прямую кишку в неизменном виде способствует образованию молочной кислоты, которая разлагается на углекислый газ и водород. Часть водорода выделяется через легкие. Таким образом, при заболевании количество молекул водорода будет повышено.
  4. Анализ кала на углеводы. На лактазную недостаточность может указывать содержание углеводов больше 0,25%. Этот тест считается самым недостоверным и используется в совокупности с другими анализами и клиническими симптомами.
  5. Копрограмма. При лактазной недостаточности стул будет более кислым. Наличие большого количества жирных кислот также укажет на наличие заболевания.
  6. Диагностическая диета. Из рациона исключаются продукты, содержащие лактозу. В случае наличия лактозной недостаточности все симптомы прекращаются и состояние кишечника улучшается.

Чтобы поставить точный диагноз у ребенка должны быть все признаки заболевания. Если у ребенка результаты анализов указывают на наличие заболевания, нужно обязательно смотреть общее состояние ребенка: у него должно быть повышенное газообразование, и частый пенистый стул, и сильные боли в животе. Главным симптомом, указывающим на наличие заболевания будет недобор или потеря веса.

Как лечить лактазную недостаточность

Если при наличии зеленого стула и повышенного газообразования ребенок хорошо набирает вес, в этом случае специального лечения не требуется. Выработка лактазы формируется у ребенка до 3-4 месяцев. Поэтому организм здорового ребенка может не справляться с большим количеством лактозы, поступающей к нему вместе с грудным молоком. Иногда бывает достаточно наладить грудное вскармливание.

  • Надо убедиться, что ребенок правильно захватывает грудь. Ребенок должен высасывать молоко из груди до конца, т.к. первая порция молока содержит больше лактозы, а последующее молоко содержит больше жира, оно более питательное для ребенка.
  • Назначается безлактозная диета. Из рациона матери исключаются все продукты, содержащие лактозу. Чаще всего аллергию вызывает белок коровьего молока. В случае выявления такой аллергии маме назначают диету, в которой исключаются все молочные продукты, включая сливочное масло, также запрещено есть говядину. Когда деятельность кишечника восстанавливается, продукты постепенно возвращают в рацион.
  • Иногда рекомендуют сцеживать первую порцию молока, в которой содержится больше лактозы.
  • Обычно эти меры помогают наладить стул ребенка и снизить повышенное газообразование.

Если эти меры не помогли, ребенку будет назначено следующее лечение:

  • Перед кормлением ребенку дают фермент лактазу – её разводят в небольшой порции грудного молока. Лечение необходимо проводить курсами, после 3-4 месяцев терапию пробуют отменить, если выработка лактозы в кишечнике не возобновилась – назначают новый курс.
  • Грудное вскармливание сочетают с безлактозной смесью. Это лечение носит временный характер, т.к. безлактозные смеси, сделанные на основе сои могут вызывать аллергию у детей.
  • Восстановление микрофлоры кишечника. Обычно лечение дизбактериоза приводит к вылечиванию лактазной недостаточности.

Генетическая форма заболевания не вылечивается, в этом случае потребуется пожизненное лечение и соблюдение диеты.

Транзиторная форма (недоразвитие функций кишечника у недоношенных) проходит к 6 месяцам самостоятельно. Но пока у ребенка не сформировалась выработка лактазы – будет необходимо соблюдать все вышеперечисленные методы лечения.

Вторичная форма лактазной недостаточности, появившейся после кишечной инфекции или нарушения грудного вскармливания – вылечивается полностью. Выработка лактозы формируется у новорожденных детей только к 3-4 месяцам.

Поэтому в таком возрасте ставить ребенку диагноз лактазная недостаточность будет преждевременным. Ни в коем случае не надо отказываться от грудного вскармливания, т.к.

отсутствие материнского молока в рационе ребенка нанесет больший вред, чем его употребление.

Известный детский врач Комаровский считает, что слишком частое выявление лактазной недостаточности является следствием политики производителей безлактозных смесей. Поэтому не надо спешить прекращать грудное вскармливание, если выявлена вторичная форма заболевания.

Введение прикорма для ребенка следует начинать с овощных пюре, отслеживая реакцию ребенка на каждый новый продукт. Кисломолочные продукты можно будет давать с 8-9 месяцев (кефир, йогурт), творог рекомендуется вводить в рацион ребенка только после одного года.

Состояния ребенка, вызывающие похожие симптомы

Похожие симптомы в виде зеленого стула и повышенного газообразования могут вызывать другие заболевания:

  • Недоразвитие слизистой тонкой кишки у недоношенных детей.
  • Аллергия на белок коровьего молока, сои или других продуктов.
  • Целиакия – непереносимость глютена, содержащегося в некоторых зерновых.

В этом случае переход с грудного вскармливания на искусственные смеси может только ухудшить ситуацию. В этом случае нужно будет соблюдать лечение для детей с аллергией.

Лактазная недостаточность в большинстве случаев является физиологическим состоянием новорожденных детей и с возрастом полностью восстанавливается.

Генетическое заболевание должно быть подтверждено рядом анализов, и иметь все симптомы заболевания. Схожие симптомы имеют и другие заболевания, такие как аллергия, целиакия, гастроэнтерит и др.

Источник: http://ritty.ru/health/laktoznaya-nedostatochnost-u-rebenka-analizy/

Симптомы и диагностика лактазной недостаточности

Прежде всего, что называют лактазной недостаточностью?

Это заболевание диагностируется, когда организм не может самостоятельно переработать молочный сахар – лактозу. Почему же тогда недостаточность лактАзная, а не лактОзная? Потому что лактаза и лактоза — это разные вещи. Подробнее здесь.

  • Почему возникает лактазная недостаточность, каковы ее симптомы и как правильно диагностировать заболевание – об этом в нашей статье.
  • Причины лактазной недостаточности
  • Симптомы лактазной недостаточности
  • Диагностика лактазной недостаточности

Лактазная недостаточность. Причины

Врачи выделяют три причины возникновения этого отклонения:

  • Гены. Мутация гена, отвечающего за правильное фнукционирование фермента лактаза в организме. В таком случае болезнь является врожденной и, как правило, наследственной. При генных мутациях может возникнуть лишь первичная лактазная недостаточность, она диагностируется в первый месяц жизни новорожденного. Помочь здесь могут только профилактические меры – питание малыша специализированными смесями или медикаментозная помощь.
  • Недоношенность. Еще одна причина возникновения заболевания – неразвитость и неготовность детского организма к правильной переработке поступающей пищи. Окончательное формирование фермента лактаза в организме складывается к 36 неделям жизни плода. Поэтому, если малыш родился недоношенным – он имеет повышенный риск «подхватить» лактазную недостаточность. В этом случае симптомы заболевания, как и оно само, исчезают в первые месяцы жизни ребенка, в тот момент, когда его организм начинает сам правильно и регулярно вырабатывать лактазу.
  • Лактазная недостаточность как следствие других заболеваний кишечника. Это могут быть инфекции или воспалительные процессы, а также возрастные изменения организма. В этом случае происходит нарушение работы энтероцитов и слизистой оболочки кишечника. Такой вид недостаточности лактазы называется вторичным.

Лактазная недостаточность. Симптомы

Какие же признаки лактазной недостаточности намекнут маме, что с малышом что-то не так?

Жидкий стул. Сопровождается кисловатым запахом забродившего молока и пенистой структурой. Такую диарею бывает трудно остановить.

Рвота или срыгивания, а также отказ от пищи. После еды младенец часто и много срыгивает, это может быть даже больше похоже на рвоту, а не на срыгивание. При грудном вкармливании малыш может бросать грудь почти сразу же после начала кормления и отказываться от предложений покушать еще.

Вздутие живота и колики. Во время или после кормления младенец выгибается дугой, плачет, вы можете услышать и почувствовать как у него в животике бродят газы.

Беспокойный сон и вялое поведение. В период бодрствования малыш не проявляет активности и не хочет веселиться, капризничает, а спит чутко и часто просыпается — так происходит потому что его беспокоят другие симптомы лактазной недостаточности.

Недовес. Ребенок плохо набирает вес и отстает от стандартов или же теряет набранные граммы.

 

Лактазная недостаточность. Диагностика

При любом недомогании, появившемся у новорожденного, мама должна обратиться к педиатру. Если доктор заподозрит, что причина болей у ребенка – лактазная недостаточность, он направит маму и малыша сдать ряд тестов. Что это может быть?

Перегрузка лактозой и определение гликемического профиля. Основа теста – определение прироста сахара в крови. Плохая усвояемость сахара, а значит отсутствие его прироста, является тем признаком, который говорит за лактазную недостаточность.

Водородный тест. Суть этой процедуры в том, что в течение трех часов после кормления малыша у него берется проба выдыхаемого воздуха, а затем анализируется количество водорода, содержащегося в выдохе. Этот метод далеко не самый точный, обычно его проводят несколько раз.

Анализ кала на углеводы или метод Бенедикта. Самый популярный анализ для выявления недостаточности лактазы. В норме показатели должны быть 0-0,25% и их превышение подтверждает диагноз. Данный метод заодно определяет и PH кала, норма – 5,5 ед., меньшее значение говорит о возможном проявлении недостаточности лактазы.

Анализ кала на углеводы также не самый точный в том смысле, что результаты, которые могут быть приняты за подтверждение диагноза на самом деле говорят об особенностях микрофлоры кишечника пациента.

В последнее время педиатры избегают этого метода из-за его малой информативности вследствие неспособности отличить галактозу, лактозу и глюкозу между собой.

Биопсия кишки. Самое сложное, но и самое информативное и точное исследование.

Самое точное потому что здесь происходит непосредственно забор клеток кишечника или смыв слизистой, а затем анализируется работа щеточной каемки энтероцитов. Здесь уже ошибиться с диагнозом невозможно.

А самый сложный потому что биопсия кишки предусматривает введение пациента под общий наркоз, а когда пациент – новорожденный младенец, это совсем нежелательно.

Безлактозная диета. Самый простой и безболезненный способ диагностики лактазной недостаточности.

В этом случае лечащий врач рекомендует маме просто на несколько недель отказаться от кормления малыша питанием, содержащим лактозу. Как правило, ребенок переводится на кормление безлактозной смесью.

Если симптомы болезни пропадают в результате соблюдения такой диеты, делается вывод о том, что у малыша как раз и была недостаточность лактазы.

  1. Сложности с этим методом могут возникнуть в том случае, если заболевание диагностируется у младенца на грудном вскармливании, ведь ребенок может отказаться кушать невкусную, по его мнению, смесь взамен сладкого и теплого маминого молока.

Итак, если лактазная недостаточность, симптомы которой наблюдались у новорожденного, подтверждена после ряда тестов, для того чтобы назначить правильное лечение доктор должен выяснить причину возникновения заболевания. О причинах мы писали выше.

Источник: http://timosha-s.ru/zdorove-grudnichka/simptomy-i-diagnostika-laktaznoj-nedostatochnosti/

Лактазная недостаточность у детей и взрослых: симптомы, лечение, причины

Лактазная недостаточность – это синдром, возникающий из-за нарушения переваривания лактозы и характеризующийся водянистой диареей.

Патология появляется, когда в кишечнике не хватает фермента лактазы, способного переварить молочный сахар (лактозу). Поэтому следует понимать, что термина лактозная недостаточность не существует, это ошибка.

Лактоза — это молочный сахар, а недостаток фермента для его расщепления (лактазы) и называется лактазной недостаточностью.

Есть несколько признаков, которые указывают на лактазную недостаточность у детей и которые сразу должны насторожить молодую маму:

  • возраст малыша 3-6 месяцев
  • стул разжиженный, пенистый
  • стул имеет кислый запах
  • вздутие живота

Удивительно, но эта патология наиболее распространена у вьетнамцев и коренных индейцев, а вот голландцы и шведы практические ей не страдают. В России до половины населения имеет недостаток этого фермента в той или иной степени, причем лактазная недостаточность может периодически появляться и исчезать.

Больше всего от дефицита лактазы страдают, конечно же, дети. Она является одной из частых причин выматывающих кишечных колик (см. что делать при коликах у новорожденного) и нередким поводом для прекращения грудного вскармливания. Молочный сахар в питании ребенка покрывает до 40% потребности в энергии.

Виды недостатка фермента

Первичная лактазная недостаточность – это синдром дефицита фермента при неповрежденных кишечных клетках энтероцитах. Сюда относится:

  • врожденная ЛН – очень редко встречается, возникает из-за генетической мутации
  • транзиторная ЛН недоношенных детей – появляется у новорожденных, появившихся на свет ранее 34-й-36-й недели: активность фермента не достаточна
  • лактазная недостаточность у взрослых – не является патологией, а отражает естественный процесс убывания активности лактазы с возрастом.

У тех же шведов и голландцев и других северных европейцев лактаза сохраняет высокую активность на протяжении всей жизни, чего не скажешь о жителях Азии.

Вторичная лактазная недостаточность – это дефицит фермента, возникающий в результате повреждения кишечных клеток. Именно недостаток лактазы является наиболее частой формой дефицита кишечных ферментов, так как особенность строения кишечных ворсинок такова, что лактаза располагается ближе всего к просвету, первой получает удар от неблагоприятных факторов.

Чем опасен дефицит лактазы?

  • Развивается обезвоживание организма в результате диареи, особую опасность это представляет у грудных детей
  • Нарушается всасывание кальция и других полезных минералов
  • Нарушается рост полезной микрофлоры вследствие отсутствия питательных веществ, получаемых в результате расщепления молочного сахара
  • Размножается гнилостная микрофлора
  • Нарушается регуляция перистальтики кишечника
  • Страдает иммунитет

Причины

ВрожденнаяЛН Мутация гена, контролирующего лактазную активность
ТранзиторнаяЛН Недостаточная активность фермента на момент рождения
ЛН у взрослых
  • Естественная инволюция (обратное развитие) активности фермента
  • Заболевания кишечника (воспалительные, инфекционные, дистрофические), которые привели к разрушению энтероцитов
Вторичная ЛН . Воспалительные и дистрофические процессы в кишечнике, возникающие в результате:
  • инфекции: ротавирус, лямблиоз и другие
  • пищевой аллергии
  • непереносимости глютена (целиакия)
  • болезни Крона
  • радиационного поражения
  • лекарственного воздействия

Уменьшение площади слизистой кишечника после удаления части кишки или при синдроме короткой кишки

Активность лактазы может изменяться. Помимо основных факторов, на фермент оказывают воздействие многочисленные биологически активные вещества: гормоны щитовидной и поджелудочной железы, гормоны гипофиза, нуклеотиды, жирные кислоты и аминокислоты, находящиеся в просвете кишечника, глюкокортикостероидные гормоны.

Симптомы

Симптомы лактазной недостаточности как первичной, так и вторичной обычно похожи.

Разница лишь в том, что при первичной ЛН патологические проявления наблюдаются уже через несколько минут, их тяжесть зависит от количества потребленной лактозы.

Вторичная ЛН выявляет себя при употреблении даже небольшого количества молочного сахара, так как отсутствие его расщепления сочетается с какой-либо кишечной патологией.

Общие признаки дефицита лактазы таковы:

  • диарея, характеризующаяся водянистым, пенистым стулом с зеленью и кислым запахом, очень много газов
  • боль, урчание в животе, рвота
  • вздутие живота, снижение аппетита
  • срыгивания у грудничка (причины), приступы кишечных колик, беспокойство, пониженная прибавка в весе, плач во время кормления характерны для лактазной недостаточности у грудничков.

Отличительные особенности отдельных форм

Врожденная ЛН – это редкий, но тяжелый вид ферментативной недостаточности, опасный обезвоживанием и сильным токсикозом. Мама может понять это с первых дней жизни ребенка, когда вскармливание грудным молоком приводит к рвоте и ничем не останавливаемой диарее. Помогает только отмена грудного вскармливания и употребление безлактозных смесей.

Первичная ЛН проявляется только после приема большого количества молока. В раннем возрасте она может маскироваться под обычные кишечные колики, которые беспокоят большинство младенцев.

С ростом ребенка микрофлора может адаптироваться к молочному сахару с помощью размножения соответствующих бактерий. Со временем симптоматика проявляется только при излишнем употреблении молока.

При этом кисломолочные продукты переносятся хорошо, так как поддерживают рост бактерий, расщепляющих молочный сахар.

Вторичная ЛН может появиться в любом возрасте вследствие какого-либо заболевания. Конкретные симптомы именно лактазной недостаточности проявляются плохо, так как главную роль играет основная патология кишечника. Однако безмолочная диета помогает немного улучшить состояние.

Как определить самостоятельно, что это именно лактазная недостаточность? Симптомы очень стойкие, отсутствует эффект от лечения. Патологические проявления исчезают только при соблюдении диеты с исключением лактозы.

Анализы на лактазную недостаточность

  • Нагрузочный тест с лактозой: определяют прирост сахара в крови, строя кривую. При дефиците фермента на графике виден уплощенный тип кривой, то есть нет нормального прироста из-за отсутствия всасывания сахара.
  • Анализ кала: кал на лактазную недостаточность сдают для определения содержания углеводов. В норме углеводов быть не должно, допускается 0,25% у грудничков, также оценивается его рН  — при ЛН уровень опускается ниже 5,5.
  • Водородный дыхательный тест. Наряду с нагрузочным тестом нужно сдать анализ на определение концентрации водорода в выдыхаемом воздухе: пробу берут каждые 30 минут в течение трех часов после нагрузки лактозой.
  • Определение активности фермента с биоптата или смыва со слизистой кишки. Это самый информативный метод определения ЛН, но его применение не всегда оправдано из-за сложности взятия анализа.
  • Генетическое исследование для выявления мутации определенных генов, отвечающих за лактазную активность.
  • Диагностическая (элиминационная) диета с исключением молочного сахара при наличии лактазной недостаточности улучшает состояние кишечника, симптомы заболевания исчезают.

При подозрении на лактазную недостаточность нужно исключить другие возможные причины диареи, которые могут быть достаточно серьезными (см. понос и рвота у ребенка без температуры).

Лечение лактазной недостаточности

  • Лечебное питание, прием пищевой добавки Лактаза Беби (370-400 руб), Лактаза Фермент (560-600 руб), Лактазар для детей (380 руб) ,Лактазар для взрослых (550 руб).
  • Помощь поджелудочной железе (ферменты: панкреатин, мезим форте, фестал, креон и другие)
  • Коррекция дисбактериоза кишечника (пребиотики и пробиотики: бифидумбактерин, линекс, хилак форте и пр. см. полный список пробиотиков)
  • Симптоматическое лечение:

Лечебное питание

Диета при лактозной недостаточности предполагает полное исключение лактозы или ограничение ее в рационе в соответствии с уровнем углеводов в кале. Полное исключение лактозы – это временная и вынужденная мера при тяжелом состоянии ребенка (обезвоживание, упорная диарея, сильная боль в животе).

Отказываться от употребления лактозы совсем не следует, так как она является естественным пребиотиком. Поэтому главная задача на данном этапе – индивидуально поэтапно подобрать диету с таким количеством лактозы, которое не вызывает нарушение пищеварения и не провоцирует выделение углеводов с калом.

Как лечить лактазную недостаточность, если ребенок находится на грудном вскармливании? Современные стандарты не предполагают полный отказ от грудного вскармливания.

Для таких детей применяют заместительную ферментотерапию: препарат добавляют в сцеженное молоко, после пятнадцатиминутной выдержки ребенка кормят маминым молоком.

Для этого используют пищевую добавку Лактазу Бэби (цена 370 руб): одной капсулы хватает на сто миллилитров молока. После кормления сцеженным молоком ребенку дают грудь.

Детям на искусственном или смешанном вскармливании подбирают оптимальную комбинацию безлактозной смеси и обычной смеси. Соотношение смесей при лактазной недостаточности может быть разным: 2 к 1, 1 к 1 и так далее (зависит от реакции ребенка). Если дефицит лактазы выражен сильно, используют только низко- или безлактозные смеси.

  • Низколактозные смеси: Нутрилон низколактозный, Нутрилак низколактозный, Хумана ЛП+СЦТ.
  • Безлактозные смеси: Нан безлактозный, Мамекс безлактозный, Нутрилак безлактозный.

Введение прикорма

  1. При лактазной недостаточности следует особенно тщательно вести дневник введения прикорма, так как некоторые продукты могут вызвать такую же патологическую реакцию: вздутие живота, диарея.
  2. Начинают прикорм с овощей, используя по одному овощу в течение нескольких дней. Их количество доводят до 150 грамм в течение 14 дней. Затем в рацион добавляют каши на воде с низким содержанием глютена (рис, гречка, кукуруза), также увеличивая массу съедаемого прикорма. Следующим этапом малышу дают мясо.
  3. После 8-9 месяцев можно дать немного кисломолочных продуктов (кефир, йогурт), внимательно отслеживая реакцию. А вот творожок больным детям не рекомендуется до одного года (см. подробно о введении прикорма здоровому грудничку).

Дальнейшее питание

Дальнейший рацион питания ребенка, а также взрослого с дефицитом фермента подбирается индивидуально, исходя из реакции организма. Какие признаки свидетельствуют о том, что продукт можно употреблять, даже если он содержит молочный сахар:

  • нормальный стул — оформленный, без патологических примесей и кислого запаха
  • отсутствие повышенного газообразования
  • отсутствия урчания и других дискомфортных ощущений в животе

Вначале в рационе питания должно быть много продуктов, не содержащих лактозу: фрукты, овощи, рис, макароны, мясо и рыба, яйца, бобовые, орехи, чай, кофе, гречка, кукуруза.

Затем в рацион нужно добавлять продукты с лактозой, но отслеживать реакцию на продукт и его количество:

  • молочные продукты — молоко, сыр, йогурт, творог, сметана, сливочное масло, мороженое (см. можно ли давать цельное молоко ребенку).
  • другие продукты, в которых лактоза добавлена в качестве дополнительного компонента — хлеб, колбасные изделия, печенье, какао, кетчуп, майонез, шоколад и многие другие

Низколактозными считаются сметана, сливки, низколактозное молоко, трехдневный кефир, твердый сыр.

Нужно помнить, что диета облегчает состояние больных ЛН, но также лишает их основного источника кальция, поэтому вопрос о восполнении этого микроэлемента обязательно следует решить с лечащим врачом.

Источник: http://zdravotvet.ru/laktaznaya-nedostatochnost-u-detej-i-vzroslyx-simptomy-lechenie-prichiny/

Лактазная недостаточность у детей и взрослых

Фермент лактаза синтезируется в клетках тонкой кишки. Этот фермент расщепляет молочный сахар (лактозу) на глюкозу и галактозу. Если активность лактазы в кишечнике снижена, то развивается лактазная недостаточность. Для детей до 1 года непереносимость лактозы имеет большое значение, так как для них молоко — это основной продукт питания.

Первичная лактазная недостаточность — это врожденное снижение активности лактазы без повреждения клеток кишечника. Врожденная (семейная) лактазная недостаточность —  низкая активность фермента лактазы передается по наследству.

Лактазная недостаточность недоношенных и незрелых детей

Высокий риск развития лактазной недостаточности у недоношенных детей. У малышей, рожденных на 28-34 недели беременности, активность фермента лактазы составляет не более 30% от уровня 39-40 недель.

Лактазная недостаточность взрослого типа (конституциональная)

При переходе на взрослый тип питания активность лактазы снижается. К 2-5 годам у 16-18% россиян формируется лактазная недостаточность взрослого типа. Многие люди не переносят молочный сахар (лактозу), но не догадываются об этом. Так как не употребляя молочные продукты, не испытывают никаких неудобств.

Высокая частота лактазной недостаточности взрослого типа среди коренного населения Африки, Америки и ряда стран Азии связана с отсутствием в этих регионах молочного животноводства.  В Африке только в племенах масаев, фулани и тасси с древних времен выращивают молочный скот.

Вторичная лактазная недостаточность

Вторичная лактазная недостаточность — это снижение активности лактазы, связанное с повреждением клеток кишечника на фоне какого-либо заболевания.

Такое повреждение энтероцита возможно при инфекционном (кишечная инфекция), иммунном (непереносимость белка коровьего молока), воспалительном процессах в кишечнике, атрофических изменениях (при целиакии, после длительного периода полного парентерального питания и др).

Признаки лактазной недостаточности

Частый, жидкий, пенистый стул, боли в животе после приема молока — это признаки лактазной недостаточности.

По степени выраженности лактазную недостаточность делят на частичную (гиполактазия) или полную (алактазия). Выраженность жалоб при непереносимости лактозы определяется различным уровнем снижения фермента.

Если активность лактазы недостаточна для переваривания поступившей в тонкую кишку лактозы, нерасщепленный дисахарид поступает в толстую кишку, где микроорганизмы расщепляют лактозу до короткоцепочечных жирных кислот, молочной кислоты, углекислого газа, метана, водорода и воды, что приводит к развитию осмотической диареи.

В небольших количествах лактоза в толстой кишке оказывает положительное влияние на микрофлору кишечника.

Основные жалобы при лактазной недостаточности

  • частый, жидкий, пенистый с кислым запахом стул, боли в животе, беспокойство ребенка после приема молока;
  • повышенное газообразование в кишечнике — метеоризм, вздутие кишечника, боли в животе;
  • у детей раннего возраста на фоне поноса возможно развитие обезвоживания и недостаточная прибавка массы тела.

Источник: http://diagnoster.ru/bolezni/l-bolezni/laktaznaia-nedostatochnost/laktaznaya-nedostatochnost/

Лактазная недостаточность у взрослых

Лактазная недостаточность – нарушение расщепления лактозы вследствие недостаточности фермента лактазы слизистой оболочки тонкой кишки, сопровождающееся клинической симптоматикой.

Лактоза – это молочный сахар. Фермент, расщепляющий лактозу, называется лактазой.

Лактазная недостаточность взрослого типа развивается после периода грудного вскармливания. Это связанно с постепенным снижением активности лактазы с возрастом. После приема молочных продуктов или цельного молока, как правило, проявляются кишечные расстройства (диарея, метеоризм). Профилактика и лечение заключается в соблюдении диеты с низким содержанием лактозы или полным ее исключением.

Для лактазной недостаточности характерно развитие кишечных симптомов после приема молока и молочных продуктов: метеоризм, боли и урчание в животе, диарея, вздутие живота. Возможна тошнота. Стул жидкий или кашицеобразный, светло-желтого цвета, с кислым запахом.

Общая информация о заболевании

Дефицит лактазы, или первичная лактазная недостаточность, – нарушение расщепления лактозы вследствие недостаточности фермента лактазы слизистой оболочки тонкой кишки, сопровождающееся клинической симптоматикой. Он вызван генетически обусловленным снижением ее продукции, что проявляется в неспособности усваивать молочный сахар (лактозу).

Активность лактазы проявляется с 12-14-й недели внутриутробного развития и достигает максимальных величин к моменту рождения (на сроке 39-40 недель).

После рождения лактаза вырабатывается в больших количествах, но уже к концу первого года жизни ее продукция снижается.

Это и есть первичная, или врождённая, лактазная недостаточность с поздним началом, которая наследуется по аутосомно-рецессивному типу.

Неспецифические абдоминальные симптомы (вздутие кишечника, расстройство стула, тошнота) развиваются после употребления продуктов, содержащих лактозу, в основном это цельное молоко и молочные продукты.

Но на сегодняшний день лактоза добавляется в другие продукты питания (например, мясные, кондитерские изделия). Фармацевтическая промышленность также использует ее в качестве вспомогательного вещества.

Выраженность симптомов гиполактазии зависит от индивидуальных физиологических особенностей человека, микрофлоры кишечника, диеты, психологических факторов.

Осознанное избегание молока, которое является важным источником кальция, может привести к дефициту этого элемента и, как следствие, к остеопорозу.

Об этом следует помнить и возмещать суточную потребность за счет других продуктов, богатых кальцием. Особенно это важно для женщин, находящихся в постменопаузе.

Первичную лактазную недостаточность следует отличать от вторичной (приобретенной), которая возникает при повреждении слизистой оболочки тонкой кишки на фоне какого-либо острого или хронического заболевания.

Такое повреждение возможно при инфекционном (кишечная инфекция), иммунном (непереносимость белка коровьего молока), воспалительном процессах в кишечнике, атрофических изменениях (при целиакии, после длительного периода полного парентерального питания и др.).

Также не следует путать данное расстройство с врождённой недостаточностью лактазы – редким генетическим нарушением, симптомы которого появляются сразу после рождения и связаны с началом грудного вскармливания.

Существует генетическая диагностика первичной лактазной недостаточности с поздним началом. Область гена MCM6 является одним из важных регуляторных элементов гена лактазы. С лактозной непереносимостью ассоциирован генетический маркер MCM6 (C(-13910)T).

Кто в группе риска?

  • Лица, имеющие родственников с непереносимостью молока и молочных продуктов.
  • Определенные этнические группы. Непереносимость лактозы наиболее распространена в Северной Америке, Африке, Юго-Восточной Азии (частота встречаемости лактазной недостаточности – 70-100  %) В российской популяции дефицит лактазы наблюдается примерно у 16  %.
  • Состояние редко встречается на первом году жизни, развитие непереносимости лактозы связано со взрослением.

Диагностика

Диагноз можно предположить на основании генеалогических данных, результатов копрологии (увеличение крахмала, клетчатки, йодофильной микрофлоры, снижение pH кала менее 5,5), определения углеводов в кале. В диагностике используется водородный дыхательный тест.

Концентрацию водорода в выдыхаемом воздухе определяют до и после нагрузки лактозой. У пациентов с лактазной недостаточностью регистрируется увеличение содержания водорода, что связано с усиленным бактериальным расщеплением лактозы в толстой кишке.

То есть лактоза, не полностью всосавшаяся в тонкой кишке, достигает толстой кишки, где расщепляется анаэробной микрофлорой.

Важным в диагностике является молекулярно-генетическое исследование на предрасположенность к лактазной недостаточности. Анализ поможет в дифференциальной диагностике причин мальабсорбции лактозы и в подборе соответствующей диеты.

При выраженных клинических проявлениях, отказе от молока также важно определить содержание кальция в сыворотке крови и в моче.

Лечение

  1. Диетотерапия: ограничение продуктов, содержащих лактозу.
  2. Возможно назначение ферментных препаратов, расщепляющих лактозу.
  3. Допускается использование кисломолочных продуктов со сниженным количеством лактозы (йогурты, простокваша), творога, масла, твердых сыров, а также безлактозных.
  4. Важно учитывать возможный недостаток поступления кальция на безмолочной диете, который рекомендуется компенсировать другими продуктами, богатыми им, или медикаментозными препаратами.

У детей раннего возраста часто лактазная недостаточность сочетается с непереносимостью белков коровьего молока. В этом случае назначаются специальные смеси на основе полного гидролизата молочного белка.

По показаниям – антидиарейные препараты, ферментатиные препараты, препараты витамина D и другие витаминные комплексы, препараты для восстановление биоценоза кишечника.

Профилактика

Профилактика заключается в предупреждении симптомов гиполактазии путём соблюдения диеты с низким содержанием лактозы или полным её отсутствием.

Поэтому при обнаружении симптомов расстройства пищеварения после употребления неферментированных молочных продуктов целесообразно проведение генетического теста на активность лактазы, чтобы избежать попыток бессмысленного лечения и выбрать соответствующую диету.

Также тест помогает спрогнозировать лактозную непереносимость у детей в целях предотвращения неожиданных расстройств кишечника.

Источник: https://helix. ru/kb/item/1517

принцип действия и правила использования

Микрофлора кишечника содержит колонии полезных и условно-патогенных бактерий, характерные для нормальной работы пищеварительной системы. В норме ее состав сильно не меняется, но бывает, что некоторые факторы, в том числе и прием лекарственных средств, нарушают состав нормофлоры. Это приводит к застою кала и ухудшает работу кишечника. Для того чтобы избавиться от таких последствий, часто назначают медикаменты со слабительным эффектом, которые не всегда оказывают желаемый результат. Для нормализации флоры кишечника и восстановления пищеварительного процесса требуется прием пробиотиков, поэтому все чаще назначается Бифидумбактерин при запорах.

Целесообразность приема Бифидумбактерина при запорах

Положительные результаты после приема препарата наблюдаются только в случае, если запор вызван нарушением флоры кишечника. При других причинах недуга, препарат бессилен. Бифидумбактерин при запорах целесообразно принимать взрослым и детям, если диагностирован дуоденит, гастрит, колит или дисфункция желчевыводящих путей, сопровождающиеся запорами. Препарат назначают в качестве поддерживающего лечения. Устранить запор удастся только при адекватной терапии основной болезни.

Препарат следует принимать, если запор является следствием дисбактериоза, вызванного разными причинами, в том числе употреблением некачественной воды, сменой климата или приемом антибактериальных препаратов, а также при диагностировании синдрома раздраженного кишечника.

Стоит помнить, что Бифидумбактерин от запоров принимают длительно, поскольку его действие начинается не сразу.

Пробиотик помогает восстановить нарушенный состав флоры и как следствие восстанавливает работу ЖКТ. У грудничков препарат помогает заселить флору полезными бактериями при искусственном кормлении, кесаревом сечении и недоношенности малыша.

Также пробиотик показан в следующих состояниях:

  • кишечная инфекция;
  • отравление продуктами питания;
  • запоры, вызванные дисбактериозом;
  • профилактика дисбиоза;
  • аллергические проявления (сыпь, крапивница).

Бифидумбактерин назначается для исключения проблем со стулом при операциях на органах пищеварения.

Особенности препарата и принцип его действия

Бифидумбактерин – лекарственный препарат, предназначенный для взрослых и грудничков, чтобы восстановить баланс микрофлоры кишечника. Назначается только после консультации врача при различных состояниях, но чаще всего при дисбактериозе.

Принцип действия препарата заключается в активном размножении полезных бактерий в кишечнике, восстанавливающие нормальную среду.

Регулярное и правильное применение препарата позволяет восстановить обмен веществ и наладить перистальтику кишечника, улучшить подвижность каловых масс. В случае длительного запора пробиотик нейтрализует токсическое действие накопленных каловых масс, приводящих к интоксикации организма.

Бифидумбактерин помогает справиться со следующими симптомами:

  • запоры;
  • диарея;
  • чувство тяжести в животе;
  • боль в животе;
  • повышенное газообразование;
  • вздутие;
  • метеоризм.

В состав препарата входят живые бактерии, которые, попадая в кишечник, вытесняют патогенную флору, нормализуя процессы пищеварения.

Формы выпуска

Бифидумбактерин при запорах у взрослых и детей используется в нескольких формах:

  • суппозитории;
  • жидкость;
  • таблетки;
  • порошок.

При запорах врачи советуют отдать предпочтение препарату в форме порошка, который перед применением предварительно смешивается с водой.

Ректальные свечи

Суппозитории содержат живые бактерии, помогающие устранить запоры и воспалительный процесс кишечника у взрослых и детей. Воздействие такой формы препарата – местное, пробиотик способствует снятию интоксикации, которая возникает вследствие жизнедеятельности патогенных микроорганизмов.

Регулярное использование ректальных свечей укрепляет иммунную систему и улучшает усвоение белка. Такая форма Бифидумбактерина подходит для терапии взрослых и детей от 3-ех лет.

Лиофилизат

Препарат представляет собой порошок, содержащий живые бактерии не менее 10*7 кое/мл, а также обезжиренное молоко, желатин и сахарозу. Показан в качестве профилактического и лечебного средства от дисбактериоза у детей и взрослых, разрешено использовать с первых дней жизни.

Активные бифидобактерии, попадая в кишечник, стабилизируют баланс флоры, вытесняя патогенные микроорганизмы. Лиофилизат устраняет острые кишечные инфекции, нормализует работу ЖКТ и улучшает обмен веществ. Кроме того, он широко используется в гинекологии при дисбиозе влагалища, который нередко возникает на фоне дисбактериоза кишечника.

Пакетированный порошок

Пакетированная форма препарата является одним из удобных и предпочтительных видов. Предназначен к использованию у взрослых и недоношенных детей. Средство помогает бороться с дисбактериозом, спровоцированным приемом медикаментов, отравлениями пищей, воздействием вирусов и кишечными инфекциями.

Бифидумбактерин-форте

Бифидумбактерин-форте состоит из живых бактерий, сорбированных на активированном угле, и смешанных с лактозой. Порошок в пакетиках имеет серый цвет с черными частичками-вкраплениями и кисловатый запах. Эта форма препарата борется с микроорганизмами, способными вызвать серьезные заболевания.

Пакетированный порошок способствует:

  • укреплению иммунитета;
  • усвоению аминокислот и витаминов;
  • улучшению работы пищеварительной системы;
  • восстановлению слизистой кишечника.

Такой вид препарата предназначен для взрослых, грудничков, кормящих и беременных женщин. Бифидумбактерин-форте помогает избавиться не только от запоров, но и показан при аллергических проявлениях, пищевых отравлениях, острых кишечных инфекциях, пневмонии.

Бифидумбактерин-мульти

Такой вид препарата – новейшая разработка, обладающая комплексным действием. Препарат помогает устранить запор и нормализовать состав флоры.  Содержит сразу несколько видов бактерий, что позволяет получить большую пользу. В состав входят клубни топинамбура и пектин, являющиеся пребиотиками. Они дополнительно помогают защитить и сохранить флору кишечника.

Бифидумбактерин-мульти разработан в нескольких вариантах: 1, 2 и 3.

Каждый из них содержит пищевые волокна и разные штаммы полезных бактерий, предназначенные прежде всего для детей от 3 до 14 лет. Клинические испытания не выявили негативных реакций, поскольку лекарство не содержит аллергенных веществ и лактозы.

Бифидумбактерин-мульти эффективен при кишечных инфекциях, наличии глистных инвазий, антибактериальном лечении, в качестве комплексной терапии таких заболеваний, как цирроз печени, гепатит и туберкулез.

Жидкая форма

Жидкая форма лекарства включает бифидобактерии и представляет собой смесь молочного цвета. Выпускается во флаконах по 100 мл, обладает слабым кисловатым привкусом. При правильном использовании средство повышает синтез витаминов, фолиевой кислоты и биотина, нормализует флору кишечника. Поскольку препарат имеет жидкую форму, он не требует разбавления с водой и готов к использованию сразу.

Противопоказания

Поскольку состав исключает гипоаллергенные компоненты, Бифидумбактерин не имеет противопоказаний. Иногда возможна непереносимость компонентов, поэтому при аллергии на входящее в препарат вещество от средства следует отказаться. Препарат в форме суппозиторий, капсул и таблеток противопоказан детям до трех лет, отказаться от Бифидумбактерина следует и при непереносимости лактозы.

Побочные эффекты

Препарат является эффективным средством для восстановления микрофлоры кишечника. В процессе его использования побочных эффектов не было выявлено, но все же иногда может наблюдаться аллергическая реакция в виде сыпи или покраснения.

Может ли быть запор от Бифидумбактерина

Несмотря на то, что действие препарата направлено на улучшение работы кишечника и нормализацию стула, все же Бифидумбактерин способен вызвать  запор. Важно при лечении соблюдать длительность терапии и дозировку препарата. Также одной их причин задержки каловых масс во время приема лекарства является непереносимость лактозы, поэтому важно соблюдать все рекомендации врача.

Бифидумбактерин для детей

Препарат широко используется для нормализации микрофлоры в детском возрасте. Однако длительность приема и дозировку может подобрать только врач, исходя из индивидуальных особенностей и возраста малыша. Только в этом случае наблюдается положительный результат при лечении расстройств ЖКТ и запоров. Препарат назначается в форме порошка для разведения детям от 2-3 лет трижды в день.

После рождения кишечник новорожденного не содержит никаких бактерий, их заселение происходит в процессе взросления. Новорожденным Бифидумбактерин назначается по следующими правилам:

  • в случае искусственного вскармливания лекарство смешивают со смесью, придерживаясь точной дозировки, или дают отдельно;
  • препарат смешивают с водой или грудным молоком;
  • помимо запоров, лекарство используется в терапии дисбактериоза;
  • для получения максимального эффекта пробиотик рекомендуется давать во время кормления с первых дней жизни.

Несмотря на полезный состав и отсутствие побочных эффектов, препарат может назначить только врач.

Аналоги

Фармацевтический рынок предлагает широкий выбор аналогов Бифидумбактерина, отличающихся между собой составом и спектром действия. К ним относятся:

  • Пробифор – помогает при запорах и диарее, выпускается в форме порошка и капсул;
  • Лактобактерин – назначается при серьезных заболеваниях ЖКТ, помогает избавиться от вздутия живота, повышенного газообразования и запоров, нормализует работу пищеварительной системы;
  • Бифинорм – “вытесняет” патогенные микроорганизмы, улучшает пищеварение, борется с запорами.

Выбор препаратов осуществляется врачом, исходя из возраста и особенностей организма.

Ответы на популярные вопросы

До и во время приема Бифидумбактерина у пациентов могут возникнуть вопросы, поэтому ниже будут даны ответы на самые распространенные.

С какого возраста можно давать Бифидумбактерин детям

Суппозитории, капсулы и таблетки назначаются детям в возрасте от трех лет. Новорожденным препарат разрешен в виде порошка. Предварительно его смешивают с грудным молоком, смесью или водой.

Как быстро подействует Бифидумбактерин

Действие препарата начинается сразу после попадания в кишечник, полезные бактерии, размножаясь, вытесняют патогенную флору, тем самым восстанавливая нормальную. Стул улучшается в течение нескольких дней.

Какие существуют аналоги у препарата

К препаратам с аналогичным действием относятся Бифинорм, Лактобактерин, Пробифор. Выбор зависит от возраста и цели терапии.

Бифидумбактерин крепит или слабит стул

Препарат обладает комплексным действием, способствует нормализации стула и пищеварения, поэтому в зависимости от проблемы пробиотик может слабить или крепить стул.

Может ли быть запор у грудничка от Бифидумбактерина

При непереносимости лактозы и неверном применении препарата у грудничка может возникнуть запор.

Можно ли принимать препарат при лактазной недостаточности

При лактозной недостаточности препарат используется с осторожностью и только по назначению врача.

Отзывы о Бифидумбактерине

Уже спустя 4-7 дней после приема препарата наблюдается нормализация стула и работы пищеварительной системы. Отмечается устранение вздутия живота, повышенного газообразования и метеоризма.

При терапии у маленьких детей улучшение состояния начинает на вторые сутки: ребенок лучше спит, ночью не просыпается от боли в животе, проходит запор. Взрослым рекомендуется, помимо применения медикамента, нормализовать питание, увеличив потребление кисломолочных продуктов.

Бифидумбактерин при грудном вскармливании для мамы

Врач-практик. Закончила в 2012 году с отличием Витебский государственный медицинский университет по специальности «лечебное дело». За достижения в работе удостоена почетной грамоты.

Задать вопрос

Бифидумбактерин разрешен при грудном вскармливании, так как не причиняет вреда младенцу. Однако существуют некоторые противопоказания к приему пробиотика, поэтому самостоятельное употребление мамой лекарственного средства нежелательно, необходима консультация врача.

Можно ли пить Бифидумбактерин при грудном вскармливании

Отравления, воспалительные либо инфекционные процессы часто провоцируют диарею. Накопление токсинов, раздражение слизистых — это показание принимать пробиотики. Медики нередко рекомендуют при ГВ Бифидумбактерин, так как препарат восстанавливает микрофлору в кишечнике.

Курсы лечения Бифидумбактерином помогают кормящей маме увеличить содержание ценных для пищеварения бактерий, улучшить усвоение продуктов в ЖКТ, а также выработку витаминов k и b. Ассортимент медикаментов довольно широк, но некоторые из них для кормящей мамы противопоказаны. Компоненты подобных средств легко проникают в молоко, добавив пробиотики в схему терапии можно невольно нанести вред здоровью грудничка.

Поэтому для кормящей мамы оптимален Бифидумбактерин. Педиатры советуют фармакологический препарат даже в терапии только родившегося малыша для избавления от колик и боли в животе. Применение для грудничков Бифидумбактерина практически безопасно.

Состав и польза Бифидумбактерина при грудном вскармливании

Основной ингредиент Bifidobacterium bifidum. Содержится вспомогательное вещество, усиливающее действие бифидобактерий, активированный уголь. Благодаря этому добиваются неподвижности колонии полезных микроорганизмов и заселение кишечника лактобактериями происходит быстрее.

Выделяют преимущество применения Бифидумбактерина при кормлении грудью. ГВ —стресс для женского организма, приводящий к ослаблению иммунитета. Патогенам легче проникнуть в ткани и приступить к активному размножению, так как роды меняют кислотность влагалища. Пробиотик помогает укрепить естественную защиту, провести своеобразную профилактику мастита и мочеполовых инфекций, вызванных неспособностью организма бороться с болезнетворными бактериями, справиться с проблемами метаболического характера, улучшить состояние ЦНС.

Компоненты лекарственных средств положительно влияют на работу пищеварительной системы и попадают с кровотоком в грудное молоко. Поэтому оказывается непосредственное воздействие на здоровье и малыша, и кормящей мамы. Если женщине врач ничего не прописывал, покупала медикамент самостоятельно по рекомендации подруг, часто развиваются негативные последствия. Необходимы при вскармливании ребенка консультации, тесты, поиски препарата, который эффективен для мамы и безопасен для младенца.

Почему Бифидумбактерин, назначенный маме, полезен малышам:

  1. У новорожденного иммунитет недостаточно развит. Препарат от дисбактериоза кишечника, облегчая состояние женщины, одновременно ускоряет созревание естественной защиты малыша. Проникая в организм вместе с грудным молоком, пробиотик предотвращает размножение вредных бактерий.
  2. Груднички часто страдают от изжоги. Но когда мама применяет препарат, в котором содержатся лактобактерии, симптоматика значительно снижается.
  3. Маленькие детки иногда подвержены хроническим запорам. Если средство использует кормящая женщина, стул укрепляется и у младенца.
  4. Доказана эффективность применения пробиотиков в борьбе с аллергическими реакциями. Присутствие Бифидумбактерина в рационе мамы, практикующей гв первые 2 года после родов, снижает риски экземы у малыша.
  5. У новорожденных, в результате постоянного использования подгузников, возможны опрелости, клиническая картина способствует развитию дрожжевых грибков. Конечно, лактобактерии не могут уничтожить патогена, но они подавляют размножение вредных микроорганизмов.
  6. По статистике, у каждого пятого младенца присутствуют колики, спровоцированные заглатыванием воздуха при кормлении. Это приводит к воспалительному процессу в кишечнике. Врачи отмечают пользу для пищеварительного тракта Бифидумбактерина, который, поставляя необходимые для хорошей работы лактобактерии, снимает клинику.
  7. И маме, и ребенку нужен витамин К для улучшения состояния ЦНС, кожи, пищеварения и обмена веществ. Прием пробиотика стимулирует организм на выработку витамина.
  8. В раннем возрасте у грудничка вероятна младенческая молочница. Дрожжевой грибок поражает соски женщины. Но с молоком инфекция проникает в детскую пищеварительную систему, здоровье подрывается. Часто подобная картина наблюдается, если мама принимала антибиотики, нарушающие микрофлору.

Бифидумбактерин помогает вывести токсичные соединения, улучшает переваривание и усвоение сложных углеводов, обеспечивает противовоспалительный эффект.

Показания к применению

Лекарство назначают независимо от возраста и взрослым, и младенцам. Причинами терапии становятся:

  1. Дисбактериоз, провокаторами которого являются антибактериальное либо гормональное лечение, стрессовые ситуации.
  2. Дисбаланс микрофлоры в результате патологий органов ЖКТ, например, панкреатита, гастрита, холецистита, язвы желудка.
  3. Острая кишечная инфекция, вызванная поражением стафилококками, шигеллой, сальмонеллой.
  4. Наличие колик, запоров, вздутия живота.

Бифидумбактерин часто рекомендуется в комплексном лечении таких проблем, как ревматоидный артрит, онкология толстого отдела, синдром раздраженной кишки, цирроз печени, энцефалопатия, вагинальная инфекция.

Практически при любых формах заболеваний ЖКТ кормящей маме необходимо восстановление микрофлоры. Бифидумбактерин почти не оказывает негативного влияния на ребенка и быстро нормализует состояние женщины, поэтому может использоваться в терапии.

Противопоказания и побочные эффекты

Лекарственное средство имеет хорошую переносимость. Иногда женщины жалуются на запоры от Бифидумбактерина. Но такая картина развивается не в результате приема пробиотика, скорее всего, на фоне терапии нарушались основные правила грамотного рациона — пили недостаточный объем воды, употребляли много плотной пищи.

В редких случаях у пациента развивается аллергическая реакция на отдельные компоненты. Например, у грудничка возможно раздражение кожного покрова, если мама принимает пробиотик, не прекращая вскармливания. При появлении подобной симптоматики следует остановить прием и с помощью врача подобрать аналогичный препарат, не провоцирующий негативного воздействия.

Такая картина наблюдается, если в организме малыша не продуцируется лактаза, необходимая для правильного переваривания и усвоения молочного сахара. Но подобный эффект развивается, когда применяют лекарство, выпускаемое в ампулах либо флаконах. Содержащиеся бактерии выращиваются в молочной среде, что при отсутствии лактазы и становится причиной усиленного метеоризма, болезненных колик.

Риски существенно снижаются, если мама использует порошок Бифидумбактерин Форте. Но это средство запрещено хранить продолжительное время, так как легко спровоцировать отравление.

Способ применения и дозы при грудном вскармливании

В каком объеме используют Бифидумбактерин, можно узнать из инструкции. Но лучше предварительно проконсультироваться с врачом, который скорректирует схему приема с учетом индивидуальных показаний.

Как применять Бифидумбактерин кормящим мамам:

  1. Взрослым рекомендуют до 2 пакетиков порошка, размешанных в теплой воде или кисломолочном продукте, 3–4 раза на протяжении суток. Выпивают за полчаса до трапезы. Показано лечение 3–4 недели.
  2. При хронических патологиях кишечника нередко используют для клизмы. В 30–40 мл теплой и заранее прокипяченной воды растворяют 2–3 пакетика. Нужно ввести средство в анальный проход с помощью груши после основной очистки. Выполняют 10 дней по 1 разу.
  3. Для обработки влагалища порошок из 2 упаковок соединяют с 15–20 мл воды и пропитывают стерильный тампон. Продолжительность процедуры 2–3 часа, делают утром либо вечером 1–1,5 недели.
  4. При мастите размешивают содержимое 1 саше в 10–15 мл воды и обрабатывают соски за 20–30 минут до кормления ребенка. Терапия занимает не меньше 5 суток.

Если маме необходим повторный курс, делают перерыв в 1 месяц.

Форма выпуска, условия и сроки хранения

В аптеках можно приобрести несколько разновидностей Бифидумбактерина:

  • свечи;
  • ампулы;
  • флаконы;
  • порошок.

В составе живые и сухие лактобактерии, питательная среда из желатина, сахара и молока. Но в порошковой форме молочного компонента нет, что и позволяет снизить риски аллергии при дефиците лактазы.

Срок годности не превышает полутора лет. Хранят при температурном режиме, не превышающем 10 градусов.

Заключение

Если при грудном вскармливании маме приходится лечить заболевания ЖКТ, лучше воспользоваться проверенным средством — Бифидумбактерином. Такая терапия облегчает усвоение продуктов: мяса, напитков, овощей. Одновременно снижаются риски дисбактериоза, обострения хронических патологий. Средство не оказывает негативного влияния на грудничка, но может иногда провоцировать аллергические реакции. Поэтому лечение рекомендовано проводить под контролем врача, внимательно придерживаясь инструкции для новорожденных и взрослых пациентов.

формы выпуска и дозировка, показания к приему, инструкция по применению

Уникальное средство бифидумбактерин для новорождённых — настоящая панацея для решения начинающихся проблем с животиком. Непременным условием воспитания здоровых детей является знание родителями природы и проявлений болезненных состояний своего малыша, умение своевременно распознать эти проявления, приходить на помощь и, наконец, просто не навредить ребёнку в искреннем стремлении помочь ему.

Особенности кишечника грудного ребёнка

К сожалению, многие заболевания детей, особенно в первые годы жизни, обуславливаются образом питания. Ребёнок появляется на этот свет беспомощным и незрелым, и пройдёт много лет, прежде чем процессы в организме младенца установятся окончательно. Желудочно-кишечный тракт не будет сформирован должным образом, если в младенчестве отсутствовало естественное грудное вскармливание.

Кишечный тракт у новорождённых стерилен, но практически с первых дней жизни начинается заселение его микроорганизмами. При нормальной лактации и вскармливании ребёнка грудью в кишечнике преобладает бифидум-флора и в малых количествах содержатся кишечная палочка, ацидофильные и другие бактерии. По мере изменения характера питания микрофлора наполняется кишечными палочками, она преобладает у детей, находящихся на смешанном или искусственном вскармливании.

Нормальная кишечная флора — это:

  • отлаженная пищеварительная функция;
  • своевременные синтетические процессы;
  • особая защита.

В рамках первой функции происходит расщепление полученной пищи для дальнейшего ее усвоения организмом. Для второй характерно осуществление синтеза витаминов группы В, РР, К и биотина. Синтетическая функция наиболее изменчива и уязвима, так как под влиянием неблагоприятных факторов может снижаться либо полностью прекратиться. Также кишечная микрофлора является своеобразным барьером для болезнетворных бактерий.

При дефиците бифидобактерий происходит угнетение иммунобиологических сил организма, так как нарушаются процесс пищеварения, всасывания и все виды обмена. В частности, снижается усвоение кальция, витамина К, страдает витаминосинтезирующая функция кишечной микрофлоры.

Лекарство для новорождённых

Одной из наиболее распространённых проблем в первый год жизни ребенка являются кишечные колики, приносящие огромный дискомфорт как самому малышу, так и молодым родителям. Помимо колик, неокрепший детский кишечник подвержен вздутиям, повышенному газообразованию, нарушениям стула. Обязательным пунктом в начале лечения является консультация детского врача. Одним из рекомендуемых специалистами препаратов является бифидумбактерин.

В число наиболее распространённых проблем входят:

  1. Вздутие.
  2. Кишечная колика.
  3. Понижение аппетита.
  4. Отсутствие набора веса.
  5. Плохой прерывающийся сон.
  6. Срыгивания, превышающие норму.

Безусловно, организм новорождённого со временем сам справляется с этими недугами, полезные бактерии возьмут верх, установится равновесие, и пищеварительные процессы придут в норму. Вместе с тем малыш успокоится и забудет о болях. Среди педиатров закрепилось мнение о том, что проблемы заселения микрофлоры младенцев уходят после первых трёх месяцев жизни. Однако каждый организм индивидуален, указанные сроки могут как сократиться, так и увеличиться. При кормлении грудью кишечник ребёнка быстрее и легче проходит адаптацию, при смешанном или полностью искусственном вскармливании эти процессы занимают более длительный период.

В группе риска чаще всего находятся:

  • недоношенные дети;
  • младенцы с недобором нормального веса;
  • малыши, получившие родовую травму;
  • аллергики;
  • младенцы, мамы которых были подвержены гестозу беременных либо страдают хроническими заболеваниями;
  • дети, появившиеся на свет при помощи кесарева сечения.

Ошибочно ждать, когда дисбактериоз пройдёт сам собой. В первую очередь необходимо обратиться к врачу и получить назначения для проведения терапевтических мер. Если обнаружен дефицит полезных бактерий, педиатры рекомендуют применять бифидумбактерин для новорождённых. Это комплексный препарат, который благотворно влияет на микрофлору кишечника, если его правильно принимать. С помощью этого лекарства можно восполнить дефицит полезных бактерий. Одновременно бифидум — это иммуномодулирующий препарат.

Показаниями к его применению являются:

  1. Профилактика и лечение различных дисбактериозов кишечника.
  2. Профилактика больничных инфекций и дисбиозов.
  3. Предупреждение нарушений кишечной флоры до и после хирургических процедур.
  4. Перевод на искусственное или смешанное вскармливание.
  5. Симптомы малокровия, рахита, аллергии, диатеза.
  6. Воспалительные заболевания, болезни, сопровождающиеся гнойно-септическими процессами.
  7. Острые инфекции кишечника вследствие жизнедеятельности ротовирусных бактерий, сальмонелл, шигелл.
  8. Пищевые отравления, размножение стафилококковых бактерий.
  9. Хронические нарушения стула, в том числе запоры или диареи, возникшие на фоне антибиотикотерапии.
  10. Нарушение всасывания питательных веществ, витаминов и микроэлементов в тонком кишечнике.

Как и любой другой лекарственный препарат, назначаемый лечащим врачом, бифидумбактерин обладает рядом ограничений к применению и лечению нарушений кишечной микрофлоры.

Противопоказания к приему бифидумбактерина:

  • Индивидуальная непереносимость.
  • Аллергическая реакция.
  • Непереносимость лактозы.

Лактазная недостаточность — это отторжение лактозы при усвоении питательных веществ. Препарат предлагает различные формы выпуска для решения этой проблемы.

Бифидумбактерин обладает иммуномодулирующим эффектом и содержит бифидобактерии, которые находятся в высушенном состоянии и при этом сохраняют свою активность. Такой эффект достигается за счёт лиофилизации, такого метода бережного высушивания, при котором исходный препарат сначала замораживается, а потом помещается в вакуумную среду, где и происходит сублимация растворителя. Это способствует сохранению дисперсной фазы исходного продукта.

Правила приёма бифидумбактерина

Указанное лекарство имеет несколько форм, которые можно приобрести в аптечных сетях. Непосредственно для грудничков существует бифидумбактерин форте. Помимо него, есть препарат в ампулах, в небольших стеклянных флаконах, в виде порошка, таблеток и свечей. Дозировка разная, в зависимости от лекарственной формы, рассчитывается исходя из индивидуальных показателей больного.

Препарат бифидумбактерин в ампулах инструкция для новорождённых предписывает употреблять в разбавленном виде, в лечебных целях назначается по 5 доз два или три раза в сутки. Исходя из того, что содержимое одной ампулы эквивалентно пяти дозам, на одну приходится кратное количество чайных ложек жидкости — молока, кипячёной воды, готовой смеси, затем готовый препарат разделяется на 2−3 приёма.

Хранить сухой препарат необходимо в сухом тёмном месте при температуре не выше 10 градусов около десяти дней. Хранение разведённого готового продукта недопустимо, употребить его необходимо в течение нескольких часов после разведения.

В отношении бифидумбактерина инструкция по применению для грудничков предписывает приём за тридцать минут до кормления. В случае терапии при дисбактериозе принимать лекарство нужно три раза за один день. В среднем курс лечения длится не более 21 дня, повторять его нужно не ранее чем через тридцать дней. Длительность приёма препарата рассчитывается исходя из состояния микрофлоры кишечника малыша.

Результаты терапии видны уже после трёх дней приёма. Разводить сухое лекарство удобнее всего в чайной ложке, условно разделив исходный препарат на три порции, отдельно растворять одну дозу на приём. Неразведённый препарат в открытом флаконе можно хранить в холодильнике не более суток.

Температура жидкости для разведения одной порции лекарства должна быть не выше сорока градусов, в противном случае полезные бактерии погибнут.

Расчёт дозы для грудничков

Согласно прилагаемой инструкция по применению бифидумбактерина, на один флакон неразведенного сухого вещества приходится пять доз.

Таким образом, получается две или три порции сухого препарата, каждую из которых отдельно необходимо размещать в пяти миллилитрах жидкости, что эквивалентно объёму чайной ложки. Так, в одной чайной ложке будет содержаться порция необходимая для однократного приёма.

В составе лекарственного препарата содержится масса живых бифидобактерий в количестве, равном 10*7 в ампулах и флаконах и 10*8 в форме порошка.

Бифидум является пробиотиком и содержит живые активные бифидобактерии в различных видах. Различают препарат с приставкой форте и без нее. В бифидумбактерине форте полезные микроорганизмы иммобилизованы на косточковом активированном угле, в других же препаратах используют защитную сахарно-желатиново-молочную среду для выращивания. Форму приема препарата и дозировку устанавливает лечащий врач.

Отзывы пациентов

Как давать бифидумбактерин грудничку, понять не могла. Методом проб и ошибок пошла, потом мама все объяснила. Препарат принимали по схеме, сыночек счастлив, животик больше не мучает, я выспалась… Да, ещё, пришла в аптеку, говорю, что нужно бифидумбактерин бэби, а провизор отвечает, что нет такого, только бифиформ бэби, а бифидумбактерин есть обычный и есть форте, не перепутайте.

Виктория Г.

Инструкция по применению бифидумбактерина во флаконах не совсем доступно изложена. Проще говоря, берётся флакон, делится на три приёма, каждая порция разводится отдельно. Сухой ставится в холодильник до следующего приёма, разбавленный сразу нужно выпить. Получается, что одного флакона хватает на 2−3 раза. Ребёнку помог хорошо, уже на вторые сутки стал меньше капризничать после кормлений, ночью сон намного спокойнее, перестала бояться ночных пробуждений, чтобы покушать. В целом лекарство рекомендуют и многие педиатры, и знакомые мамочки очень хвалят. Проверила лично, даже сама пробовала, все отлично.

Анна Зато

Согласно отзывам, препарат бифидумбактерин для новорождённых прекрасно справится с проблемами пищеварения неокрепшего кишечника и избавит молодых мам от истерик и капризов малышей, поможет решить вопрос с нарушениями сна из-за колик и вздутий, облегчит ночные кормления. Он содержит миллионы полезных бактерий, которые восстанавливают и улучшают работу желудочно-кишечного тракта. Многообразие форм выпуска предоставляет большой выбор способов употребления препарата, удобных для совсем юных пациентов.

Поможет в преодолении проблем после приёма антибиотиков и эффективно устранит проявления аллергии на фоне приёма лекарства или ввода нового прокорма. Работоспособность ЖКТ и поддержание его здорового состояния — это первый кирпичик в построении крепкого и сильного организма, залог хорошего самочувствия и прекрасного настроения малыша.

Лактазар для взрослых и детей старше 7 лет

ЛАКТАЗАР® для взрослых и детей старше 7 лет за счёт лактазы в составе позволяет полноценно включать в рацион молочные продукты при лактазной недостаточности, вызывающей дискомфорт в кишечнике, повышенное газообразование и неустойчивый стул.

ЛАКТАЗАР® для взрослых и детей старше 7 лет. В чём преимущества состава?

  • В отличие от симптоматических средств при дискомфорте в кишечнике и вздутии, активный компонент - лактаза в составе ЛАКТАЗАР® воздействует на истинную причину неприятных симптомов – восполняет недостаток фермента при лактазной недостаточности.
  • Благоприятный профиль безопасности.
    Компоненты в составе ЛАКТАЗАР® действуют только на лактозу в составе молочных продуктов, помогая её усвоить, и не оказывают системного влияния.
  • ЛАКТАЗАР® - бренд №1 на рынке средств лактазы*.

Что такое лактаза?

Это фермент, необходимый для усвоения лактозы («молочный сахар» - важный элемент для развития нервной системы и зрительного аппарата).

Что происходит в кишечнике при лактазной недостаточности?

  • Не полностью переваренная лактоза поступает в толстый кишечник, где начинает бродить с повышенным образованием газов, и способствует развитию нарушения стула и дисбактериоза.
  • Скопившиеся газы  приводят  к развитию чувства вздутия и дискомфорта в животе, нарушению стула.

Рекомендации по применению

Взрослым и детям старше 7 лет по 1 капсуле при приеме молока или пищи, содержащей молоко, молочные продукты или углевод лактозу.

Капсулу можно принять внутрь, можно вскрыть капсулу и добавить ее содержимое в еду или в молоко.

Вопрос-ответ

Сколько раз в день нужно принимать Лактазар? В инструкции точно не написано количество раз в день.

Согласно официально утвержденным рекомендациям по применению, Лактазар принимается при каждом приеме молока или пищи, содержащей молоко, молочные продукты или углевод лактозу.


Каковы причины лактазной недостаточности?

Дефицит лактазы может быть врожденным и приобретенным. Причиной врожденной лактазной недостаточности является наследственная предрасположенность. Приобретенный дефицит возникает на фоне инфекционных и вирусных заболеваний кишечника, пищевой аллергии, атопического дерматита, дисбактериоза, паразитарных инфекций.


Через какое время нужно понижать дозу Лактазара при врождённой лактазной недостаточности?

При врожденной лактазной недостаточности непереносимость лактозы (молочного сахара) сохраняется на протяжении всей жизни, поэтому при употреблении молока или других продуктов с содержанием лактозы необходим дополнительный прием фермента лактазы, например, Лактазара.


Возможно ли применение Лактазара кормящей мамой для того, чтобы фермент попадал ребенку непосредственно через грудное молоко?

Препараты лактазы работают только в просвете кишечника. Субстратом для воздействия лактазы является только лактоза. В кровь фермент не всасывается. Остатки невостребованного фермента выводятся из организма естественным путем с калом. В грудное молоко препарат попасть не может. Следовательно, для того, чтобы восполнить дефицит лактазы у ребенка, Лактазар необходимо давать именно ему, а не кормящей матери.


Другие формы выпуска

Непереносимость лактозы и желудочно-кишечная аллергия на коровье молоко у младенцев и детей - пересмотр распространенных заблуждений

Реферат

Лактоза является основным углеводом в молоке человека и млекопитающих. Лактоза требует ферментативного гидролиза лактазой до D-глюкозы и D-галактозы, прежде чем она сможет абсорбироваться. Доношенные младенцы выделяют достаточно лактазы, чтобы переваривать около одного литра грудного молока в день. Психологическая мальабсорбция лактозы в младенчестве оказывает положительное воздействие на пребиотики, включая формирование фекальной микробиоты, богатой бифидобактериями.Во многих популяциях уровень лактазы снижается после отлучения (непостоянство лактазы; LNP). LNP поражает около 70% населения мира и является физиологической основой первичной непереносимости лактозы (LI). Сохранение лактазы после младенчества связано с несколькими однонуклеотидными полиморфизмами в промоторной области гена лактазы на хромосоме 2. Первичный LI обычно не проявляется клинически до 5-летнего возраста. ЛИ у детей раннего возраста обычно вызывается основными заболеваниями кишечника, такими как вирусный гастроэнтерит, лямблиоз, энтеропатия коровьего молока, глютеновая болезнь или болезнь Крона.Таким образом, ЛИ в детстве в основном носит временный характер и улучшается по мере разрешения основной патологии. Продолжается путаница между LI и аллергией на коровье молоко (CMA), что по-прежнему приводит к неправильному диагнозу и неправильному соблюдению диеты. Кроме того, предполагаемый LI может вызвать ненужное ограничение молока и неблагоприятные последствия для питания. Лечение LI включает сокращение, но не полное устранение лактозосодержащих продуктов. Напротив, младенцы, находящиеся на грудном вскармливании с подозрением на ХМА, должны пройти испытание строгой исключающей материнской диеты, не содержащей белков коровьего молока.Если младенец не находится на грудном вскармливании, стандартным лечением CMA являются смеси с сильным гидролизом или на основе аминокислот и строгий отказ от коровьего молока. Большинство младенцев с CMA могут переносить лактозу, за исключением случаев энтеропатии с вторичной лактазной недостаточностью.

Ключевые слова

Мальабсорбция

Углеводы

Энтеропатия

Аллергия на коровье молоко

Целиакия

Гастроэнтерит

Рекомендуемые статьиЦитирующие статьи (0)

Авторские права © 2017 Автор (ы).Опубликовано Elsevier Inc.

Рекомендуемые статьи

Цитирующие статьи

Непереносимость лактозы у детей: общие сведения, патофизиология, эпидемиология

Автор

Стефано Гуандалини, доктор медицины Основатель и медицинский директор Центра глютеновых болезней, руководитель отдела детской гастроэнтерологии, гепатологии и питания, Департамент педиатрии, Медицинский центр Чикагского университета; Профессор кафедры педиатрии, отделение гастроэнтерологии, гепатологии и питания, Отделение биологических наук Чикагского университета, Медицинская школа Притцкера

Стефано Гуандалини, доктор медицины, является членом следующих медицинских обществ: Американская гастроэнтерологическая ассоциация, Европейское общество Детская гастроэнтерология, гепатология и питание, Североамериканское общество детской гастроэнтерологии, гепатологии и питания, Североамериканское общество по изучению целиакии

Раскрытие: Ничего не разглашать.

Соавтор (ы)

Ричард Э. Фрай, доктор медицины, доктор наук Профессор детского здоровья, Медицинский колледж Университета Аризоны в Фениксе; Заведующий отделением нервно-психических расстройств, директор программ по аутизму и синдрому Дауна и ломкой Х-хромосоме отдела неврологических расстройств отделения неврологии Неврологического института Барроу Детской больницы Феникса

Ричард Э. Фрай, доктор медицины, доктор философии является членом следующих медицинских обществ: Американская академия неврологии, Американская академия педиатрии, Общество детской неврологии

Раскрытие информации: нечего раскрывать.

Делия М. Ривера, доктор медицины Доцент кафедры педиатрии, отделение инфекционных заболеваний и иммунологии, Медицинский факультет Университета Майами Леонарда М. Миллера

Делия М. Ривера, доктор медицины, является членом следующих медицинских обществ: Американской академии наук Педиатрия, Американское общество микробиологии, Общество педиатрических инфекционных болезней

Раскрытие: Ничего не разглашать.

Стивен М. Боровиц, доктор медицины Профессор педиатрии и наук об общественном здравоохранении, Департамент педиатрии, Отделение детской гастроэнтерологии, гепатологии и питания, Медицинский факультет Университета Вирджинии

Стивен М. Боровиц, доктор медицинских наук, является членом следующих медицинских организаций: общества: Американская академия педиатрии, Американская гастроэнтерологическая ассоциация, Американское педиатрическое общество, Североамериканское общество детской гастроэнтерологии, гепатологии и питания, Общество педиатрических исследований

Раскрытие: Ничего не раскрывать.

Специальная редакционная коллегия

Мэри Л. Виндл, PharmD Адъюнкт-профессор, Фармацевтический колледж Медицинского центра Университета Небраски; Главный редактор Medscape Drug Reference

Раскрытие информации: нечего раскрывать.

B UK Li, MD Профессор педиатрии, отделение гастроэнтерологии, гепатологии и питания, Медицинский колледж Висконсина; Лечащий гастроэнтеролог, директор программы циклической рвоты, Детская больница Висконсина

B Великобритания Ли, доктор медицинских наук, является членом следующих медицинских обществ: Alpha Omega Alpha, Американская гастроэнтерологическая ассоциация, Североамериканское общество детской гастроэнтерологии, гепатологии и питания

Раскрытие информации : Нечего раскрывать.

Главный редактор

Кармен Каффари, доктор медицины Доцент кафедры педиатрии, отделение гастроэнтерологии / питания, Медицинский факультет Университета Джона Хопкинса

Кармен Каффари, доктор медицины, является членом следующих медицинских обществ: Американского колледжа гастроэнтерологии, Американской гастроэнтерологической ассоциации, Североамериканское общество детской гастроэнтерологии, гепатологии и питания, Королевский колледж врачей и хирургов Канады

Раскрытие информации: Получено гонорар от лабораторий Прометея за выступления и обучение; Получал гонорары от Abbott Nutritionals за выступления и преподавание.для: Abbott Nutritional, Abbvie, спикеры.

Дополнительные участники

Эрик С. Маллер, доктор медицины

Эрик С. Маллер, доктор медицинских наук, является членом следующих медицинских обществ: Американской ассоциации по изучению заболеваний печени, Американской гастроэнтерологической ассоциации, Американского общества хирургов-трансплантологов, Североамериканского общества детской гастроэнтерологии, Гепатология и питание

Раскрытие информации: раскрывать нечего.

пробиотиков и непереносимость лактозы | Профессионалы

Что такое непереносимость лактозы?

Непереносимость лактозы - это неспособность организма переваривать лактозу, которая является одним из видов натурального сахара, содержащегося в молоке и молочных продуктах. Чтобы лактоза легко всасывалась в кровоток, она расщепляется в тонком кишечнике на два моносахарида - глюкозу и галактозу - с помощью фермента, известного как лактаза.

Лактоза - это тип натурального сахара, который содержится в молоке и молочных продуктах, таких как сыр и йогурт

Когда лактазы недостаточно для расщепления лактозы в тонком кишечнике, непереваренная лактоза перемещается в толстую кишку, где она метаболизируется бактерии.Этот метаболический процесс приводит к образованию короткоцепочечных жирных кислот и газов, таких как водород, углекислый газ и метан. Этим можно объяснить некоторые желудочно-кишечные симптомы непереносимости лактозы, такие как метеоризм, вздутие живота и спазмы желудка 1 . Непереваренная лактоза также способствует повышению кислотности в толстой кишке и увеличивает осмотическое давление, что может вызвать диарею 1, 2 .

С точки зрения того, как долго лактоза выводится из организма и как долго длятся симптомы, это зависит от человека к человеку в зависимости от различных факторов, таких как количество проглоченной лактозы и время опорожнения желудка. 2 .

Может ли со временем развиться непереносимость лактозы?

Многие люди задают вопрос: «Можно ли со временем стать непереносимым лактозой?», И ответ положительный: непереносимость лактозы может развиться в любой момент жизни 2 .

Большинство людей рождаются со способностью переваривать лактозу, поскольку активность лактазы наиболее высока в первые годы жизни; однако известно, что активность лактазы со временем снижается. Это известно как первичная лактазная недостаточность / непостоянство.Считается, что эта форма лактазной недостаточности генетически запрограммирована и связана с возрастом, поскольку ген, отвечающий за выработку лактазы (ген LCT), постепенно становится неактивным. Обычно он появляется в возрасте от 5 до 20 лет 1, 3 .

Повреждение тонкого кишечника, в котором вырабатывается лактаза, также может привести к форме дефицита лактазы, называемой вторичной недостаточностью лактазы. Это повреждение может возникнуть в результате гастроэнтерита, воспалительного заболевания кишечника (ВЗК), инфекций и недоедания.

Некоторые люди задаются вопросом, может ли непереносимость лактозы исчезнуть, и можно ли исправить или вылечить ее. Ну, это действительно зависит от причины непереносимости лактозы. Первичная недостаточность / непостоянство лактазы генетически запрограммирована, и снижение активности лактазы не может быть обращено вспять, поэтому на данный момент нет лекарства от этого. Тем не менее, вторичный дефицит лактазы, вызванный повреждением тонкой кишки, иногда может быть устранен. Лечение повреждения тонкой кишки может улучшить толерантность к лактозе, когда кишечная стенка заживает 3 .У этих людей непереносимость лактозы со временем может улучшиться.

Люди с непереносимостью лактозы могут испытывать такие симптомы, как метеоризм, вздутие живота, спазмы желудка и диарея после употребления пищи или напитков, содержащих лактозу

Людям с непереносимостью лактозы может потребоваться избегать продуктов, содержащих большое количество лактозы, таких как коровье молоко, сыр и т. Д. другие обработанные пищевые продукты, содержащие молоко или производные молока, такие как сухая сыворотка. При этом не всегда необходимо полностью исключать лактозу из рациона даже после постановки диагноза, поскольку каждый человек будет иметь определенное количество лактозы / молочных продуктов, которые он может переносить, не испытывая симптомов.Таким образом, при тщательном наблюдении люди могут определить типы молочных продуктов и количество лактозы, которые они могут переносить. Ряд исследований также показали, что употребление молочных продуктов, таких как молоко, во время еды, также может снизить вероятность возникновения симптомов после употребления 4 или выбрать кисломолочные продукты - подробнее об этом и почему они могут быть лучше для вас, см. Ниже. вам сложно есть молочные продукты.

Следует отметить, что яйца не являются молочными продуктами и не содержат лактозу; однако они часто используются вместе с молочными продуктами во многих продуктах питания, поэтому все же стоит обращать внимание на этикетки пищевых продуктов на основе яиц, поскольку в них могут присутствовать некоторые молочные ингредиенты.

Пробиотики и непереносимость лактозы - полезны ли они?

Это вопрос, который мне часто задают, и я говорю, что данные свидетельствуют о том, что пробиотики вполне могут быть полезны! У каждого человека будет свой уровень толерантности к молочным продуктам, и состав нашей кишечной микрофлоры уникален для каждого человека, но ряд исследований показал, что пробиотики в йогуртовых напитках и немолочных пробиотических добавках могут помочь усвоению лактозы 5 .

Ферментированные молочные продукты, такие как йогурты, как правило, лучше переносятся людьми с непереносимостью лактозы

Ферментированные молочные продукты, содержащие живые культуры, часто лучше переносятся людьми с непереносимостью лактозы, и ряд исследований показал, что эти люди лучше реагируют на йогурты, чем на молоко с молоком. такое же количество лактозы. Одно из объяснений этого заключается в том, что ферментированные продукты могут задерживать опорожнение желудка, что означает, что лактоза может дольше оставаться в тонком кишечнике, и больше лактозы может быть расщеплено, прежде чем она переместится в толстую кишку 5 .Но это также действие пробиотиков, которое может объяснить, почему ферментированные молочные продукты легче перевариваются: ферментация с живыми бактериями приводит к получению уникальной формы лактозы, которая легче переваривается, 3 и многие штаммы пробиотических бактерий также производят бета-галактозидазу фермент, который действует как лактаза и может помочь расщепить лактозу 6 в кишечнике. Узнайте больше по этой теме, прочитав: Почему стоит использовать пробиотические добавки вместо йогуртов?

Итак, если у вас непереносимость лактозы, определенно стоит рассмотреть пробиотики и ферментированные продукты как часть вашего режима здоровья.Но есть ли какие-то штаммы пробиотиков, которые лучше других при непереносимости лактозы?

Лучший пробиотик от непереносимости лактозы

В одном исследовании He et al (2007) оценивалось влияние добавок пробиотиков на микробиоту толстой кишки участников с непереносимостью лактозы. Они обнаружили, что всего после двух недель приема йогурта (с добавлением Bifidobacterium animalis ) и добавки, содержащей Bifidobacterium longum , метаболическая активность в толстой кишке и непереносимость лактозы улучшились.Активность фекальной β-галактозидазы также увеличилась после 2-недельного приема добавок 1 . Метаболизм толстой кишки играет важную роль в непереносимости лактозы, поэтому добавление в рацион пробиотических добавок или продуктов, содержащих живые культуры, может помочь сбалансировать микробиоту и улучшить непереносимость лактозы и пищеварение 3, 5, 7 .

Другое исследование показало, что добавление двух штаммов, Lactobacillus rhamnosus Rosell-11 и Lactobacillus acidophilus Rosell-52, улучшило переносимость молочных продуктов и консистенцию стула у субъектов 8 .Узнайте больше об исследованиях Lactobacillus rhamnosus Rosell-11 и Lactobacillus acidophilus Rosell-52 в базе данных пробиотиков.

Сравнительно недавнее двойное слепое контрольное исследование плацебо оценило эффект Lactobacillus acidophilus DDS-1 на облегчение симптомов непереносимости лактозы, таких как диарея, рвота, метеоризм и спазмы в животе. В исследовании приняли участие 38 участников с непереносимостью лактозы, и все они получили возможность принять плацебо и пробиотическую добавку, содержащую 10 миллиардов КОЕ Lactobacillus acidophilus DDS-1, поскольку это было перекрестное исследование с двумя группами.Они обнаружили статистически значимое улучшение показателей диареи, спазмов в животе, рвоты и общих симптомов по сравнению с группой плацебо 7 .

Другие штаммы, такие как Lactobacillus acidophilus LA-05 ® , Lactobacillus acidophilus NCFM ® , Bifidobacterium lactis BB-12 ® , в различных исследованиях было обнаружено, что симптомы и толерантность улучшились. к молочным продуктам в период приема добавок 8, 9, 10 .Подробнее о Lactobacillus acidophilus LA-05 ® , Lactobacillus acidophilus NCFM ® , Bifidobacterium lactis BB-12 ® в базе данных пробиотиков.

Что NHS говорит о пробиотиках для поддержки симптомов?

NHS признает, что определенные типы пробиотиков, такие как Lactobacillus acidophilus , могут помочь уменьшить симптомы непереносимости лактозы. Они рекомендуют пробиотики без йогурта, содержащие л.acidophilus 11 . В целом, существует множество различных штаммов, которые были всесторонне исследованы для поддержки таких симптомов, как диарея, вздутие живота, метеоризм и газы, и, безусловно, стоит попробовать пробиотики для поддержки симптомов. Узнайте больше на сайте Probiotics Learning Lab, прочитав: Что такое ацидофилин?

Итак, если вы боретесь с непереносимостью лактозы, почему бы не попробовать пробиотики? Они безопасны и естественны, и вы можете выбрать определенные сорта, которые с большей вероятностью окажут вам некоторую поддержку.

Для получения более подробной информации обратите внимание на следующее:

База данных пробиотиков: штаммы, исследованные на непереносимость лактозы

Если вам понравилась эта статья, возможно, вам также понравится прочитать:

Пробиотики от вздутия живота

В чем разница между пробиотиками и пищеварительными ферментами?

Список литературы

  1. Й. Дэн, Б. Миссельвиц, Н. Дай и М. Фокс, «Непереносимость лактозы у взрослых: биологический механизм и управление питанием», Nutrients, vol.7, вып. 12. С. 8020-8035, 2015.
  2. R. Mattar, D. F. d. К. Мазо и Ф. Дж. Каррильо, «Непереносимость лактозы: диагностика, генетические и клинические факторы», Клиническая и экспериментальная гастроэнтерология, стр. 113-121, 2012.
  3. Британский фонд питания, «Британский фонд питания», 2009 г. [Интернет]. Доступно: https://www.nutrition.org.uk/nutritionscience/allergy/lactose-intolerance.html?limit=1&start=1. [Доступ 20 февраля 2018 г.].
  4. А. Шаукат, М. Д. Левитт, Б. С.Тейлор, Р. Макдональд, Т. А. Шамлиян, Р. Л. Кейн и Т. Дж. Уилт, «Систематический обзор: эффективные стратегии управления непереносимостью лактозы», Annals of Internal Medicine, vol. 152, нет. 12, стр. 797, 2010.
  5. T. He, MG Priebe, Y. Zhong, C. Huang, HJ Harmsen, GC Raangs, JM Antoine, GW Welling и RJ Vonk, «Влияние добавок йогурта и бифидобактерий на микробиоту толстой кишки у субъектов с непереносимостью лактозы», Журнал прикладной микробиологии, т. 2, вып. 104, стр.595 - 604, 2007.
  6. Д. Х. Джерс, Б. В. Мэтьюз и Р. Э. Хубер, «LacZ β-галактозидаза: структура и функция фермента, имеющего историческое и молекулярно-биологическое значение», Наука о белках, т. 21, нет. 12. С. 1792-1807, 2012.
  7. М. Н. Пакдаман, Дж. К. Удани, П. М. Джанна и С. Майкл, «Влияние штамма лактобацилл DDS-1 на облегчение симптомов непереносимости лактозы - рандомизированное двойное слепое плацебо-контролируемое перекрестное клиническое исследование», журнал Nutrition Journal , т.15, нет. 1. С. 1-11, 2016.
  8. J. Kocián, «Лактобациллы в лечении диспепсии, вызванной дисмикробией различных причин», vol. 40, нет. (c2): S, стр. 79-83, 1994.
  9. Р. Г. Монтес, Т. М. Бэйлесс, Дж. М. Сааведра и Дж. А. Перман, «Влияние молока, инокулированного Lactobacillus acidophilus или закваски для йогурта», Journal of Dairy Science, vol. 78, нет. 8. С. 1657-1664, 1995.
  10. .
  11. Вирта П. и др. «Влияние препарата, содержащего лиофилизированные молочнокислые бактерии, на непереносимость лактозы», 1993 г.
  12. NHS, «Выбор NHS», 2016 г. [онлайн]. Доступно: https://www.nhs.uk/conditions/probiotics/. [Проверено 16 февраля 2018 г.].

Связь между функциональными вариантами лактазы и высоким содержанием Bifidobacterium в кишечнике здоровых японцев

Abstract

Предыдущие исследования показали, что у японцев более высокая численность Bifidobacterium по сравнению с людьми из других стран. Среди возможных факторов, влияющих на состав кишечной микробиоты, в некоторых сообщениях была предложена ассоциация функциональных вариантов гена лактазы с более высокой численностью Bifidobacterium в кишечнике.Однако в эти исследования не были включены японские субъекты. В этом исследовании мы исследовали возможный вклад функциональных локусов лактазы в высокую численность Bifidobacterium в японских популяциях. На основе анализа данных, проведенного с участием 1068 здоровых взрослых японцев, количество субъектов как минимум в семь раз больше, чем указано в доступных онлайн-данных. все субъекты обладали генотипом CC на rs4988235 и GG на rs182549, которые связаны с низкой активностью лактазы.Мы наблюдали положительную корреляцию между потреблением молочных продуктов и содержанием Bifidobacterium в кишечнике. Учитывая предыдущие отчеты, которые показали, что четыре дополнительных функциональных локуса лактазы, rs145946881, rs41380347, rs41525747 и rs86

  • 67 (ss820486563), также связаны с низкой активностью лактазы у японцев, наши результаты предполагают возможный вклад низкой активности лактазы, связанной с генетическими вариациями хозяина. к высокой численности Bifidobacterium в популяции Японии.

    Образец цитирования: Kato K, Ishida S, Tanaka M, Mitsuyama E, Xiao J-z, Odamaki T (2018) Связь между функциональными вариантами лактазы и высоким содержанием Bifidobacterium в кишечнике здоровых японцев. PLoS ONE 13 (10): e0206189. https://doi.org/10.1371/journal.pone.0206189

    Редактор: Бренда А. Уилсон, Иллинойский университет в Урбана-Шампейн, США

    Поступила: 10 июля 2018 г .; Принята к печати: 7 октября 2018 г .; Опубликован: 19 октября 2018 г.

    Авторские права: © 2018 Kato et al.Это статья в открытом доступе, распространяемая в соответствии с условиями лицензии Creative Commons Attribution License, которая разрешает неограниченное использование, распространение и воспроизведение на любом носителе при условии указания автора и источника.

    Доступность данных: Все соответствующие данные находятся в документе и его файлах с вспомогательной информацией.

    Финансирование: Наша работа финансировалась Morinaga Milk Industry Co., LTD., DeNA Life Science, Inc. и модельным проектом префектуры Канагава, связанным с созданием индустрии ME-BYO в 2016 финансовом году.Сотрудники Morinaga Milk Industry Co., LTD., KK, EM, JX и TO, а также сотрудники DeNA Life Science, Inc., SI и MT получали зарплату от каждой компании. Конкретные роли этих авторов сформулированы в разделе «Авторский вклад». Финансирующие организации не играли никакой роли в дизайне исследования, сборе и анализе данных, принятии решения о публикации или подготовке рукописи.

    Конкурирующие интересы: Я ознакомился с политикой журнала, и у авторов этой рукописи есть следующие конкурирующие интересы: Кумико Като, Эри Мицуяма, Цзинь-чжун Сяо и Тошитака Одамаки работали в компании Morinaga Milk Industry Co., Ltd., а также Сатико Исида и Масами Танака работали в DeNA Life Science, Inc. Это не влияет на нашу приверженность политике PLOS ONE в отношении обмена данными и материалами.

    Введение

    Ожидаемая продолжительность жизни населения Японии - одна из самых высоких среди всех стран мира [1]. Обсуждались основные причины долгой жизни в Японии, а среди возможных вариантов - соблюдение правил гигиены, высокий уровень сознательности в отношении здоровья в Японии и японская диета [2].В предыдущих отчетах у здоровых взрослых японцев было более высокое содержание Bifidobacterium по сравнению с людьми из других стран [3–5]. Учитывая, что Bifidobacterium естественным образом населяет желудочно-кишечный тракт (ЖКТ) человека и, как полагают, играет ключевую роль в поддержании здоровья человека [6], более высокая численность этого рода кажется еще одной потенциальной причиной долгой жизни в Японии. На долю Bifidobacterium в микробиоте кишечника влияют многие факторы, такие как возраст хозяина [4], стресс [7] и диета [8].

    Генетические вариации хозяев, связанные с фукозилтрансферазой 2 [9] и лактазой [10–13], как сообщается, вносят вклад в изобилие Bifidobacterium . В частности, функциональный вариант гена лактазы ( LCT ) rs4988235 был связан с изобилием Bifidobacterium в кишечнике во многих сообщениях [14–16]. Наличие генотипа CC в rs4988235 связано с низкой активностью лактазы и неперевариваемым молоком во взрослом возрасте. Поскольку Bifidobacterium ассимилирует лактозу в качестве предпочтительного источника углерода для роста, разумно, чтобы субъекты с генотипом CC в этом локусе имели более высокое содержание Bifidobacterium в кишечнике.Локус rs4988235 в основном описывается как характерный локус, связанный с активностью лактазы у европейцев. Однако этого единственного локуса недостаточно, чтобы объяснить частоту фенотипа лактазы, присутствующего в различных популяциях во всем мире [11]. Другой вариант, генотип GG по rs182549, как сообщается, способствует персистенции лактазы в японско-бразильских и китайских популяциях, чьи генетические фоны более близки к японскому, чем к европейскому [11].Следовательно, локус rs182549 может также вносить важный вклад в активность лактазы в популяции Японии.

    Здесь мы исследовали ассоциации между этими двумя однонуклеотидными полиморфизмами (SNP), которые были описаны как функциональные варианты лактазы, и долей Bifidobacterium в микробиоте кишечника 1068 здоровых взрослых японцев. Кроме того, информация о дополнительных четырех функциональных вариантах лактазы, о которых сообщалось ранее [12,13], но которые отсутствовали в нашем наборе данных, также была включена с использованием данных японского генома, полученных из двух предыдущих исследований [13,17].

    Результаты / обсуждение

    Из 1250 участников, включенных в это исследование, 182 участника были исключены из анализа данных из-за отказа от участия (n = 64), беременности или кормления грудью (n = 7), использования лекарств в течение последних двух недель (n = 96) и несоответствие критериям контроля качества генотипических данных (n = 15, см. материалы и методы). Наконец, в общей сложности было отобрано 1068 здоровых японцев (S1, рис.).

    Обилие Bifidobacterium в микробиоте кишечника Японии было подтверждено секвенированием гена рибосомной РНК 16S.В общей сложности 9 285 977 высококачественных парных последовательностей было получено из 1068 образцов, и было произведено 8 695 ± 2255 (среднее ± стандартное отклонение) считываний на образец. Средняя численность Bifidobacterium составила 6,3 ± 7,8%, что ниже, чем в предыдущих японских отчетах (17,9 ± 15,2% [3], 10,5 ± 11,0% [4], 13,6 ± 17,7% [5]). Это несоответствие может быть связано с различиями в образцах фекалий, экстракции ДНК и методах анализа, включая используемые праймеры [5,18,19], в дополнение к распределению населения в каждом исследовании.Тем не менее, процент численности Bifidobacterium в этом исследовании выше, чем у данных по субъектам во многих других странах [3,20–22]. Предыдущий отчет показал, что численность Bifidobacterium была менее 5% в 9 из 11 стран, в среднем 3,89 ± 5,45% [3]. Относительно более высокая численность Bifidobacterium в микробиоте кишечника японцев была подтверждена нашими данными.

    Затем мы исследовали частоты генотипов двух функциональных вариантов LCT , rs4988235 и rs182549, на предмет персистенции лактазы.Результаты генотипирования показали, что эти два варианта были мономорфными: все испытуемые имели генотип CC на уровне rs4988235 и генотип GG на уровне rs182549 (таблица 1), что связано с низкой активностью лактазы. Эти генотипические частоты для двух вариантов были подтверждены в других 42 и 104 японских образцах из предыдущего отчета [13] и проекта «1000 геномов» [17], соответственно. В дополнение к двум вариантам, четыре других варианта LCT , rs145946881, rs41380347, rs41525747 и rs86

  • 67 (ss820486563), также, как сообщается, влияют на активность лактазы [12,13].К сожалению, в нашем наборе данных генотипа не было информации об этих четырех вариантах; однако мы не наблюдали изменений этих SNP в данных о популяции Японии из двух предыдущих исследований [13,17] (Таблица 1). В таблице 2 показаны частоты неперсистентных генотипов LCT для этих шести SNP в разных популяциях. Только население Восточной Азии, включая население Японии, не имеет вариаций всех этих SNP. Основываясь на этих выводах, все доступные данные, относящиеся к функциональным вариантам лактазы в отношении японского генома, показали, что низкая активность лактазы в японской популяции, по-видимому, способствует более высокой численности Bifidobacterium в японской популяции.

    Предыдущее исследование показало положительную корреляцию между численностью Bifidobacterium в европейской популяции и количеством потребляемых молочных продуктов только у субъектов с генотипом GG на уровне rs4988235 на обратной цепи, что эквивалентно генотипу CC на прямой цепи [ 15]. Этот отчет показывает, что относительно высокое количество лактозы, содержащегося в молочных продуктах, может напрямую достигать кишечника и быть доступным для представителей рода Bifidobacterium из-за низкой активности лактазы.Поэтому мы исследовали связь между потреблением молочных продуктов и численностью Bifidobacterium , используя 1068 японских образцов, все из которых однородно представляли генотип CC. Краткий вопросник по истории диеты (BDHQ) показал, что среднее потребление молочных продуктов среди включенных в исследование субъектов составляло 67,9 ± 61,4 г / 1000 ккал. Наблюдалась значимая положительная корреляция между количеством потребляемых молочных продуктов и относительной численностью Bifidobacterium в кишечнике (r = 0.164, p <0,01, рис. 1 и таблица S1), предполагая связь между более высоким количеством лактозы, полученной из молочных продуктов, и более высоким содержанием Bifidobacterium в кишечнике. Учитывая, что влияние диеты на микробиоту кишечника очень сложное и тот факт, что лактоза не является селективным субстратом для роста бифидобактерий, функциональные варианты монофилетической лактазы у японцев могут частично способствовать значительной положительной корреляции между количеством потребляемой диеты. лактозы и обилие Bifidobacterium в кишечнике.Тем не менее, наш крупномасштабный опрос японцев подтвердил наблюдение, что субъекты европейской популяции с генотипом GG по rs4988235 могли увеличить количество Bifidobacterium в кишечнике, потребляя лактозу [15].

    В заключение, мы продемонстрировали связь шести функциональных вариантов лактазы с относительной численностью Bifidobacterium в кишечнике японцев, используя наш большой набор данных из 1068 субъектов, а также 146 японских геномов, полученных из двух предыдущих отчетов [13,17].Наши крупномасштабные данные показали, что у японцев не было изменений в SNP, связанных с низкой активностью лактазы. Ссылаясь на предыдущий отчет, около 85% японцев страдают непереносимостью лактозы [23]. Основная причина 15% -ного разрыва между фенотипом и генотипом по активности лактазы неясна. В предыдущем отчете было высказано предположение, что три варианта LCT , rs41525747, rs41380347 и rs145946881, которые отличаются от вариантов, которые способствовали активности лактазы в европейских и американских популяциях, являются эффективными функциональными вариантами в Африке и на Ближнем Востоке [11].Поскольку считается, что эффективный локус варьирует в зависимости от происхождения популяции, в японских популяциях могут быть неоткрытые функциональные варианты лактазы.

    Наши результаты предполагают возможный вклад вариантов монофилетической лактазы в более высокую численность Bifidobacterium в популяции Японии (рис. 2). Однако, поскольку лактоза не является селективным субстратом для роста Bifidobacterium в кишечнике, мы должны учитывать другие возможные факторы, такие как различные типы растворимых пищевых волокон в японской диете.Необходимы дальнейшие исследования, чтобы понять механизм, с помощью которого устанавливается состав микробиоты кишечника.

    Рис. 2. Обзор функциональных вариантов LCT .

    Большой набор данных предполагает возможный вклад вариантов монофилетической лактазы в более высокую численность Bifidobacterium в популяции Японии.

    https://doi.org/10.1371/journal.pone.0206189.g002

    Материал и метод

    Объекты исследования и сбор образцов

    Всего в этом исследовании приняли участие 1250 здоровых взрослых японцев в рамках MYCODE Research, исследовательской платформы, основанной на клиентах MYCODE (DeNA Life Science Inc., Токио, Япония), служба персонального генома в Японии. В общей сложности 182 субъекта были исключены из анализа данных на основании следующих критериев (см. Также S1 рис.): 64 субъекта отказались от участия, семь субъектов были беременными или кормящими женщинами, 96 субъектов принимали лекарства в течение последних двух недель и 15 субъектов не соответствовали критериям контроля качества генотипических данных, как подробно описано ниже. Наконец, 1068 участников состояли из 541 женщины и 527 мужчин со средним возрастом 41 год (диапазон 20–64 года) и средним индексом массы тела 21.4 кг / м 2 (межквартильный диапазон 19,7–23,7 кг / м 2 ).

    Все исследование было одобрено этическим комитетом DeNA Life Science Inc. (протокол № 20160727_1) и Институтом медицинских наук Токийского университета (протокол № 28-29-1125) (Токио, Япония).

    Письменное информированное согласие было первоначально получено для исследования MYCODE, охватывающего всесторонние геномные исследования. Затем было получено дополнительное информированное согласие на это конкретное исследование от всех субъектов на веб-сайте MYCODE.

    Для генетического тестирования MYCODE было собрано

    образцов слюны, и эти генетические данные были использованы для этого исследования. Все участники представили свои образцы стула для анализа кишечной микробиоты. Аликвоту образца стула смешивали с 1 мл раствора гуанидинтиоцианата (GuSCN) (TechnoSuruga Laboratory Co., Ltd, Сидзуока, Япония) [24] и отправляли в лабораторию по почте при комнатной температуре. Сразу после получения образцы фекалий хранили при -80 ° C до дня анализа.

    Генотипирование и контроль качества

    Генотипирование SNP выполняли с использованием либо Infinium OmniExpress-24 + BeadChip, либо Human OmniExpress-24 + BeadChip (Illumina Inc., Сан-Диего, Калифорния, США). Основываясь на данных генотипа, всего 15 субъектов были удалены в процессе контроля качества с использованием PLINK версии 1.9 [25] следующим образом: два субъекта с частотой звонков ниже 95%, что указывало на низкую надежность результатов их генотипирования; девять субъектов, которые были одними из пары с долей идентичных по происхождению (ВЗК)> 0.185; что указывает на родство; один субъект демонстрирует несоответствие между полом по самооценке и генотипированным полом; и три субъекта, у которых было установлено неяпонское происхождение с помощью анализа главных компонентов.

    Выделение ДНК из образцов фекалий

    Экстракция ДНК

    из образцов фекалий человека была проведена с использованием метода взбивания шариков, как описано ранее [4] с некоторыми модификациями. Вкратце, 500 мкл образца фекалий в растворе GuSCN интенсивно встряхивали со стеклянными шариками (300 мг; 0.1 мм в диаметре) и 500 мкл насыщенного буфером фенола с использованием Multi-Beads Shocker (Yasui Kikai Co., Осака, Япония) при скорости 2700 об / мин в течение 180 с. После центрифугирования при 10000 × g в течение 10 мин 400 мкл супернатанта экстрагировали фенол-хлороформом и 250 мкл супернатанта осаждали изопропанолом. Очищенную ДНК суспендировали в 1000 мкл буфера Трис-ЭДТА (pH 8,0).

    Секвенирование и обработка данных последовательностей бактериальной 16S рРНК

    Секвенирование гена

    16S рРНК проводили, как описано ранее, с небольшими модификациями [4].Вкратце, область V3-V4 бактериального гена 16S рРНК амплифицировали с помощью ПЦР в трех экземплярах с использованием набора TaKaRa Ex Taq HS (TaKaRa Bio, Shiga, Япония) и наборов праймеров Tru357F (5'-CGCTCTTCCGATCTCTGTACGGRAGGCAGCA G-3 '). Tru806R (5'-CGCTCTCCGATCTGACG-GACTACHVGGGTWTCTAAT-3 ') со следующей программой: предварительный нагрев при 94 ° C в течение 3 минут; 30 циклов денатурации при 94 ° C в течение 30 с, отжига при 50 ° C в течение 30 с и удлинения при 72 ° C в течение 30 с; и удлинение клеммы при 72 ° C в течение 5 мин. А 1-мкл образец комбинированных продуктов ПЦР амплифицировали с помощью праймеров Barcoded адаптирован для Illumina MiSeq последовательности: 5'-Fwd AATGATACGGCGACCACCGAGATCTACACXXXXXXXXACACTCTTTCCCTACACGACGCTCTTCCGATCTCTG-3’ и 5'-Ред CAAGCAGAAGACGGCATACGAGATXXXXXXXXGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTGAC-3 ', где Х представляет собой базу штрих-кода.Амплификацию проводили в соответствии с описанной выше программой, за исключением того, что было выполнено только восемь циклов. Продукты очищали и количественно определяли с помощью набора для очистки ПЦР QIAquick (Qiagen, Валенсия, Калифорния, США) и набора для анализа дцДНК Quant-iT PicoGreen (Thermo Fisher Scientific, Уолтем, Массачусетс, США) в соответствии с протоколами производителя. Равные количества ампликонов объединяли и очищали с помощью набора GeneRead Size Selection Kit (Qiagen) в соответствии с протоколом производителя.Объединенные библиотеки секвенировали с помощью прибора Illumina MiSeq и набора реагентов MiSeq v3 (Illumina Inc., Сан-Диего, Калифорния, США).

    После получения считываний парных концов Illumina программа Bowtie-2 [26] (версия 2–2.2.4) использовалась для удаления считываний, сопоставленных с последовательностью PhiX 174 и сборкой человека 38 (GRCh48) Консорциума референс генома. После этого 3 ’область каждого считывания с показателем качества PHRED менее 17 была обрезана. Обрезанные считывания длиной менее 150 п.н. со средней оценкой качества менее 25 или считывания без парных считываний также удалялись.Обрезанные чтения с парных концов были объединены сценарием fastq-join в EA-Utils [27] (версии 1.1.2–537). Потенциальные химерные последовательности были удалены путем проверки химер на основе ссылок в USEARCH [28] (версия 5.2.32) и в базе данных Genomes OnLine (GOLD) (http://drive5.com/otupipe/gold.tz).

    Нехимерные последовательности анализировали с помощью программного пакета QIIME версии 1.8.0 [29,30]. Для анализа на уровне рода последовательности были отнесены к рабочим таксономическим единицам (OTU) путем выбора OTU с открытыми ссылками [31] с 97% -ным порогом парной идентичности и справочной базы данных Greengenes [32].

    Частоты

    вариантов LCT в различных популяциях по всему миру

    Частоты вариантов LCT в популяциях Японии, Африки, Америки, Восточной Азии, Европы и Южной Азии были получены из данных Phase3browser.1000genomes.org/index.html) [ 17].

    Оценка потребления молочных продуктов с помощью BDHQ

    A BDHQ [33] использовался для оценки пищевых привычек в течение месяца перед сбором образцов.

    Для оценки количества лактозы, содержащейся в рационе человека, мы использовали объединенные данные с категориями «молоко с нормальным содержанием жира» и «молоко с низким содержанием жира» (обозначенные здесь как молочные продукты) после корректировки энергии с использованием метода плотности.

    Статистический анализ

    Все анализы были выполнены с использованием статистического программного пакета IBM SPSS Statistics, версия 22.0 (IBM Corp., Армонк, Нью-Йорк, США). Межгрупповые различия в составе Bifidobacterium анализировали с помощью теста Краскела-Уоллиса.Коэффициент корреляции Спирмена использовался для определения взаимосвязи численности Bifidobacterium с количеством потребляемого молочного продукта. Для всех тестов статистически значимым считалось p <0,05.

    Благодарности

    Мы хотели бы поблагодарить доктора Чин Бун Вонг за ее критический обзор этой рукописи.

    Ссылки

    1. 1. Шваб К., редактор. Отчет о глобальной конкурентоспособности 2017–2018 гг. Всемирный Экономический Форум.2017.
    2. 2. Икеда Н., Сайто Э., Кондо Н., Иноуэ М., Икеда С., Сато Т. и др. Что сделало население Японии здоровым? Ланцет. Elsevier Ltd; 2011; 378: 1094–1105.
    3. 3. Нисидзима С., Суда В., Осима К., Ким С. В., Хиросе Ю., Морита Н. и др. Микробиом кишечника здорового японца, его микробная и функциональная уникальность. ДНК Res. 2016; dsw002. pmid: 26951067
    4. 4. Одамаки Т., Като К., Сугахара Х., Хашикура Н., Такахаши С., Сяо Дж. И др.Возрастные изменения в составе микробиоты кишечника от новорожденного до столетнего: кросс-секционное исследование. BMC Microbiol. BioMed Central; 2016; 16: 90. pmid: 27220822
    5. 5. Хосоми К., Оно Х., Мураками Х., Нацумэ-Китатани Й., Танисава К., Хирата С. и др. Метод получения ДНК из фекалий в растворе тиоцианата гуанидина влияет на профилирование разнообразия микробиоты человека на основе 16S рРНК. Sci Rep.2017; 7: 4339. pmid: 28659635
    6. 6. Ди Джоя Д., Алоизио I, Маццола Дж., Биавати Б.Бифидобактерии: их влияние на состав микробиоты кишечника и их применение в качестве пробиотиков у младенцев. Appl Microbiol Biotechnol. Springer Berlin Heidelberg; 2014; 98: 563–577. pmid: 24287935
    7. 7. Логан А.С., Кацман М. Большое депрессивное расстройство: пробиотики могут быть вспомогательной терапией. Мед-гипотезы. 2005; 64: 533–538. pmid: 15617861
    8. 8. Скотт К.П., Грац С.В., Шеридан П.О., Флинт Г.Дж., Дункан С.Х. Влияние диеты на микробиоту кишечника. Pharmacol Res.Elsevier Ltd; 2013; 69: 52–60. pmid: 23147033
    9. 9. Wacklin P, Mäkivuokko H, Alakulppi N, Nikkilä J, Tenkanen H, Räbinä J, et al. Генотип секретора (ген FUT2) прочно связан с составом бифидобактерий в кишечнике человека. Отто М., редактор. PLoS One. Публичная научная библиотека; 2011; 6: e20113. pmid: 21625510
    10. 10. Блехман Р., Гудрич Дж. К., Хуанг К., Сан К., Буковски Р., Белл Дж. Т. и др. Генетическая изменчивость хозяина влияет на состав микробиома на разных участках тела человека.Genome Biol. Геномная биология; 2015; 1–12.
    11. 11. Маттар Р., Мазо Каррильо. Непереносимость лактозы: диагностика, генетические и клинические факторы. Clin Exp Gastroenterol. 2012; 113.
    12. 12. Итан Y, Джонс Б.Л., Ингрэм СиДжей, Ласточка DM, Томас М.Г. Мировая корреляция фенотипа и генотипов персистенции лактазы. BMC Evol Biol. 2010; 10. pmid: 20144208
    13. 13. Либерт А., Лопес С., Джонс Б.Л., Монтальва Н., Жербо П., Лау В. и др. Распространение аллелей персистенции лактазы во всем мире и комплексные эффекты рекомбинации и отбора.Hum Genet. Springer Berlin Heidelberg; 2017; 136: 1445–1453. pmid: 2

      88

    14. 14. Гудрич Дж. К., Давенпорт ER, Бомонт М., Белл Дж. Т., Кларк АГ, Лей RE. Генетические детерминанты кишечного микробиома в переписке близнецов в Великобритании. Клеточный микроб-хозяин. Elsevier Inc .; 2016; 19: 731–743. pmid: 27173935
    15. 15. Бондер М.Дж., Курильщиков А., Тигчелаар Э.Ф., Муджаджич З., Имханн Ф., Вила А.В. и др. Влияние генетики хозяина на микробиом кишечника. Нат Жене. Издательская группа «Природа»; 2016; 1–9.pmid: 27694959
    16. 16. Ротшильд Д., Вайсброд О., Баркан Э., Корем Т., Зееви Д., Костя П.И. и др. Факторы окружающей среды преобладают над генетикой хозяина в формировании состава микробиоты кишечника человека. Природа. Издательская группа «Природа»; 2018; 555: 150540.
    17. 17. Аутон А., Абекасис Г. Р., Альтшулер Д. М., Дурбин Р. М., Бентли Д. Р., Чакраварти А. и др. Глобальный справочник по генетической изменчивости человека. Природа. 2015; 526: 68–74. pmid: 26432245
    18. 18. Маккензи Б.В., Уэйт Д.В., Тейлор М.В.Оценка различий в профилях микробиоты кишечника человека из-за метода выделения ДНК и различий между субъектами. Front Microbiol. 2015; 6: 1–11.
    19. 19. Джовел Дж., Паттерсон Дж., Ван В., Хотте Н., О’Киф С., Митчел Т. и др. Характеристика микробиома кишечника с использованием 16S или метагеномики дробовика. Front Microbiol. 2016; 7: 1–17.
    20. 20. Тандон Д., Хак М.М., Сараванан Р., Шейх С., Шрирам П., Дубей А.К. и др. Снимок кишечной микробиоты взрослого городского населения из западного региона Индии.PLoS One. 2018; 13: 1–20. pmid: 29624599
    21. 21. Ли Дж., Цзя Х., Цай Х, Чжун Х., Фэн К., Сунагава С. и др. Интегрированный каталог эталонных генов микробиома кишечника человека. Nat Biotechnol. 2014; 32: 834–841. pmid: 24997786
    22. 22. Salamon D, Sroka-Oleksiak A, Kapusta P, Szopa M, Mrozińska S, Ludwig-Słomczyńska AH, et al. Характеристики микробиоты кишечника взрослых пациентов с сахарным диабетом 1 и 2 типа на основе анализа фрагмента гена 16S рРНК с использованием секвенирования следующего поколения.Польский Arch Intern Med. 2018; pmid: 29657308
    23. 23. де Врезе М., Стегельманн А., Рихтер Б., Фенселау С., Лауэ С., Шрезенмейр Дж. Пробиотики - компенсация лактазной недостаточности. Am J Clin Nutr. 2001; 73: 421С – 429С. pmid: 11157352
    24. 24. Хисада Т., Эндох К., Курики К. Меж- и внутрииндивидуальные вариации сезонной и суточной стабильности микробиоты кишечника человека на японском языке. Arch Microbiol. Springer Berlin Heidelberg; 2015; 197: 919–934. pmid: 26068535
    25. 25.Перселл С., Нил Б., Тодд-Браун К., Томас Л., Феррейра МАР, Бендер Д. и др. PLINK: Набор инструментов для анализа ассоциации всего генома и популяционного анализа. Am J Hum Genet. 2007. 81: 559–575. pmid: 17701901
    26. 26. Лангмид Б, Зальцберг С.Л. Быстрое согласование с пропуском чтения с Bowtie 2. Натр. Методы. 2012; 9: 357–359. pmid: 22388286
    27. 27. Аронести Э. Сравнение служебных программ секвенирования. Откройте Bioinforma J. 2013; 7: 1–8.
    28. 28. Эдгар Р.К., Хаас Б.Дж., Клементе Д.К., Айва С., Найт Р.UCHIME улучшает чувствительность и скорость обнаружения химер. Биоинформатика. Издательство Оксфордского университета; 2011; 27: 2194–2200. pmid: 21700674
    29. 29. Caporaso JG, Kuczynski J, Stombaugh J, Bittinger K, Bushman FD, Costello EK, et al. соответствие QIIME позволяет анализировать данные секвенирования сообщества с высокой пропускной способностью. Нормализация интенсивности улучшает определение цвета в секвенировании SOLiD. Nat Publ Gr. Издательская группа «Природа»; 2010. 7: 335–336.
    30. 30. Кучински Дж., Стомбо Дж., Уолтерс В.А., Гонсалес А., Капорасо Дж. Г., Найт Р.Использование QIIME для анализа последовательностей гена 16S рРНК из микробных сообществ. Текущие протоколы в биоинформатике. Хобокен, штат Нью-Джерси, США: John Wiley & Sons, Inc.; 2011. с. 10.7.1–10.7.20. https://doi.org/10.1002/0471250953.bi1007s36 pmid: 22161565
    31. 31. Rideout JR, He Y, Navas-Molina JA, Walters WA, Ursell LK, Gibbons SM и др. Кластеризация открытых ссылок с субдискретизацией создает согласованные, исчерпывающие определения OTU и масштабируется до миллиардов последовательностей. PeerJ. 2014; 2: e545. pmid: 25177538
    32. 32.Макдональд Д., Прайс М.Н., Гудрич Дж., Навроски Е.П., ДеСантис Т.З., Пробст А. и др. Улучшенная таксономия Greengenes с явными рангами для экологического и эволюционного анализа бактерий и архей. ISME J. 2011; 6: 610–618. pmid: 22134646
    33. 33. Кобаяси С., Мураками К., Сасаки С., Окубо Х., Хирота Н., Нотсу А. и др. Сравнение относительной достоверности групповых приемов пищи, оцененных с помощью комплексных и кратких анкет по истории диеты, самостоятельно вводимых самостоятельно, с записями о питании за 16 дней у взрослых японцев.Public Health Nutr. 2011; 14: 1200–1211. pmid: 21477414

    Роль пребиотиков в лечении непереносимости лактозы

    Июль 2017 Выпуск

    Роль пребиотиков в лечении непереносимости лактозы - что диетологи должны знать
    Констанс Браун-Риггс, MSEd, RD, CDE, CDN
    Сегодняшний диетолог
    Vol. 19, № 7, стр. 18

    Простые удовольствия - выпить высокий стакан ледяного молока или насладиться большой ложкой мороженого - могут вызвать у многих пищеварительный дискомфорт.До 70% человеческой популяции имеют пониженную способность переваривать лактозу после младенчества.1

    После двухлетнего возраста происходит постепенное снижение фермента лактазы, расщепляющего лактозу в молоке и других молочных продуктах2. Распространенность лактазной недостаточности широко варьируется в разных географических точках по всему миру. В Соединенных Штатах 20% белых людей имеют дефицит лактазы, в то время как от 80% до 100% азиатов имеют дефицит фермента лактазы1. Распространенность лактазной недостаточности составляет от 70% до 95% в Африке и от 15% до 70%. в Европе.1 Люди с дефицитом лактазы подвержены риску непереносимости лактозы. 3 Текущее лечение непереносимости лактозы зависит от степени дефицита лактазы и может включать отказ от лактозы, ограничение количества лактозы, добавление ферментов лактазы или использование пробиотиков. Новые данные свидетельствуют о том, что пребиотики могут быть еще одним вариантом лечения непереносимости лактозы.

    В этой статье описывается непереносимость лактозы, проводится различие между пребиотиками и пробиотиками, обсуждаются последние исследования пребиотиков как средства лечения непереносимости лактозы и предлагаются стратегии для специалистов по питанию, консультирующих клиентов и пациентов с непереносимостью лактозы.

    Определение непереносимости лактозы
    Непереносимость лактозы часто понимают неправильно. Это состояние, при котором у людей возникают расстройства желудочно-кишечного тракта (ЖКТ) после еды или употребления молока или молочных продуктов.

    Во время переваривания молочных продуктов лактаза тонкого кишечника расщепляет лактозу на два более мелких сахара, глюкозу и галактозу, которые легче усваиваются организмом.1

    У людей с дефицитом лактазы тонкий кишечник производит низкий уровень лактазы и не может переваривать много лактозы.1,3 Дефицит лактазы, в свою очередь, может вызывать мальабсорбцию лактозы. При мальабсорбции лактозы непереваренная лактоза переходит в толстую кишку. Оставшаяся непереваренной, лактоза ферментируется микрофлорой толстой кишки в кишечном тракте.1,3 Эта ферментация вызывает неприятные симптомы, такие как вздутие живота, вздутие живота, чрезмерное метеоризм, тошнота и боль в животе. Некоторые люди также могут испытывать диарею.1

    Дефицит лактазы и мальабсорбция лактозы, также известные как нарушение пищеварения лактозы, могут привести к непереносимости лактозы, поскольку уровни лактазы снижены, что может происходить из-за первичной лактазной недостаточности, вторичной лактазной недостаточности, дефицита лактазы развития или врожденного дефицита лактазы.3

    Первичная лактазная недостаточность , также называемая лактазной недостаточностью взрослого типа, является наиболее распространенным типом лактазной недостаточности. У людей с этим заболеванием выработка лактазы постепенно снижается с течением времени после достижения возраста 2,1 года. Однако симптомы могут проявляться только в подростковом или взрослом возрасте.1,3 Исследователи обнаружили, что некоторые люди наследуют гены от своих родителей, которые могут вызывать первичный дефицит лактазы.3

    Вторичная недостаточность лактазы возникает в результате повреждения тонкой кишки, вторичного по отношению к таким заболеваниям, как целиакия, болезнь Крона или эпизоды гастроэнтерита.1 Лечение основной причины обычно улучшает уровень лактазы и толерантности к лактозе.1

    Дефицит лактазы развития может возникнуть у недоношенных младенцев. Это состояние обычно длится непродолжительное время после рождения ребенка3

    Врожденная недостаточность лактазы - чрезвычайно редкое генетически наследуемое заболевание3, обычно описываемое в отчетах из Финляндии. При врожденной недостаточности лактазы тонкий кишечник с рождения вырабатывает мало фермента лактазы или вообще не вырабатывает его.Симптомы непереносимости лактозы возникают вскоре после рождения и исчезают при соблюдении безлактозной диеты.1

    Пробиотики и пребиотики
    Использование пробиотиков и пребиотиков в США продолжает расти. Согласно данным Национального опроса о состоянии здоровья 2012 года, употребление пробиотиков и пребиотиков увеличилось в четыре раза в период с 2007 по 2012 год. Фактически, 4 миллиона взрослых в США использовали пробиотики или пребиотики за 30 дней до исследования4.

    Пробиотики были впервые описаны в 1908 году Эли Мечниковым, которого иногда называют «отцом естественного иммунитета», который предложил регулярное употребление лактобацилл - предшественников современных пробиотиков.5,6 В конце 1800-х - начале 1900-х годов Мечников предположил, что, манипулируя кишечным микробиомом с помощью «благоприятных для хозяина» бактерий, обнаруженных в йогурте, можно улучшить здоровье и отсрочить старение.7

    В 2001 году Совместная рабочая группа Продовольственной и сельскохозяйственной организации Объединенных Наций / Всемирной организации здравоохранения определила пробиотики как живые микроорганизмы, которые при введении в адекватных количествах приносят пользу здоровью хозяина.8 Международная научная ассоциация пробиотиков и пребиотиков усилила это определение как актуально в опубликованном консенсусном заявлении 2014 года.9

    Пробиотики доступны в пищевых добавках и йогуртах, а также в суппозиториях и кремах.4 FDA определяет йогурт как ферментированный молочный продукт, полученный в результате ферментации молока двумя видами бактериальных культур: Streptococcus thermophilus и Lactobacillus bulgaricus .10 «Две заквасочные культуры [ S thermophilus и L bulgaricus ], использованные для производства йогурта, производят β-галактозидазу, которая способствует перевариванию лактозы в кишечнике», - говорит Джо Энн Хаттнер, магистр здравоохранения, RDN, Hattner Nutrition в Сан-Франциско и соавтор Gut Insight: Пробиотики и пребиотики для здоровья и благополучия пищеварительной системы .«Вот почему люди с непереносимостью лактозы часто переносят йогурт больше, чем молоко», - говорит Хаттнер.

    Пребиотики часто путают с пробиотиками. В отличие от пробиотиков, пребиотики не являются бактериями; они стимулируют рост здоровых бактерий в кишечнике. «Пребиотики - это неперевариваемые пищевые ингредиенты, которые выборочно питают пробиотические микробы, обитающие в нашем кишечнике», - говорит Кейт Скарлата, RDN, автор бестселлеров и эксперт по здоровью пищеварительной системы из Массачусетса.Они также описаны как ферментируемые ингредиенты, которые благоприятным образом изменяют состав и активность микрофлоры кишечника.11 Общие пребиотики включают фруктоолигосахариды, галактоолигосахариды (GOS), лактулозу и инулин.1

    Пребиотики также могут играть роль в непереносимости лактозы. Андреа Аскарате-Перил, доктор философии, доцент медицинского факультета Медицинского факультета Университета Северной Каролины (UNC) и директор UNC Microbiome Core Facility, говорит, что «пребиотики [и особенно чистый GOS] оказывают влияние на кишечник. микробиом людей с непереносимостью лактозы.«

    В многоцентровом рандомизированном двойном слепом плацебо-контролируемом исследовании, разработанном для определения влияния короткоцепочечной GOS на непереносимость лактозы, субъекты с самооценкой непереносимости лактозы в анамнезе оценивались с помощью водородного дыхательного теста. Восемьдесят пять человек были случайным образом распределены в группы лечения GOS или плацебо (2: 1). Группа плацебо получала кукурузный сироп (Sweetose). GOS и плацебо увеличивали с пятидневным шагом с 1,5 г до 15 г, потребляемых один раз в день.Субъекты избегали молочных продуктов во время 35-дневного лечения. После завершения периода лечения испытуемые были проинструктированы повторно включить молочные продукты в свой рацион.12 Образцы фекалий были взяты у участников исследования в ходе исследования, чтобы определить изменения в микробиоме кишечника. «Целью исследования было выяснить, изменится ли микробиота кишечника людей с непереносимостью лактозы в ответ на пребиотики и молочные продукты, уменьшая симптомы непереносимости лактозы», - говорит Азкарат-Перил.В конце периода исследования боль в животе уменьшилась на 70% у тех, кто употреблял GOS, и у 90% наблюдалось значительное увеличение ферментирующих лактозу бифидобактерий , известное как бифидогенный ответ.12

    Анализ

    Azcarate-Peril и его коллег показал, что исследование продемонстрировало модуляцию кишечного микробиома пребиотиками у лиц с непереносимостью лактозы. «Мы смогли соотнести Bifidobacterium с симптомами. В частности, у людей, которые сообщили о боли и спазмах, было меньше бифидобактерий .Примерно 70% людей заявили, что чувствуют себя лучше, и около 90% продемонстрировали увеличение полезной Bifidobacterium », - сообщает Azcarate-Peril.

    Хаттнер говорит: «Это было хорошо спланированное испытание на людях, которое продемонстрировало преимущества ферментации. В этом исследовании они продемонстрировали модуляцию кишечного микробиома у людей с непереносимостью лактозы. Однако исследования действительно нуждаются в дублировании». Чтобы расширить размер выборки и глубже изучить, какие изменения происходят в микробиоме при потреблении GOS и молочных продуктов, и насколько устойчивы эти изменения с течением времени, было проведено исследование фазы 2b / 3 с участием 377 человек.Первые результаты этого исследования согласуются с результатами первоначального исследования, и их публикация запланирована на конец этого года.13

    Многие специалисты по питанию рекомендуют клиентам избегать GOS из-за дискомфорта с пищеварением, например, при синдроме раздраженного кишечника (IBS). Известно, что GOS, семейство плохо усваиваемых короткоцепочечных углеводов, содержащихся в бобах (почках, соевых бобах) и орехах, таких как кешью и фисташки, вызывает газообразование. синдром, диета с высоким содержанием GOS может усилить газовые боли и изнуряющие спазмы, - говорит Скарлата.

    Лица с СРК не были включены в вышеупомянутое исследование, хотя результаты показали, что GOS может иметь потенциальные терапевтические преимущества при СРК14

    «Идея изменения микробиоты толстой кишки с помощью диеты для улучшения здоровья и толерантности к пище является интересной и отмеченной областью расширяющихся исследований», - говорит Скарлата. «Использование пребиотиков может предложить другое решение для тех, кто страдает непереносимостью лактозы; тем не менее, я бы применила эти подходы [использование GOS] осторожно и осторожно у пациентов с непереносимостью пищи или СРК в анамнезе, чтобы избежать длительной боли», - говорит она.

    Консультирование пациентов с непереносимостью лактозы
    Когда дело доходит до консультирования пациентов с непереносимостью лактозы, лучше всего использовать командный подход, особенно для людей с вторичной лактазной недостаточностью, когда заживление кишечника обычно восстанавливает толерантность к лактозе. «Диетологи должны работать с пациентом и гастроэнтерологом, чтобы лучше понять потенциальную причину непереносимости лактозы, чтобы обеспечить индивидуальный подход к уходу за пациентом.Например, непереносимость лактозы может быть преходящей из-за избыточного бактериального роста в тонком кишечнике (SIBO). Лечение SIBO антибиотиками может привести к улучшению пищеварения лактозы », - говорит Скарлата. Тем, у кого первичный дефицит лактазы, команда должна работать вместе, чтобы побудить пациента попробовать небольшое количество молочных продуктов во время еды, чтобы замедлить и улучшить переваривание лактозы. Например, приготовьте супы, блины и овсянку из нежирного молока или йогурта.

    Знать содержание лактозы
    Люди различаются по количеству лактозы, которое они могут переносить.В целом, взрослые и подростки с диагнозом «мальабсорбция лактозы» могут переносить не менее 12 г лактозы3. «RDN, работающие с этой группой населения, должны быть осведомлены о различных вариантах безлактозного и низкого содержания лактозы, - говорит Вандана Шет из Калифорнии. RDN, CDE, представитель Академии питания и диетологии, специализирующийся на диабете, контроле веса, расстройствах пищевого поведения, пренатальном питании, пищевой аллергии и различных расстройствах. Как правило, твердые сыры, такие как чеддер или швейцарский сыр, содержат менее 1 г лактозы и переносятся с большей вероятностью, чем стакан молока на 8 унций, в котором содержится от 11 до 13 г лактозы.15 Люди с непереносимостью лактозы также более склонны переносить йогурт, чем молоко, хотя у них может быть аналогичное количество лактозы15. Шет связывает это с живыми культурами йогурта. «Йогурт содержит живые культуры, которые расщепляют лактозу из молока в йогурте. Это помогает минимизировать симптомы желудочно-кишечного дискомфорта, включая вздутие живота и газы, у людей с непереносимостью лактозы», - говорит Шет. Кроме того, Шет предлагает предоставить клиентам список продуктов с указанием содержания в них лактозы.

    Оценить переносимость
    Существует распространенное заблуждение, что клиенты, соблюдающие диету с низким содержанием FODMAP (ферментируемых олигосахаридов, дисахаридов, моносахаридов и полиолов) при СРК, должны ограничивать потребление лактозы.Это верно только в том случае, если у них также диагностирована непереносимость лактозы. Однако, поскольку лактоза является дисахаридом, она удаляется во время фазы выведения диеты с низким содержанием FODMAP. Фаза выведения может длиться от двух до шести недель, после чего постепенно снова вводится лактоза для определения переносимости. Со временем толерантность к FODMAP, включая пребиотики, может измениться. Скарлата говорит: «При работе с пациентами с чувствительностью к FODMAP рекомендуется проводить периодические испытания пищевых продуктов, чтобы помочь пациентам включить больше пребиотических волокон в свой рацион.Включение пребиотических волокон в их рацион осуществляется в соответствии с их личным порогом, чтобы помочь справиться с симптомами, потенциально улучшая здоровье кишечника ».

    Заключительные мысли
    «Учитывая, что у каждого из нас есть свой личный микробный« отпечаток »кишечника, я ожидаю, что диетическая терапия в будущем, вероятно, станет более индивидуализированной», - говорит Скарлата. Текущее лечение непереносимости лактозы зависит от степени лактазной недостаточности и может включать отказ от лактозы, ограничение количества лактозы, добавление ферментов лактазы или использование пробиотиков.Наука о пребиотиках и переваривании лактозы ограничена, но может представлять собой еще один терапевтический вариант для взрослых с непереносимостью лактозы.

    - Констанс Браун-Риггс, MSEd, RD, CDE, CDN, консультант по питанию в Dannon One Yogurt Every Day Initiative; бывший национальный представитель Академии питания и диетологии, специализирующийся на питании афроамериканцев; и автор книги Афроамериканское руководство по здоровому образу жизни с диабетом и Душевное и здоровое питание при диабете .


    Ссылки

    1. Справочник WGO по диете и кишечнику. Сайт Всемирной гастроэнтерологической организации. http://www.worldgastroenterology.org/UserFiles/file/
    WGOHandbookonDietandtheGut_2016_Final.pdf. Опубликовано в 2016 г. Проверено 2 мая 2017 г.

    2. Решают ли пребиотики непереносимость лактозы? Сайт UNC Healthcare. http://news.unchealthcare.org/news/2017/january/are-prebiotics-the-answer-for-lactose-intolerance. По состоянию на 8 мая 2017 г.

    3.Непереносимость лактозы. Веб-сайт Национального института диабета, болезней органов пищеварения и почек. https://www.niddk.nih.gov/health-information/digestive-diseases/lactose-intolerance. Обновлено в июне 2014 г. Проверено 2 мая 2017 г.

    4. Основы пробиотиков. NIH Medline Plus. https://medlineplus.gov/magazine/issues/winter16/articles/winter16pg22.html. Опубликовано в 2016 г. По состоянию на 10 мая 2017 г.

    5. Чаухан С.В., Чоравала MR. Пребиотики, пробиотики и синбиотики. Int J Pharm Sci Res .2012; 3 (3): 711-726.

    6. Гордон С. Эли Мечников: отец естественного иммунитета. Eur J Immunol . 2008; 38 (12): 3257-3264.

    7. Mackowiak PA. Переработка Мечникова: пробиотики, микробиом кишечника и поиски долгой жизни. Фронт общественного здравоохранения . 2013; 1:52.

    8. Продовольственная и сельскохозяйственная организация Объединенных Наций, Всемирная организация здравоохранения. Рекомендации по оценке пробиотиков в продуктах питания. http: // www.who.int/foodsafety/fs_management/en/probiotic_guidelines.pdf. Опубликовано 30 апреля и 1 мая 2002 г. Проверено 2 мая 2017 г.

    9. Hill C, Guarner F, Reid G, et al. Документ о консенсусе экспертов. Согласованное заявление Международной научной ассоциации пробиотиков и пребиотиков относительно области применения и надлежащего использования термина пробиотик. Нат Рев Гастроэнтерол Гепатол . 2014; 11 (8): 506-514.

    10. Министерство здравоохранения и социальных служб США. CFR - Свод федеральных правил, раздел 21.https://www.accessdata.fda.gov/scripts/cdrh/cfdocs/cfcfr/CFRSearch.cfm?fr=131. 200. По состоянию на 10 мая 2017 г.

    .

    11. Рушиньо М., Эфрон А., Питтс Л. мл. Экологическое питание: пребиотики, чтобы прокормить ваши полезные бактерии. Утренний звонок . 18 апреля 2017 г. http://www.mcall.com/features/sns-201704181113--tms--foodstylts--v-e20170418-20170418-story.html. По состоянию на 2 мая 2017 г.

    12. Azcarate-Peril MA, Ritter AJ, Savaiano D, Monteagudo-Mera A, Anderson C, Magness ST.Влияние короткоцепочечных галактоолигосахаридов на микробиом кишечника людей с непереносимостью лактозы. Proc Natl Acad Sci U S A . 2017; 114 (3): E367-E375.

    13. Ritter Pharmaceuticals объявляет о том, что препарат RP-G28 для лечения непереносимости лактозы продемонстрировал эффективность и клинически значимое преимущество в клинических испытаниях фазы 2b / 3. Веб-сайт Market Wired. http://www.marketwired.com/press-release/ritter-pharmaceuticals-announces-lactose-intolerance-treatment-rp-g28-demonstrated-efficacy-nasdaq-rttr-2206020.htm. Опубликовано 28 марта 2017 г. Проверено 2 мая 2017 г.

    14. Данные микробиома непереносимости лактозы фазы 2a компании Ritter Pharmaceuticals, опубликованные в Proceedings of the National Academy of Sciences. Веб-сайт Market Wired. http://www.marketwired.com/press-release/ritter-pharmaceuticals-phase-2a-lactose-intolerance-clinical-trial-microbiome-data-published-nasdaq-rttr-2186048.htm. Опубликовано 3 января 2017 г. Проверено 2 мая 2017 г.

    15. Сухи Ф.Дж., Брэннон П.М., Капрентер Т.О. и др.Конференция по развитию консенсуса Национального института здравоохранения: непереносимость лактозы и здоровье. Энн Интерн Мед. . 2010; 152 (12): 792-796.

    Непереносимость лактозы и грудное вскармливание - Сеть грудного вскармливания

    Эту информацию также можно просмотреть в формате PDF, щелкнув здесь .

    Предоставленная информация взята из различных справочных источников. Он предоставляется в качестве руководства. Автор или Сеть грудного вскармливания не несут ответственности за способ использования информации.Клинические решения остаются в сфере ответственности практикующих врачей и специалистов по грудному вскармливанию. Представленные здесь данные предназначены для предоставления некоторой немедленной информации, но не могут заменить мнения профессионалов.

    Лактоза - это сахар, содержащийся в молоке всех млекопитающих.
    Количество лактозы в грудном молоке не зависит от потребления матерью лактозы и практически не меняется.
    Количество лактазы, фермента, необходимого для расщепления сахара, действительно варьируется.

    Непереносимость лактозы возникает, когда человек не вырабатывает фермент лактазу или не вырабатывает ее в достаточном количестве и, следовательно, не может переваривать лактозу. Если она не переваривается и не расщепляется, лактоза не усваивается. Непереваренная лактоза быстро проходит через кишечник, пока не расщепляется бактериями, производящими кислоты и газ. Производство лактазы снижается у большинства людей с двухлетнего возраста, хотя до шести лет симптомы непереносимости редки.Непереносимость лактозы у взрослых очень распространена. Непереносимость лактозы - это не то же самое, что непереносимость белка коровьего молока (Андерсон).

    Первичная непереносимость лактозы - редкое наследственное нарушение обмена веществ. Это несовместимо с жизнью без медицинского вмешательства и безлактозной диеты. Ребенок с истинной непереносимостью лактозы не сможет развиваться с рождения (то есть даже не начнет набирать вес) и покажет очевидные симптомы мальабсорбции и обезвоживания (Келлимом). Савилахти и др. Выявили только 16 случаев врожденной лактазной недостаточности за 17 лет, несмотря на то, что эти гены очень распространены в Финляндии.В каждом случае мать сообщала о водянистой диарее, как правило, после первого кормления грудью, но в течение 10 дней после рождения. Плохое всасывание лактозы было подтверждено между 3 и 90 днями после родов, когда все младенцы были обезвожены, и 15 из 16 весили меньше, чем при рождении. Все дети, соблюдающие лактозную диету, не отставали от своего роста. Некоторые недоношенные дети временно не переносят лактозу из-за своей незрелости.

    Вторичная непереносимость лактозы может появиться в любом возрасте из-за повреждения щеточных краев вилок кишечника (где вырабатывается лактаза) инфекцией, аллергией или воспалением.Это снижает активность лактазы. Это временное состояние, и устранение причины позволяет кишечнику зажить. Это может также проявиться у ребенка, находящегося на грудном вскармливании, после того, как мать начала использовать антибиотики, но проходит без лечения даже при продолжении грудного вскармливания (Андерсон).

    Медицинские работники должны рекомендовать использование искусственного детского молока без лактозы только в том случае, если ребенок находится на искусственном вскармливании, сильно истощен и / или теряет вес. Грудное молоко остается оптимальным молоком и способствует заживлению кишечника при вторичной непереносимости лактозы (Шульман).Среднее время восстановления кишечника ребенка с тяжелым гастроэнтеритом составляет 4 недели, но может достигать 8 недель для ребенка младше 3 месяцев. Для детей старшего возраста, старше 18 месяцев, выздоровление может занять всего 1 неделю. За медицинской помощью следует обращаться к любому ребенку с долгосрочными симптомами и / или у которого не удается развиваться.

    Непереносимость лактозы часто называют фактором, способствующим коликам, что приводит к прекращению грудного вскармливания и замене смеси на безлактозную смесь. Младенцы с желудочно-кишечными симптомами при контакте с коровьим молоком более склонны к аллергии на коровье молоко, чем к непереносимости лактозы (Джонс)

    Зеленые и пенистые движения кишечника могут быть признаком того, что ребенок получает слишком много лактозы, что имеет быстрое время прохождения через кишечник.Это может быть связано с избытком раннего менее жирного молока или переключением ребенка между грудями перед тем, как опорожнить одну грудь. Младенцы могут быть очень беспокойными и ветреными. У матерей может быть гиперактивный рефлекс подавления.

    Оценка, проводимая опытным работником грудного вскармливания, может быть полезной для обеспечения оптимального удаления молока ребенком, прежде чем рассматривать смеси без лактозы. Дисбаланс передачи молока (вызванный несовершенным прикладыванием) может вызывать аналогичные симптомы: i.е. жидкие дефекации, которые могут быть зелеными и пенистыми. Это связано с быстрым переходом больших объемов молока с низким содержанием жира и, как следствие, с чрезмерным потреблением лактозы (Woolridge 1988). Сдавливание груди, когда ребенок не сосет активно, может улучшить передачу молока.

    Младенцы могут испытывать чрезмерный ветер и дискомфорт в желудке, что может быть диагностировано как непереносимость лактозы, но на самом деле это временный дефицит лактазы, то есть слишком много лактозы для доступной лактазы.

    Добавление ферментов лактазы (Colief®) к грудному молоку было предложено для лечения колик.Канабар и др. (2001) провели исследование 53 младенцев. В состав смеси или сцеженного «грудного молока» добавляли лактазу или плацебо и инкубировали в течение периода перед тем, как дать ребенку. Формулу охлаждали в течение четырех часов, а затем снова нагревали. «Переднее молоко» инкубировали во время кормления и давали в конце кормления. Общее время плача за 10-дневный период лечения сократилось во всех 46, а в 32 послушных семьях достигло статистической значимости. Несоблюдение требований (не определено), возможно, связано с высокой долей англоговорящих людей, для которых английский не является родным.

    Лактоза - это особое питательное вещество для младенцев, обеспечивающее около 40% потребностей ребенка в энергии, способствующее усвоению кальция, магния, цинка и железа, способствующее нормальному здоровому кишечнику за счет стимулирования роста бифидобактерий и обеспечивающее галактозу, которая включается непосредственно в виде галактолипиды в ткани центральной нервной системы (Akre 1990). Соевые смеси не рекомендуются детям младше шести месяцев

    Соевое молоко не рекомендуется в качестве заменителя молока детям до шести месяцев из-за фитоэстрогенов и высокого содержания сахара.Дети, страдающие аллергией на белок коровьего молока, также могут иметь аллергию на соевый белок (главный врач, COT)

    Непереносимость лактозы очень часто встречается у взрослых. Производство лактазы снижается примерно с 2-х летнего возраста, хотя до 6-летнего возраста симптомы возникают редко.

    • Akre J (ed) 1990 Infant Feeding: физиологические основы, дополнение к тому 67 Бюллетеня ВОЗ ВОЗ, Женева. 27-28.
    • Андерсон Дж. Непереносимость лактозы и ребенок, находящийся на грудном вскармливании.www.breastfeeding.asn.au/bf-info/lactose
    • Обновление CMO 37. Соевое молоко (детская смесь) 2007 г. www.dh.gov.uk/en/Publichealth/Nutrition/Nutritionpregnancyearlyyears/DH_127640
    • Комитет по токсичности химических веществ в пищевых продуктах, потребительских товарах и окружающей среде (2003 г.). Фитоэстрогены и здоровье. http://cot.food.gov.uk/sites/default/files/cot/cotlsumphytos.pdf
    • Специализированная смесь для питания младенцев First Steps Nutrition www.firststepsnutrition.org/pdfs/draft_specialised_milks_mar_2013.pdf
    • Джонс В. Рутледж по грудному вскармливанию и лечению 2018
    • Канабар D1, Рандхава М., Клейтон П. Улучшение симптомов колик у младенцев после снижения лактозной нагрузки с помощью лактазы. J Hum Nutr Diet. 2001 Октябрь; 14 (5): 359-63.
    • Непереносимость лактозы у KellyMom http://kellymom.com/health/baby-health/lactose-intolerance/
    • NHS «Непереносимость лактозы» включает пищевые источники лактозы. www.nhs.uk/Conditions/lactose-intolerance/
    • Noble R & Bovey Решение проблемы непереносимости лактозы и колик у детей, находящихся на грудном вскармливании www.health-e-learning.com/articles/Lactose.pdf
    • Савилахти Э., Лауниала К., Куйтунен П. Врожденная недостаточность лактазы. Клиническое исследование с участием 16 пациентов. Arch Dis Child 1983; 58: 246-252
    • .
    • Shulman R, Feste A, Ou C (1995). Всасывание лактозы, полимеров глюкозы или их комбинации у недоношенных детей. Журнал педиатрии, 127, 626-631.
    • Woolridge MW, Fisher C. Колики, «переедание» и симптомы нарушения всасывания лактозы у ребенка, находящегося на грудном вскармливании: возможный артефакт правильного кормления? Lancet

    © Доктор Венди Джонс, MBE, MRPharmS и сеть грудного вскармливания, сентябрь 2019 г.

    продуктов, содержащих лактобациллы и бифидобактерии | Здоровое питание

    Шэрон Перкинс Обновлено 12 декабря 2018 г.

    Многие бактерии живут в вашем кишечнике в паразитарных отношениях, которые приносят пользу и вам, и им.Бактерии Lactobacillus принадлежат к классу бактерий, известных как молочнокислые бактерии. Бифидобактерии производят молочную кислоту как конечный продукт ферментации. Молочнокислые бактерии сбраживают пищу, что снижает уровень pH и предотвращает рост вредных бактерий. В некоторых случаях, например, в некоторых типах йогурта, ферментированные продукты содержат живые культуры бактерий, которые могут оказывать благотворное воздействие на кишечник. Живые культуры бактерий, которые, как известно, оказывают положительное воздействие на желудочно-кишечный тракт, называются пробиотиками. Однако в некоторых случаях бактерии погибают в процессе производства и в результате не имеют пробиотических преимуществ.

    Молочные продукты

    Йогурт - самый известный источник молочнокислых бактерий в Соединенных Штатах. Однако не все йогуртовые продукты содержат значительное количество живых культур лактобактерий или бифидобактерий, поскольку бактерии обычно не выживают в процессе производства. Некоторые йогурты содержат живые культуры, добавленные производителем.

    Национальная ассоциация йогуртов рекомендует использовать печать, указывающую на то, что во время ферментации использовалось минимальное количество живых заквасок.Но наличие этой печати не обязательно означает, что содержащиеся в ней бактерии являются пробиотическими или что они существуют в достаточно больших количествах, чтобы иметь положительные преимущества.

    Если у вас непереносимость лактозы, вы можете обнаружить, что йогурт с живыми культурами легче переваривается, поскольку бактерии производят лактазу, фермент, расщепляющий лактозу. Кефир и пахта - это другие молочные продукты, содержащие активные культуры молочнокислых бактерий.

    Ферментированные овощи

    Многие культуры потребляют ферментированные овощи, такие как квашеная капуста и другие овощи, содержащиеся в корейском кимчи, квашеной капусте и маринованных овощах.Ферментированные овощи, которые не подвергались производственным процессам, убивающим содержащиеся в них лактобациллы, могут иметь пробиотические эффекты.

    Мисо, темпе, умэбоши (разновидность маринованной сливы и соленые огурцы, а также ряд других ферментированных овощей) могут содержать активные культуры лактобацилл, но только если они не пастеризованы или не подвергаются воздействию высоких температур. Ферментированные овощи, производимые в США, обычно пастеризуются.

    Детские смеси

    Некоторые производители добавляют в детские смеси живые культуры пробиотических бактерий, обычно бифидобактерии, чтобы имитировать защитное действие грудного молока на кишечник.Формулы с пробиотиками кажутся безопасными, но их эффективность до конца не установлена.

    Согласно «Уход за младенцем и маленьким ребенком: от рождения до 5 лет, 6-е издание», опубликованным в 2015 году Американской академией педиатрии, преимущества формулы, обогащенной пробиотиками, которые включают профилактику и лечение экземы, профилактика инфекций мочевыводящих путей, инфекционной диареи и облегчение симптомов астмы и пищевой аллергии длится только до тех пор, пока младенец употребляет смесь, обогащенную пробиотиками.

  • Добавить комментарий

    Ваш адрес email не будет опубликован. Обязательные поля помечены *

    *